ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal26d20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY103571.1| Zea mays PCO153825 mRNA sequence 422 e-115
2ref|XM_468609.1| Oryza sativa (japonica cultivar-group), mRNA 400 e-108
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 400 e-108
4gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genom... 400 e-108
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 400 e-108
6gb|BT017787.1| Zea mays clone EL01N0504C04.c mRNA sequence 389 e-105
7gb|BT016384.1| Zea mays clone Contig217 mRNA sequence 381 e-102
8dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 361 1e-96
9dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D... 361 1e-96
10dbj|AP003700.3| Oryza sativa (japonica cultivar-group) genomic D... 361 1e-96
11gb|AY103771.1| Zea mays PCO152633 mRNA sequence 345 7e-92
12ref|XM_479144.1| Oryza sativa (japonica cultivar-group), mRNA 329 4e-87
13dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 295 6e-77
14dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic D... 295 6e-77
15dbj|AK121069.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 6e-77
16dbj|AB077113.1| Prunus persica mRNA, microsatellite marker M9a 252 8e-64
17dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone... 220 3e-54
18gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete s... 174 2e-40
19ref|NM_105728.2| Arabidopsis thaliana structural constituent of ... 151 2e-33
20gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete se... 151 2e-33
21gb|AY091706.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, com... 151 2e-33
22gb|AY048228.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, com... 151 2e-33
23gb|AY039519.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, com... 151 2e-33
24emb|BX813428.1|CNS0AARB Arabidopsis thaliana Full-length cDNA Co... 151 2e-33
25emb|BX827775.1|CNS0A4FW Arabidopsis thaliana Full-length cDNA Co... 151 2e-33
26gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24... 151 2e-33
27gb|AC011663.7|AC011663 Arabidopsis thaliana chromosome 1 BAC F5A... 151 2e-33
28gb|AY085573.1| Arabidopsis thaliana clone 15789 mRNA, complete s... 151 2e-33
29emb|X91959.1|AT60SRL27 A.thaliana mRNA for 60S ribosomal protein... 151 2e-33
30emb|CT573365.4| M.truncatula DNA sequence from clone MTH2-89E15 ... 151 2e-33
31gb|AY804547.1| Drosophila yakuba strain Tai18 ribosomal protein ... 149 9e-33
32gb|AY804546.1| Drosophila santomea strain STO.4 ribosomal protei... 149 9e-33
33gb|AY804956.1| Drosophila yakuba isolate 1250_4 RpL27A gene, par... 149 9e-33
34gb|AY804955.1| Drosophila yakuba isolate 1250_3 RpL27A gene, par... 149 9e-33
35gb|AY804953.1| Drosophila yakuba isolate 1250_1 RpL27A gene, par... 149 9e-33
36gb|AY804952.1| Drosophila santomea isolate 1250_3 RpL27A gene, p... 149 9e-33
37gb|AY804951.1| Drosophila santomea isolate 1250_2 RpL27A gene, p... 149 9e-33
38gb|AY804950.1| Drosophila santomea isolate 1250_1 RpL27A gene, p... 149 9e-33
39gb|AY804949.1| Drosophila santomea isolate 1566_4 RpL27A gene, p... 149 9e-33
40gb|AY804948.1| Drosophila santomea isolate 1566_3 RpL27A gene, p... 149 9e-33
41gb|AY804947.1| Drosophila santomea isolate 1566_2 RpL27A gene, p... 149 9e-33
42gb|AY804946.1| Drosophila santomea isolate 1566_1 RpL27A gene, p... 149 9e-33
43gb|AY804944.1| Drosophila yakuba isolate SaoT_2 RpL27A gene, par... 149 9e-33
44gb|AY804943.1| Drosophila yakuba isolate SaoT_1 RpL27A gene, par... 149 9e-33
45gb|AY232080.1| Drosophila yakuba clone yak-ad_RpL27A mRNA sequence 149 9e-33
46gb|AY231794.1| Drosophila yakuba clone yak-em_RpL27A mRNA sequence 149 9e-33
47gb|AY804954.1| Drosophila yakuba isolate 1250_2 RpL27A gene, par... 145 1e-31
48gb|AY804945.1| Drosophila yakuba isolate SaoT_3 RpL27A gene, par... 145 1e-31
49emb|BX817859.1|CNS0AEEA Arabidopsis thaliana Full-length cDNA Co... 143 5e-31
50gb|DQ191629.1| Solanum tuberosum ribosomal protein L27a-like pro... 139 8e-30
51ref|NM_102178.2| Arabidopsis thaliana RPL27A (RIBOSOMAL PROTEIN ... 135 1e-28
52gb|AF349525.1| Arabidopsis thaliana putative 60s ribosomal prote... 135 1e-28
53gb|AF324716.2| Arabidopsis thaliana At1g23290 (At1g23290/F26F24_... 135 1e-28
54emb|BX814201.1|CNS0AC9G Arabidopsis thaliana Full-length cDNA Co... 135 1e-28
55emb|BX814197.1|CNS0AC79 Arabidopsis thaliana Full-length cDNA Co... 135 1e-28
56emb|BX814930.1|CNS0ABGE Arabidopsis thaliana Full-length cDNA Co... 135 1e-28
57gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana... 135 1e-28
58gb|BT022137.2| Drosophila melanogaster IP01552 full insert cDNA 133 5e-28
59ref|NM_057615.3| Drosophila melanogaster Ribosomal protein L27A ... 133 5e-28
60gb|AY071144.1| Drosophila melanogaster RE17991 full length cDNA 133 5e-28
61gb|AC092232.1|AC092232 Drosophila melanogaster, chromosome 2L, r... 133 5e-28
62gb|AE003576.5| Drosophila melanogaster chromosome 2L, section 15... 133 5e-28
63gb|U66357.1|DMU66357 Drosophila melanogaster ribosomal protein R... 133 5e-28
64gb|U66358.1|DMU66358 Drosophila melanogaster ribosomal protein L... 133 5e-28
65gb|AC004267.1|AC004267 Drosophila melanogaster DNA sequence (P1 ... 133 5e-28
66gb|DQ191661.1| Solanum tuberosum ribosomal protein L27a-like pro... 131 2e-27
67gb|BT000542.1| Arabidopsis thaliana 60s ribosomal protein l27a. ... 131 2e-27
68gb|AF410280.1|AF410280 Arabidopsis thaliana At1g23290/F26F24_23 ... 131 2e-27
69gb|AY086256.1| Arabidopsis thaliana clone 23092 mRNA, complete s... 131 2e-27
70gb|BT016406.1| Zea mays clone Contig239 mRNA sequence 127 3e-26
71dbj|AB042856.1| Panax ginseng mRNA for 60S ribosomal protein L27... 127 3e-26
72gb|AF459726.1| Elaeocarpus angustifolius clone scu22Eg microsate... 123 5e-25
