ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal28d05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL590666.8| Human DNA sequence from clone RP11-66D17 on chro... 44 0.47
2ref|NM_124096.2| Arabidopsis thaliana ATP binding AT5G47250 mRNA... 40 7.4
3ref|XM_868331.1| PREDICTED: Bos taurus similar to cytochrome P45... 40 7.4
4gb|AC102145.3| Mus musculus chromosome 6, clone RP23-302K3, comp... 40 7.4
5emb|AL391215.12| Human DNA sequence from clone RP11-408B19 on ch... 40 7.4
6gb|AC079842.19| Homo sapiens 12q BAC RP11-989K8 (Roswell Park Ca... 40 7.4
7emb|BX294140.1| Pirellula sp. strain 1 complete genome; segment ... 40 7.4
8gb|AC161417.5| Mus musculus BAC clone RP23-325H23 from chromosom... 40 7.4
9gb|AC084117.6| Homo sapiens chromosome 11, clone RP11-107C21, co... 40 7.4
10gb|AC107948.7| Homo sapiens chromosome 11, clone RP11-81D23, com... 40 7.4
11gb|AC021701.8| Homo sapiens chromosome 18, clone RP11-704G7, com... 40 7.4
12dbj|AB018117.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 7.4
13gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete s... 40 7.4
14gb|AC002500.1|AC002500 Human Cosmid g5129z101 from 7q31.3, compl... 40 7.4

>emb|AL590666.8| Human DNA sequence from clone RP11-66D17 on chromosome 1 Contains the
             3' end of the SH2D2A gene for SH2 domain protein 2A, the
             PRCC gene for papillary renal cell carcinoma
             (translocation-associated), the HDGF gene for
             hepatoma-derived growth factor (high-mobility group
             protein 1-like), the MRPL24 gene for mitochondrial
             ribosomal protein L24, the gene for CGI-41 protein
             (CGI-41), a novel gene (FLJ12671), a novel gene, the
             CRABP2 gene for cellular retinoic acid binding protein 2,
             a novel gene, the gene for NES nestin, the 5' end of a
             novel gene, the 3' end of the BCAN gene for brevican and 5
             CpG islands, complete sequence
          Length = 160597

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 460   cataaatcctgctgtttggttt 481
             ||||||||||||||||||||||
Sbjct: 27677 cataaatcctgctgtttggttt 27698



to top

>ref|NM_124096.2| Arabidopsis thaliana ATP binding AT5G47250 mRNA, complete cds
          Length = 2783

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 70 tgcatgttgaaggaaaatct 89
          ||||||||||||||||||||
Sbjct: 79 tgcatgttgaaggaaaatct 98



to top

>ref|XM_868331.1| PREDICTED: Bos taurus similar to cytochrome P450 monooxygenase
           CYP2T1 (LOC616335), mRNA
          Length = 1323

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 328 caggagcctcaggaactcca 347
           ||||||||||||||||||||
Sbjct: 585 caggagcctcaggaactcca 566



to top

>gb|AC102145.3| Mus musculus chromosome 6, clone RP23-302K3, complete sequence
          Length = 199882

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 332    agcctcaggaactccaccag 351
              ||||||||||||||||||||
Sbjct: 165810 agcctcaggaactccaccag 165791



to top

>emb|AL391215.12| Human DNA sequence from clone RP11-408B19 on chromosome 1 Contains part
             of a novel gene (KIAA1026) and a CpG island, complete
             sequence
          Length = 120551

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   tgatgacccaatgacaggag 333
             ||||||||||||||||||||
Sbjct: 32299 tgatgacccaatgacaggag 32280



to top

>gb|AC079842.19| Homo sapiens 12q BAC RP11-989K8 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 133000

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 404   tgttaaggaagatgaactga 423
             ||||||||||||||||||||
Sbjct: 13438 tgttaaggaagatgaactga 13419



to top

>emb|BX294140.1| Pirellula sp. strain 1 complete genome; segment 8/24
          Length = 307050

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 416    tgaactgaaggttgacagcc 435
              ||||||||||||||||||||
Sbjct: 201337 tgaactgaaggttgacagcc 201318



to top

>gb|AC161417.5| Mus musculus BAC clone RP23-325H23 from chromosome 6, complete sequence
          Length = 173502

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 332    agcctcaggaactccaccag 351
              ||||||||||||||||||||
Sbjct: 118924 agcctcaggaactccaccag 118943



to top

>gb|AC084117.6| Homo sapiens chromosome 11, clone RP11-107C21, complete sequence
          Length = 166973

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 488   tttcaccaagcttacaagaa 507
             ||||||||||||||||||||
Sbjct: 13393 tttcaccaagcttacaagaa 13412



to top

>gb|AC107948.7| Homo sapiens chromosome 11, clone RP11-81D23, complete sequence
          Length = 156839

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 488   tttcaccaagcttacaagaa 507
             ||||||||||||||||||||
Sbjct: 24304 tttcaccaagcttacaagaa 24285



to top

>gb|AC021701.8| Homo sapiens chromosome 18, clone RP11-704G7, complete sequence
          Length = 170311

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   aatcttcaagtggaagcaag 134
             ||||||||||||||||||||
Sbjct: 41787 aatcttcaagtggaagcaag 41768



to top

>dbj|AB018117.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQL5
          Length = 88398

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tgcatgttgaaggaaaatct 89
             ||||||||||||||||||||
Sbjct: 36840 tgcatgttgaaggaaaatct 36821



to top

>gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete sequence
          Length = 1844853

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 478    gtttatgctgtttcaccaag 497
              ||||||||||||||||||||
Sbjct: 285742 gtttatgctgtttcaccaag 285761



to top

>gb|AC002500.1|AC002500 Human Cosmid g5129z101 from 7q31.3, complete sequence
          Length = 41084

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   agaacactcaaatgctgcta 225
             ||||||||||||||||||||
Sbjct: 24508 agaacactcaaatgctgcta 24489


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,844,094
Number of Sequences: 3902068
Number of extensions: 4844094
Number of successful extensions: 90334
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90298
Number of HSP's gapped (non-prelim): 36
length of query: 543
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 520
effective length of database: 17,143,297,704
effective search space: 8914514806080
effective search space used: 8914514806080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top