>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete
             sequence
          Length = 129438

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 170   tgaaacacagcccacgttacgcg 192
             |||||||||||||||||||||||
Sbjct: 28472 tgaaacacagcccacgttacgcg 28450

>gb|DQ227316.1| Synthetic construct VAR2CSA mRNA, partial cds
          Length = 8000

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 388  cttgttggcgtcgtagatctccttg 412
            |||||||||||||||||||| ||||
Sbjct: 3366 cttgttggcgtcgtagatctgcttg 3342

>gb|AC113987.11| Mus musculus chromosome 9, clone RP24-106M14, complete sequence
          Length = 170828

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 422   tagaactggctgtatatgaggcct 445
             ||||||| ||||||||||||||||
Sbjct: 80748 tagaacttgctgtatatgaggcct 80771

>gb|AC123614.6| Mus musculus chromosome 9, clone RP23-446P16, complete sequence
          Length = 210060

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 422   tagaactggctgtatatgaggcct 445
             ||||||| ||||||||||||||||
Sbjct: 17088 tagaacttgctgtatatgaggcct 17065

>ref|XM_744904.1| Aspergillus fumigatus Af293 plasma membrane ATPase (Afu1g02480)
            partial mRNA
          Length = 2880

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 5    ctacgggctttgacaatctc 24
            ||||||||||||||||||||
Sbjct: 2756 ctacgggctttgacaatctc 2775

>ref|XM_505910.1| Yarrowia lipolytica CLIB122, YALI0F26499g predicted mRNA
          Length = 3450

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 401  tagatctccttgacggagttgtagaact 428
            |||||||||||| |||||| ||||||||
Sbjct: 2306 tagatctccttgccggagtcgtagaact 2279

>gb|AC006395.1|AC006395 Homo sapiens PAC clone RP3-394H4 from Xq23, complete sequence
          Length = 72291

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    aagaagggcattcatccagg 118
             ||||||||||||||||||||
Sbjct: 26179 aagaagggcattcatccagg 26198

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 401     tagatctccttgacggagttgtagaact 428
               |||||||||||| |||||| ||||||||
Sbjct: 3391389 tagatctccttgccggagtcgtagaact 3391416


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,229,633
Number of Sequences: 3902068
Number of extensions: 2229633
Number of successful extensions: 35743
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35719
Number of HSP's gapped (non-prelim): 24
length of query: 466
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 444
effective length of database: 17,147,199,772
effective search space: 7613356698768
effective search space used: 7613356698768
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)