73emb|X74484.1|DMRPL27A D.melanogaster mRNA for ribosomal protein ... 117 3e-23
74gb|AY432710.1| Aedes aegypti ASAP ID: 34035 cytosolic large ribo... 111 2e-21
75gb|DQ440054.1| Aedes aegypti clone AE-306 60S ribosomal protein ... 111 2e-21
76gb|AY961477.1| Phytophthora infestans clone MY-19-H-09 ribosomal... 103 5e-19
77emb|BX071844.1|CNS09RLK Single read from an extremity of a full-... 96 1e-16
78emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-... 96 1e-16
79emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-... 96 1e-16
80emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-... 96 1e-16
81emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-... 96 1e-16
82emb|BX071150.1|CNS09R2A Single read from an extremity of a full-... 96 1e-16
83emb|BX071149.1|CNS09R29 Single read from an extremity of a full-... 96 1e-16
84emb|BX071048.1|CNS09QZG Single read from an extremity of a full-... 96 1e-16
85emb|BX071325.1|CNS09R75 Single read from an extremity of a full-... 96 1e-16
86emb|BX071324.1|CNS09R74 Single read from an extremity of a full-... 96 1e-16
87emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-... 96 1e-16
88emb|BX070688.1|CNS09QPG Single read from an extremity of a full-... 96 1e-16
89emb|BX070687.1|CNS09QPF Single read from an extremity of a full-... 96 1e-16
90emb|BX070669.1|CNS09QOX Single read from an extremity of a full-... 96 1e-16
91emb|BX070195.1|CNS09QBR Single read from an extremity of a full-... 96 1e-16
92emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-... 96 1e-16
93emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-... 96 1e-16
94emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-... 96 1e-16
95emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-... 96 1e-16
96emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-... 96 1e-16
97emb|BX069763.1|CNS09PZR Single read from an extremity of a full-... 96 1e-16
98emb|BX069694.1|CNS09PXU Single read from an extremity of a full-... 96 1e-16
99emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-... 96 1e-16
100emb|BX069225.1|CNS09PKT Single read from an extremity of a full-... 96 1e-16
101emb|BX069118.1|CNS09PHU Single read from an extremity of a full-... 96 1e-16
102emb|BX069067.1|CNS09PGF Single read from an extremity of a full-... 96 1e-16
103emb|BX069066.1|CNS09PGE Single read from an extremity of a full-... 96 1e-16
104emb|BX068786.1|CNS09P8M Single read from an extremity of a full-... 96 1e-16
105emb|BX068729.1|CNS09P71 Single read from an extremity of a full-... 96 1e-16
106emb|BX068402.1|CNS09OXY Single read from an extremity of a full-... 96 1e-16
107emb|BX068401.1|CNS09OXX Single read from an extremity of a full-... 96 1e-16
108emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-... 96 1e-16
109emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-... 96 1e-16
110emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-... 96 1e-16
111emb|BX067750.1|CNS09OFU Single read from an extremity of a full-... 96 1e-16
112emb|BX067375.1|CNS09O5F Single read from an extremity of a full-... 96 1e-16
113emb|BX067374.1|CNS09O5E Single read from an extremity of a full-... 96 1e-16
114emb|BX067204.1|CNS09O0O Single read from an extremity of a full-... 96 1e-16
115emb|BX067203.1|CNS09O0N Single read from an extremity of a full-... 96 1e-16
116emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-... 96 1e-16
117emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-... 96 1e-16
118emb|BX066485.1|CNS09NGP Single read from an extremity of a full-... 96 1e-16
119emb|BX066475.1|CNS09NGF Single read from an extremity of a full-... 96 1e-16
120emb|BX066474.1|CNS09NGE Single read from an extremity of a full-... 96 1e-16
121emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-... 96 1e-16
122emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-... 96 1e-16
123emb|BX065859.1|CNS09MZB Single read from an extremity of a full-... 96 1e-16
124emb|BX065576.1|CNS09MRG Single read from an extremity of a full-... 96 1e-16
125emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-... 96 1e-16
126emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-... 96 1e-16
127emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-... 96 1e-16
128emb|BX064810.1|CNS09M66 Single read from an extremity of a full-... 96 1e-16
129emb|BX064779.1|CNS09M5B Single read from an extremity of a full-... 96 1e-16
130emb|BX064778.1|CNS09M5A Single read from an extremity of a full-... 96 1e-16
131emb|BX064611.1|CNS09M0N Single read from an extremity of a full-... 96 1e-16
132emb|BX064509.1|CNS09LXT Single read from an extremity of a full-... 96 1e-16
133emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-... 96 1e-16
134emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-... 96 1e-16
135emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-... 96 1e-16
136emb|BX063825.1|CNS09LET Single read from an extremity of a full-... 96 1e-16
137emb|BX063744.1|CNS09LCK Single read from an extremity of a full-... 96 1e-16
138emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-... 96 1e-16
139emb|BX063616.1|CNS09L90 Single read from an extremity of a full-... 96 1e-16
140emb|BX063581.1|CNS09L81 Single read from an extremity of a full-... 96 1e-16
141emb|BX063323.1|CNS09L0V Single read from an extremity of a full-... 96 1e-16
142emb|BX062743.1|CNS09KKR Single read from an extremity of a full-... 96 1e-16
143emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-... 96 1e-16
144emb|BX062417.1|CNS09KBP Single read from an extremity of a full-... 96 1e-16
145emb|BX062386.1|CNS09KAU Single read from an extremity of a full-... 96 1e-16
146emb|BX061846.1|CNS09JVU Single read from an extremity of a full-... 96 1e-16
147emb|BX061653.1|CNS09JQH Single read from an extremity of a full-... 96 1e-16
148emb|BX061652.1|CNS09JQG Single read from an extremity of a full-... 96 1e-16
149emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-... 96 1e-16
150emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-... 96 1e-16
151emb|BX061418.1|CNS09JJY Single read from an extremity of a full-... 96 1e-16
152emb|BX061372.1|CNS09JIO Single read from an extremity of a full-... 96 1e-16
153emb|BX061371.1|CNS09JIN Single read from an extremity of a full-... 96 1e-16
154emb|BX060850.1|CNS09J46 Single read from an extremity of a full-... 96 1e-16
155emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-... 96 1e-16
156emb|BX060638.1|CNS09IYA Single read from an extremity of a full-... 96 1e-16
157emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-... 96 1e-16
158emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-... 96 1e-16
159emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-... 96 1e-16
160emb|BX060482.1|CNS09ITY Single read from an extremity of a full-... 96 1e-16
161emb|BX060103.1|CNS09IJF Single read from an extremity of a full-... 96 1e-16
162emb|BX060038.1|CNS09IHM Single read from an extremity of a full-... 96 1e-16
163emb|BX059961.1|CNS09IFH Single read from an extremity of a full-... 96 1e-16
164emb|BX059617.1|CNS09I5X Single read from an extremity of a full-... 96 1e-16
165emb|BX059580.1|CNS09I4W Single read from an extremity of a full-... 96 1e-16
166emb|BX059462.1|CNS09I1M Single read from an extremity of a full-... 96 1e-16
167emb|BX059461.1|CNS09I1L Single read from an extremity of a full-... 96 1e-16
168emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-... 96 1e-16
169emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-... 96 1e-16
170emb|BX058666.1|CNS09HFI Single read from an extremity of a full-... 96 1e-16
171emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-... 96 1e-16
172emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-... 96 1e-16
173emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-... 96 1e-16
174emb|BX058454.1|CNS09H9M Single read from an extremity of a full-... 96 1e-16
175emb|BX058452.1|CNS09H9K Single read from an extremity of a full-... 96 1e-16
176emb|BX058451.1|CNS09H9J Single read from an extremity of a full-... 96 1e-16
177emb|BX058229.1|CNS09H3D Single read from an extremity of a full-... 96 1e-16
178emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-... 96 1e-16
179emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-... 96 1e-16
180emb|BX057878.1|CNS09GTM Single read from an extremity of a full-... 96 1e-16
181emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-... 96 1e-16
182emb|BX057633.1|CNS09GMT Single read from an extremity of a full-... 96 1e-16
183emb|BX057505.1|CNS09GJ9 Single read from an extremity of a full-... 96 1e-16
184emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-... 96 1e-16
185emb|BX055833.1|CNS09F8T Single read from an extremity of a full-... 96 1e-16
186emb|BX055484.1|CNS09EZ4 Single read from an extremity of a full-... 96 1e-16
187emb|BX053216.1|CNS09D84 Single read from an extremity of a full-... 96 1e-16
188emb|BX053162.1|CNS09D6M Single read from an extremity of a full-... 96 1e-16
189emb|BX053144.1|CNS09D64 Single read from an extremity of a full-... 96 1e-16
190emb|BX055141.1|CNS09EPL Single read from an extremity of a full-... 96 1e-16
191emb|BX054882.1|CNS09EIE Single read from an extremity of a full-... 96 1e-16
192emb|BX053068.1|CNS09D40 Single read from an extremity of a full-... 96 1e-16
193emb|BX054081.1|CNS09DW5 Single read from an extremity of a full-... 96 1e-16
194emb|BX053881.1|CNS09DQL Single read from an extremity of a full-... 96 1e-16
195emb|BX053707.1|CNS09DLR Single read from an extremity of a full-... 96 1e-16
196emb|BX053706.1|CNS09DLQ Single read from an extremity of a full-... 96 1e-16
197emb|BX053663.1|CNS09DKJ Single read from an extremity of a full-... 96 1e-16
198emb|BX052674.1|CNS09CT2 Single read from an extremity of a full-... 96 1e-16
199emb|BX052301.1|CNS09CIP Single read from an extremity of a full-... 96 1e-16
200emb|BX051916.1|CNS09C80 Single read from an extremity of a full-... 96 1e-16
201emb|BX051464.1|CNS09BVG Single read from an extremity of a full-... 96 1e-16
202emb|BX051169.1|CNS09BN9 Single read from an extremity of a full-... 96 1e-16
203emb|BX050918.1|CNS09BGA Single read from an extremity of a full-... 96 1e-16
204emb|BX050847.1|CNS09BEB Single read from an extremity of a full-... 96 1e-16
205emb|BX050846.1|CNS09BEA Single read from an extremity of a full-... 96 1e-16
206emb|BX050735.1|CNS09BB7 Single read from an extremity of a full-... 96 1e-16
207emb|BX050637.1|CNS09B8H Single read from an extremity of a full-... 96 1e-16
208emb|BX050473.1|CNS09B3X Single read from an extremity of a full-... 96 1e-16
209emb|BX050285.1|CNS09AYP Single read from an extremity of a full-... 96 1e-16
210emb|BX049853.1|CNS09AMP Single read from an extremity of a full-... 96 1e-16
211emb|BX049852.1|CNS09AMO Single read from an extremity of a full-... 96 1e-16
212emb|BX049352.1|CNS09A8S Single read from an extremity of a full-... 96 1e-16
213emb|BX049279.1|CNS09A6R Single read from an extremity of a full-... 96 1e-16
214emb|BX049134.1|CNS09A2Q Single read from an extremity of a full-... 96 1e-16
215emb|BX048838.1|CNS099UI Single read from an extremity of a full-... 96 1e-16
216emb|BX048660.1|CNS099PK Single read from an extremity of a full-... 96 1e-16
217emb|BX046531.1|CNS0982F Single read from an extremity of a full-... 96 1e-16
218emb|BX046527.1|CNS0982B Single read from an extremity of a full-... 96 1e-16
219emb|BX048302.1|CNS099FM Single read from an extremity of a full-... 96 1e-16
220emb|BX048147.1|CNS099BB Single read from an extremity of a full-... 96 1e-16
221emb|BX048146.1|CNS099BA Single read from an extremity of a full-... 96 1e-16
222emb|BX048050.1|CNS0998M Single read from an extremity of a full-... 96 1e-16
223emb|BX047926.1|CNS09956 Single read from an extremity of a full-... 96 1e-16
224emb|BX047906.1|CNS0994M Single read from an extremity of a full-... 96 1e-16
225emb|BX047760.1|CNS0990K Single read from an extremity of a full-... 96 1e-16
226emb|BX047689.1|CNS098YL Single read from an extremity of a full-... 96 1e-16
227emb|BX047677.1|CNS098Y9 Single read from an extremity of a full-... 96 1e-16
228emb|BX047676.1|CNS098Y8 Single read from an extremity of a full-... 96 1e-16
229emb|BX047547.1|CNS098UN Single read from an extremity of a full-... 96 1e-16
230emb|BX047520.1|CNS098TW Single read from an extremity of a full-... 96 1e-16
231emb|BX047255.1|CNS098MJ Single read from an extremity of a full-... 96 1e-16
232emb|BX047102.1|CNS098IA Single read from an extremity of a full-... 96 1e-16
233emb|BX046950.1|CNS098E2 Single read from an extremity of a full-... 96 1e-16
234emb|BX046739.1|CNS09887 Single read from an extremity of a full-... 96 1e-16
235emb|BX046675.1|CNS0986F Single read from an extremity of a full-... 96 1e-16
236emb|BX046022.1|CNS097OA Single read from an extremity of a full-... 96 1e-16
237emb|BX046021.1|CNS097O9 Single read from an extremity of a full-... 96 1e-16
238emb|BX045808.1|CNS097IC Single read from an extremity of a full-... 96 1e-16
239emb|BX045791.1|CNS097HV Single read from an extremity of a full-... 96 1e-16
240emb|BX045765.1|CNS097H5 Single read from an extremity of a full-... 96 1e-16
241emb|BX045764.1|CNS097H4 Single read from an extremity of a full-... 96 1e-16
242emb|BX045565.1|CNS097BL Single read from an extremity of a full-... 96 1e-16
243emb|BX043029.1|CNS095D5 Single read from an extremity of a full-... 96 1e-16
244emb|BX044717.1|CNS096O1 Single read from an extremity of a full-... 96 1e-16
245emb|BX044716.1|CNS096O0 Single read from an extremity of a full-... 96 1e-16
246emb|BX044419.1|CNS096FR Single read from an extremity of a full-... 96 1e-16
247emb|BX044308.1|CNS096CO Single read from an extremity of a full-... 96 1e-16
248emb|BX044225.1|CNS096AD Single read from an extremity of a full-... 96 1e-16
249emb|BX044005.1|CNS09649 Single read from an extremity of a full-... 96 1e-16
250emb|BX043494.1|CNS095Q2 Single read from an extremity of a full-... 96 1e-16
251emb|BX043388.1|CNS095N4 Single read from an extremity of a full-... 96 1e-16
252emb|BX043306.1|CNS095KU Single read from an extremity of a full-... 96 1e-16
253emb|BX042574.1|CNS0950I Single read from an extremity of a full-... 96 1e-16
254emb|BX042573.1|CNS0950H Single read from an extremity of a full-... 96 1e-16
255emb|BX042534.1|CNS094ZE Single read from an extremity of a full-... 96 1e-16
256emb|BX042035.1|CNS094LJ Single read from an extremity of a full-... 96 1e-16
257emb|BX041883.1|CNS094HB Single read from an extremity of a full-... 96 1e-16
258emb|BX041665.1|CNS094B9 Single read from an extremity of a full-... 96 1e-16
259emb|BX041364.1|CNS0942W Single read from an extremity of a full-... 96 1e-16
260emb|BX041363.1|CNS0942V Single read from an extremity of a full-... 96 1e-16
261emb|BX041181.1|CNS093XT Single read from an extremity of a full-... 96 1e-16
262emb|BX041016.1|CNS093T8 Single read from an extremity of a full-... 96 1e-16
263emb|BX040956.1|CNS093RK Single read from an extremity of a full-... 96 1e-16
264emb|BX040955.1|CNS093RJ Single read from an extremity of a full-... 96 1e-16
265emb|BX040768.1|CNS093MC Single read from an extremity of a full-... 96 1e-16
266emb|BX040258.1|CNS09386 Single read from an extremity of a full-... 96 1e-16
267emb|BX040257.1|CNS09385 Single read from an extremity of a full-... 96 1e-16
268emb|BX040215.1|CNS0936Z Single read from an extremity of a full-... 96 1e-16
269emb|BX040210.1|CNS0936U Single read from an extremity of a full-... 96 1e-16
270emb|BX039720.1|CNS092T8 Single read from an extremity of a full-... 96 1e-16
271emb|BX039593.1|CNS092PP Single read from an extremity of a full-... 96 1e-16
272emb|BX038555.1|CNS091WV Single read from an extremity of a full-... 96 1e-16
273emb|BX038371.1|CNS091RR Single read from an extremity of a full-... 96 1e-16
274emb|BX038370.1|CNS091RQ Single read from an extremity of a full-... 96 1e-16
275emb|BX038029.1|CNS091I9 Single read from an extremity of a full-... 96 1e-16
276emb|BX038028.1|CNS091I8 Single read from an extremity of a full-... 96 1e-16
277emb|BX038002.1|CNS091HI Single read from an extremity of a full-... 96 1e-16
278emb|BX037726.1|CNS0919U Single read from an extremity of a full-... 96 1e-16
279emb|BX037704.1|CNS09198 Single read from an extremity of a full-... 96 1e-16
280emb|BX037688.1|CNS0918S Single read from an extremity of a full-... 96 1e-16
281emb|BX037668.1|CNS09188 Single read from an extremity of a full-... 96 1e-16
282emb|BX037021.1|CNS090Q9 Single read from an extremity of a full-... 96 1e-16
283emb|BX032436.1|CNS08X6W Single read from an extremity of a full-... 96 1e-16
284emb|BX022760.1|CNS08PQ4 Single read from an extremity of a full-... 96 1e-16
285emb|BX021276.1|CNS08OKW Single read from an extremity of a full-... 96 1e-16
286emb|BX020664.1|CNS08O3W Single read from an extremity of a full-... 96 1e-16
287emb|BX020663.1|CNS08O3V Single read from an extremity of a full-... 96 1e-16
288emb|BX020342.1|CNS08NUY Single read from an extremity of a full-... 96 1e-16
289emb|BX020341.1|CNS08NUX Single read from an extremity of a full-... 96 1e-16
290emb|BX017080.1|CNS08LCC Single read from an extremity of a full-... 96 1e-16
291emb|BX015695.1|CNS08K9V Single read from an extremity of a full-... 96 1e-16
292emb|BX016091.1|CNS08KKV Single read from an extremity of a full-... 96 1e-16
293emb|BX015264.1|CNS08JXW Single read from an extremity of a full-... 96 1e-16
294emb|BX014967.1|CNS08JPN Single read from an extremity of a full-... 96 1e-16
295emb|BX014077.1|CNS08J0X Single read from an extremity of a full-... 96 1e-16
296emb|BX010268.1|CNS08G34 Single read from an extremity of a full-... 96 1e-16
297emb|BX008036.1|CNS08ED4 Single read from an extremity of a full-... 96 1e-16
298emb|BX008035.1|CNS08ED3 Single read from an extremity of a full-... 96 1e-16
299emb|BX007645.1|CNS08E29 Single read from an extremity of a full-... 96 1e-16
300emb|BX006393.1|CNS08D3H Single read from an extremity of a full-... 96 1e-16
301emb|BX006392.1|CNS08D3G Single read from an extremity of a full-... 96 1e-16
302ref|XM_320804.2| Anopheles gambiae str. PEST ENSANGP00000017987 ... 96 1e-16
303gb|AY826145.1| Aedes albopictus clone AL_181 60S ribosomal prote... 94 4e-16
304gb|AC012187.3|F13K23 Sequence of BAC F13K23 from Arabidopsis tha... 92 2e-15
305emb|BX063708.1|CNS09LBK Single read from an extremity of a full-... 90 7e-15
306emb|BX063707.1|CNS09LBJ Single read from an extremity of a full-... 90 7e-15
307gb|AY440238.1| Armigeres subalbatus ASAP ID: 39091 cytosolic lar... 88 3e-14
308emb|BX072340.1|CNS09RZC Single read from an extremity of a full-... 88 3e-14
309emb|BX071464.1|CNS09RB0 Single read from an extremity of a full-... 88 3e-14
310emb|BX071369.1|CNS09R8D Single read from an extremity of a full-... 88 3e-14
311emb|BX070860.1|CNS09QU8 Single read from an extremity of a full-... 88 3e-14
312emb|BX070196.1|CNS09QBS Single read from an extremity of a full-... 88 3e-14
313emb|BX069764.1|CNS09PZS Single read from an extremity of a full-... 88 3e-14
314emb|BX069119.1|CNS09PHV Single read from an extremity of a full-... 88 3e-14
315emb|BX068787.1|CNS09P8N Single read from an extremity of a full-... 88 3e-14
316emb|BX068730.1|CNS09P72 Single read from an extremity of a full-... 88 3e-14
317emb|BX068159.1|CNS09OR7 Single read from an extremity of a full-... 88 3e-14
318emb|BX067963.1|CNS09OLR Single read from an extremity of a full-... 88 3e-14
319emb|BX066389.1|CNS09NE1 Single read from an extremity of a full-... 88 3e-14
320emb|BX066287.1|CNS09NB7 Single read from an extremity of a full-... 88 3e-14
321emb|BX066286.1|CNS09NB6 Single read from an extremity of a full-... 88 3e-14
322emb|BX065577.1|CNS09MRH Single read from an extremity of a full-... 88 3e-14
323emb|BX065498.1|CNS09MPA Single read from an extremity of a full-... 88 3e-14
324emb|BX065054.1|CNS09MCY Single read from an extremity of a full-... 88 3e-14
325emb|BX064050.1|CNS09LL2 Single read from an extremity of a full-... 88 3e-14
326emb|BX064012.1|CNS09LK0 Single read from an extremity of a full-... 88 3e-14
327emb|BX064011.1|CNS09LJZ Single read from an extremity of a full-... 88 3e-14
328emb|BX063617.1|CNS09L91 Single read from an extremity of a full-... 88 3e-14
329emb|BX063582.1|CNS09L82 Single read from an extremity of a full-... 88 3e-14
330emb|BX062744.1|CNS09KKS Single read from an extremity of a full-... 88 3e-14
331emb|BX062032.1|CNS09K10 Single read from an extremity of a full-... 88 3e-14
332emb|BX061419.1|CNS09JJZ Single read from an extremity of a full-... 88 3e-14
333emb|BX060763.1|CNS09J1R Single read from an extremity of a full-... 88 3e-14
334emb|BX060104.1|CNS09IJG Single read from an extremity of a full-... 88 3e-14
335emb|BX060039.1|CNS09IHN Single read from an extremity of a full-... 88 3e-14
336emb|BX059596.1|CNS09I5C Single read from an extremity of a full-... 88 3e-14
337emb|BX059581.1|CNS09I4X Single read from an extremity of a full-... 88 3e-14
338emb|BX059233.1|CNS09HV9 Single read from an extremity of a full-... 88 3e-14
339emb|BX058230.1|CNS09H3E Single read from an extremity of a full-... 88 3e-14
340emb|BX056621.1|CNS09FUP Single read from an extremity of a full-... 88 3e-14
341emb|BX055855.1|CNS09F9F Single read from an extremity of a full-... 88 3e-14
342emb|BX055853.1|CNS09F9D Single read from an extremity of a full-... 88 3e-14
343emb|BX056291.1|CNS09FLJ Single read from an extremity of a full-... 88 3e-14
344emb|BX055142.1|CNS09EPM Single read from an extremity of a full-... 88 3e-14
345emb|BX053163.1|CNS09D6N Single read from an extremity of a full-... 88 3e-14
346emb|BX053069.1|CNS09D41 Single read from an extremity of a full-... 88 3e-14
347emb|BX053882.1|CNS09DQM Single read from an extremity of a full-... 88 3e-14
348emb|BX052302.1|CNS09CIQ Single read from an extremity of a full-... 88 3e-14
349emb|BX051963.1|CNS09C9B Single read from an extremity of a full-... 88 3e-14
350emb|BX051465.1|CNS09BVH Single read from an extremity of a full-... 88 3e-14
351emb|BX051098.1|CNS09BLA Single read from an extremity of a full-... 88 3e-14
352emb|BX051097.1|CNS09BL9 Single read from an extremity of a full-... 88 3e-14
353emb|BX050778.1|CNS09BCE Single read from an extremity of a full-... 88 3e-14
354emb|BX050638.1|CNS09B8I Single read from an extremity of a full-... 88 3e-14
355emb|BX046528.1|CNS0982C Single read from an extremity of a full-... 88 3e-14
356emb|BX046456.1|CNS0980C Single read from an extremity of a full-... 88 3e-14
357emb|BX048303.1|CNS099FN Single read from an extremity of a full-... 88 3e-14
358emb|BX047907.1|CNS0994N Single read from an extremity of a full-... 88 3e-14
359emb|BX046951.1|CNS098E3 Single read from an extremity of a full-... 88 3e-14
360emb|BX046676.1|CNS0986G Single read from an extremity of a full-... 88 3e-14
361emb|BX045090.1|CNS096YE Single read from an extremity of a full-... 88 3e-14
362emb|BX043030.1|CNS095D6 Single read from an extremity of a full-... 88 3e-14
363emb|BX044388.1|CNS096EW Single read from an extremity of a full-... 88 3e-14
364emb|BX044006.1|CNS0964A Single read from an extremity of a full-... 88 3e-14
365emb|BX043903.1|CNS0961F Single read from an extremity of a full-... 88 3e-14
366emb|BX041884.1|CNS094HC Single read from an extremity of a full-... 88 3e-14
367emb|BX041453.1|CNS0945D Single read from an extremity of a full-... 88 3e-14
368emb|BX040769.1|CNS093MD Single read from an extremity of a full-... 88 3e-14
369emb|BX040585.1|CNS093H9 Single read from an extremity of a full-... 88 3e-14
370emb|BX038382.1|CNS091S2 Single read from an extremity of a full-... 88 3e-14
371emb|BX032666.1|CNS08XDA Single read from an extremity of a full-... 88 3e-14
372emb|BX032437.1|CNS08X6X Single read from an extremity of a full-... 88 3e-14
373emb|BX031688.1|CNS08WM4 Single read from an extremity of a full-... 88 3e-14
374emb|BX029896.1|CNS08V8C Single read from an extremity of a full-... 88 3e-14
375emb|BX028447.1|CNS08U43 Single read from an extremity of a full-... 88 3e-14
376emb|BX028274.1|CNS08TZA Single read from an extremity of a full-... 88 3e-14
377emb|BX021277.1|CNS08OKX Single read from an extremity of a full-... 88 3e-14
378emb|BX017081.1|CNS08LCD Single read from an extremity of a full-... 88 3e-14
379emb|BX014078.1|CNS08J0Y Single read from an extremity of a full-... 88 3e-14
380emb|BX013872.1|CNS08IV8 Single read from an extremity of a full-... 88 3e-14
381emb|BX013871.1|CNS08IV7 Single read from an extremity of a full-... 88 3e-14
382emb|BX010269.1|CNS08G35 Single read from an extremity of a full-... 88 3e-14
383emb|BX009357.1|CNS08FDT Single read from an extremity of a full-... 88 3e-14
384emb|BX007646.1|CNS08E2A Single read from an extremity of a full-... 88 3e-14
385dbj|AB226252.1| Aspergillus oryzae cDNA, contig sequence: AoEST3111 88 3e-14
386dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 88 3e-14
387emb|AM049100.1| Georissus sp. APV-2005 mRNA for ribosomal protei... 86 1e-13
388emb|BX053417.1|CNS09DDP Single read from an extremity of a full-... 86 1e-13
389gb|BC064441.1| Danio rerio zgc:77235, mRNA (cDNA clone MGC:77235... 86 1e-13
390dbj|AB169006.1| Macaca fascicularis testis cDNA, clone: QtsA-165... 86 1e-13
391ref|NM_200030.1| Danio rerio zgc:77235 (zgc:77235), mRNA 86 1e-13
392emb|BX022761.1|CNS08PQ5 Single read from an extremity of a full-... 84 4e-13
393emb|BX006006.1|CNS08CSQ Single read from an extremity of a full-... 84 4e-13
394ref|XM_388032.1| Gibberella zeae PH-1 chromosome 4 RL2A_ERYGR 60... 82 2e-12
395emb|BX068340.1|CNS09OW8 Single read from an extremity of a full-... 82 2e-12
396emb|BX066718.1|CNS09NN6 Single read from an extremity of a full-... 82 2e-12
397emb|BX064612.1|CNS09M0O Single read from an extremity of a full-... 82 2e-12
398emb|BX062646.1|CNS09KI2 Single read from an extremity of a full-... 82 2e-12
399emb|BX056068.1|CNS09FFC Single read from an extremity of a full-... 82 2e-12
400emb|BX005667.1|CNS08CJB Single read from an extremity of a full-... 82 2e-12
401emb|BX071843.1|CNS09RLJ Single read from an extremity of a full-... 80 7e-12
402emb|BX071047.1|CNS09QZF Single read from an extremity of a full-... 80 7e-12
403emb|BX070670.1|CNS09QOY Single read from an extremity of a full-... 80 7e-12
404emb|BX069224.1|CNS09PKS Single read from an extremity of a full-... 80 7e-12
405emb|BX065781.1|CNS09MX5 Single read from an extremity of a full-... 80 7e-12
406emb|BX065069.1|CNS09MDD Single read from an extremity of a full-... 80 7e-12
407emb|BX064806.1|CNS09M62 Single read from an extremity of a full-... 80 7e-12
408emb|BX064710.1|CNS09M3E Single read from an extremity of a full-... 80 7e-12
409emb|BX059595.1|CNS09I5B Single read from an extremity of a full-... 80 7e-12
410emb|BX059232.1|CNS09HV8 Single read from an extremity of a full-... 80 7e-12
411emb|BX058615.1|CNS09HE3 Single read from an extremity of a full-... 80 7e-12
412emb|BX058329.1|CNS09H65 Single read from an extremity of a full-... 80 7e-12
413emb|BX058255.1|CNS09H43 Single read from an extremity of a full-... 80 7e-12
414emb|BX056620.1|CNS09FUO Single read from an extremity of a full-... 80 7e-12
415emb|BX057313.1|CNS09GDX Single read from an extremity of a full-... 80 7e-12
416emb|BX057272.1|CNS09GCS Single read from an extremity of a full-... 80 7e-12
417emb|BX057100.1|CNS09G80 Single read from an extremity of a full-... 80 7e-12
418emb|BX056824.1|CNS09G0C Single read from an extremity of a full-... 80 7e-12
419emb|BX056459.1|CNS09FQ7 Single read from an extremity of a full-... 80 7e-12
420emb|BX055894.1|CNS09FAI Single read from an extremity of a full-... 80 7e-12
421emb|BX055854.1|CNS09F9E Single read from an extremity of a full-... 80 7e-12
422emb|BX056290.1|CNS09FLI Single read from an extremity of a full-... 80 7e-12
423emb|BX053228.1|CNS09D8G Single read from an extremity of a full-... 80 7e-12
424emb|BX053079.1|CNS09D4B Single read from an extremity of a full-... 80 7e-12
425emb|BX051962.1|CNS09C9A Single read from an extremity of a full-... 80 7e-12
426emb|BX051915.1|CNS09C7Z Single read from an extremity of a full-... 80 7e-12
427emb|BX051054.1|CNS09BK2 Single read from an extremity of a full-... 80 7e-12
428emb|BX050777.1|CNS09BCD Single read from an extremity of a full-... 80 7e-12
429emb|BX049278.1|CNS09A6Q Single read from an extremity of a full-... 80 7e-12
430emb|BX048984.1|CNS099YK Single read from an extremity of a full-... 80 7e-12
431emb|BX048627.1|CNS099ON Single read from an extremity of a full-... 80 7e-12
432emb|BX046455.1|CNS0980B Single read from an extremity of a full-... 80 7e-12
433emb|BX044387.1|CNS096EV Single read from an extremity of a full-... 80 7e-12
434emb|BX044163.1|CNS0968N Single read from an extremity of a full-... 80 7e-12
435emb|BX043902.1|CNS0961E Single read from an extremity of a full-... 80 7e-12
436emb|BX043699.1|CNS095VR Single read from an extremity of a full-... 80 7e-12
437emb|BX041767.1|CNS094E3 Single read from an extremity of a full-... 80 7e-12
438emb|BX040584.1|CNS093H8 Single read from an extremity of a full-... 80 7e-12
439emb|BX040214.1|CNS0936Y Single read from an extremity of a full-... 80 7e-12
440emb|BX032665.1|CNS08XD9 Single read from an extremity of a full-... 80 7e-12
441emb|BX031689.1|CNS08WM5 Single read from an extremity of a full-... 80 7e-12
442emb|BX020026.1|CNS08NM6 Single read from an extremity of a full-... 80 7e-12
443emb|BX016439.1|CNS08KUJ Single read from an extremity of a full-... 80 7e-12
444emb|BX014615.1|CNS08JFV Single read from an extremity of a full-... 80 7e-12
445emb|BX009356.1|CNS08FDS Single read from an extremity of a full-... 80 7e-12
446gb|AF400186.1| Spodoptera frugiperda ribosomal protein L27A mRNA... 80 7e-12
447ref|XM_215041.3| PREDICTED: Rattus norvegicus ribosomal protein ... 80 7e-12
448emb|X52733.1|RRRPL27A Rat mRNA for ribosomal protein L27a 80 7e-12
449emb|BX052072.1|CNS09CCC Single read from an extremity of a full-... 78 3e-11
450emb|BX045089.1|CNS096YD Single read from an extremity of a full-... 78 3e-11
451gb|AF088913.1|AF088913 Petunia x hybrida ribosomal protein L27a ... 78 3e-11
452gb|AY752829.1| Culicoides sonorensis clone CsRPL27A ribosomal pr... 76 1e-10
453emb|BX063824.1|CNS09LES Single read from an extremity of a full-... 76 1e-10
454gb|L19698.1|RATRALA Rat GTP-binding protein (ral A) mRNA, comple... 76 1e-10
455gb|AY853171.1| Pectinaria gouldii ribosomal protein L27a mRNA, c... 74 4e-10
456ref|NM_001034084.1| Pan troglodytes ribosomal protein L27a (RPL2... 74 4e-10
457ref|NM_000990.3| Homo sapiens ribosomal protein L27a (RPL27A), mRNA 74 4e-10
458gb|CP000081.1| Leishmania major chromosome 35, complete sequence 74 4e-10
459gb|BC005326.1| Homo sapiens ribosomal protein L27a, mRNA (cDNA c... 74 4e-10
460ref|XM_838388.1| Leishmania major strain Friedlin 60S ribosomal ... 74 4e-10
461ref|XM_838390.1| Leishmania major strain Friedlin 60S ribosomal ... 74 4e-10
462emb|AL590867.10| Human DNA sequence from clone RP11-475C16 on ch... 74 4e-10
463emb|BX071281.1|CNS09R5X Single read from an extremity of a full-... 74 4e-10
464emb|BX038003.1|CNS091HJ Single read from an extremity of a full-... 74 4e-10
465gb|BC066326.1| Homo sapiens ribosomal protein L27a, mRNA (cDNA c... 74 4e-10
466emb|CR936817.1| Homo sapiens mRNA; cDNA DKFZp686E23167 (from clo... 74 4e-10
467emb|CR857381.1| Pongo pygmaeus mRNA; cDNA DKFZp468N1916 (from cl... 74 4e-10
468gb|BC020169.1|BC020169 Homo sapiens, clone IMAGE:3543815, mRNA, ... 74 4e-10
469ref|XM_941582.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 74 4e-10
470ref|XM_371853.4| PREDICTED: Homo sapiens similar to 60S ribosoma... 74 4e-10
471gb|AY044167.1| Homo sapiens clone IMAGE:BE741130 mRNA sequence 74 4e-10
472dbj|AB188277.1| Pan troglodytes rpl27a mRNA for ribosomal protei... 74 4e-10
473gb|U14968.1|HSU14968 Human ribosomal protein L27a mRNA, complete... 74 4e-10
474ref|XM_655956.1| Aspergillus nidulans FGSC A4 hypothetical prote... 72 2e-09
475emb|BX043307.1|CNS095KV Single read from an extremity of a full-... 72 2e-09
476emb|BX015295.1|CNS08JYR Single read from an extremity of a full-... 72 2e-09
477ref|XM_518819.1| PREDICTED: Pan troglodytes similar to 60S ribos... 70 6e-09
478emb|BX011142.1|CNS08GRE Single read from an extremity of a full-... 70 6e-09
479ref|XM_574425.1| PREDICTED: Rattus norvegicus similar to 60S rib... 68 3e-08
480emb|BX063730.1|CNS09LC6 Single read from an extremity of a full-... 66 1e-07
481emb|BX060639.1|CNS09IYB Single read from an extremity of a full-... 66 1e-07
482emb|BX045566.1|CNS097BM Single read from an extremity of a full-... 66 1e-07
483emb|BX044213.1|CNS096A1 Single read from an extremity of a full-... 66 1e-07
484emb|BX038383.1|CNS091S3 Single read from an extremity of a full-... 66 1e-07
485gb|AF493565.1| Kluyveromyces lactis hypothetical protein, YGL104... 64 4e-07
486ref|XM_455390.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F06831g ... 64 4e-07
487ref|XM_455389.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F06820g ... 64 4e-07
488emb|BX046775.1|CNS09897 Single read from an extremity of a full-... 64 4e-07
489emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 64 4e-07
490emb|AL116198.1|CNS01CZY Botrytis cinerea strain T4 cDNA library 64 4e-07
491emb|AL115817.1|CNS01CPD Botrytis cinerea strain T4 cDNA library 64 4e-07
492emb|AL115727.1|CNS01CMV Botrytis cinerea strain T4 cDNA library 64 4e-07
493emb|AL115713.1|CNS01CMH Botrytis cinerea strain T4 cDNA library 64 4e-07
494emb|AL115709.1|CNS01CMD Botrytis cinerea strain T4 cDNA library 64 4e-07
495emb|AL113985.1|CNS01BAH Botrytis cinerea strain T4 cDNA library 64 4e-07
496emb|AL112475.1|CNS01A4J Botrytis cinerea strain T4 cDNA library 64 4e-07
497emb|AL111246.1|CNS0196E Botrytis cinerea strain T4 cDNA library 64 4e-07
498gb|AF401582.1| Ictalurus punctatus ribosomal protein L27a mRNA, ... 64 4e-07
499ref|XM_575475.1| PREDICTED: Rattus norvegicus similar to ribosom... 64 4e-07
500ref|XM_816549.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 62 2e-06

>gb|AY103571.1| Zea mays PCO153825 mRNA sequence
          Length = 725

 Score =  422 bits (213), Expect = e-115
 Identities = 342/385 (88%)
 Strand = Plus / Plus

                                                                       
Query: 45  cggcggcgatgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccg 104
           |||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 59  cggcggcgatgacgacgcgcttcaagaagaaccgcaagaagcgcggccacgtgtccgccg 118

                                                                       
Query: 105 ggcacgggcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggca 164
           ||||||| ||  | ||||||||||| |||||||||||||| |||||||||||||| ||||
Sbjct: 119 ggcacggccgcatcggcaagcaccggaagcatcccggaggtcgcggtaacgccggtggca 178

                                                                       
Query: 165 tgcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggta 224
           ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
Sbjct: 179 tgcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcggtaaggtcggca 238

                                                                       
Query: 225 tgaggtacttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggc 284
           || | ||||||||||||||| |||||| |||||||  |||  | |||||| ||||| | |
Sbjct: 239 tgcgctacttccacaagctccgcaacaagttctactgccccgcggtcaacatcgagcgcc 298

                                                                       
Query: 285 tctggtccatggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccgtcg 344
           ||||||| ||||||||  |||| ||||| ||||||||||||  ||||||||||||     
Sbjct: 299 tctggtcgatggtgcccgccgaaaaggcggcggaggccggcctcgacaaggccccgcaga 358

                                                                       
Query: 345 tcgacgtctcgcagttcggctacttcaaggtgctcggcaaggggatgctgccggagaagc 404
           |||||||| |||||||||||||||||||||||||||| |||||| ||||||||   ||||
Sbjct: 359 tcgacgtcacgcagttcggctacttcaaggtgctcgggaagggggtgctgccgcccaagc 418

                                    
Query: 405 ccattgtcgtcaaggccaagctcat 429
           |||||||||||||||||||||||||
Sbjct: 419 ccattgtcgtcaaggccaagctcat 443



to top

>ref|XM_468609.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 694

 Score =  400 bits (202), Expect = e-108
 Identities = 336/380 (88%), Gaps = 3/380 (0%)
 Strand = Plus / Plus

                                                                       
Query: 53  atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
           ||||| || ||| ||||||||||||| ||||||||||||||||| || ||||||||||||
Sbjct: 31  atgacaacgcgcttcaagaagaaccggaagaagcgcggccacgtgtcggccgggcacggg 90

                                                                       
Query: 113 cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
           ||  | || |||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 91  cgcatcgggaagcaccgcaagcaccccggaggccgcggtaacgccggagggatgcaccac 150

                                                                       
Query: 173 caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
           ||||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 151 caccggatcctgttcgacaagtaccacccgggctacttcggcaaggtcggcatgcgctac 210

                                                                       
Query: 233 ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtcc 292
           |||||||||||||||||||||||| ||  |||  |||||||||||||| | |||||||||
Sbjct: 211 ttccacaagctcagcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtcc 270

                                                                       
Query: 293 atggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtc 352
           ||||||||  ||||||||||||| |||||||||| || ||||||||||||| ||||||||
Sbjct: 271 atggtgcccaccgacaaggccgccgaggccggcgccggcaaggcccccgtcatcgacgtc 330

                                                                       
Query: 353 tcgcagttcggctacttcaaggtgctcggcaaggggatgct---gccggagaagcccatt 409
            | ||||||||||||  ||||||||||||||||||||||||    ||| ||| |||||| 
Sbjct: 331 acccagttcggctacaccaaggtgctcggcaaggggatgcttcccccgcagaggcccatc 390

                               
Query: 410 gtcgtcaaggccaagctcat 429
           ||||||||||||||||||||
Sbjct: 391 gtcgtcaaggccaagctcat 410



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  400 bits (202), Expect = e-108
 Identities = 336/380 (88%), Gaps = 3/380 (0%)
 Strand = Plus / Plus

                                                                            
Query: 53       atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
                ||||| || ||| ||||||||||||| ||||||||||||||||| || ||||||||||||
Sbjct: 16599500 atgacaacgcgcttcaagaagaaccggaagaagcgcggccacgtgtcggccgggcacggg 16599559

                                                                            
Query: 113      cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
                ||  | || |||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 16599560 cgcatcgggaagcaccgcaagcaccccggaggccgcggtaacgccggagggatgcaccac 16599619

                                                                            
Query: 173      caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
                ||||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 16599620 caccggatcctgttcgacaagtaccacccgggctacttcggcaaggtcggcatgcgctac 16599679

                                                                            
Query: 233      ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtcc 292
                |||||||||||||||||||||||| ||  |||  |||||||||||||| | |||||||||
Sbjct: 16599680 ttccacaagctcagcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtcc 16599739

                                                                            
Query: 293      atggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtc 352
                ||||||||  ||||||||||||| |||||||||| || ||||||||||||| ||||||||
Sbjct: 16599740 atggtgcccaccgacaaggccgccgaggccggcgccggcaaggcccccgtcatcgacgtc 16599799

                                                                            
Query: 353      tcgcagttcggctacttcaaggtgctcggcaaggggatgct---gccggagaagcccatt 409
                 | ||||||||||||  ||||||||||||||||||||||||    ||| ||| |||||| 
Sbjct: 16599800 acccagttcggctacaccaaggtgctcggcaaggggatgcttcccccgcagaggcccatc 16599859

                                    
Query: 410      gtcgtcaaggccaagctcat 429
                ||||||||||||||||||||
Sbjct: 16599860 gtcgtcaaggccaagctcat 16599879



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 38      gcggcggcggcggcgatgacgacccg 63
               ||||||||||||||||||||||||||
Sbjct: 8595724 gcggcggcggcggcgatgacgacccg 8595749



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 36      cagcggcggcggcggcgatgacgac 60
               |||||||||||||||||||||||||
Sbjct: 8779868 cagcggcggcggcggcgatgacgac 8779892



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 34       gccagcggcggcggcggcgatgacgac 60
                |||||||||||||||||||| ||||||
Sbjct: 24650565 gccagcggcggcggcggcgacgacgac 24650539



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 34       gccagcggcggcggcggcga 53
                ||||||||||||||||||||
Sbjct: 26935642 gccagcggcggcggcggcga 26935623



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 32       aagccagcggcggcggcggcgatg 55
                ||||| ||||||||||||||||||
Sbjct: 21048702 aagccggcggcggcggcggcgatg 21048679



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 313      cgcggaggccggcggcgaca 332
                ||||||||||||||||||||
Sbjct: 11143430 cgcggaggccggcggcgaca 11143411



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      cagcggcggcggcggcgatg 55
               ||||||||||||||||||||
Sbjct: 9967112 cagcggcggcggcggcgatg 9967131



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      cagcggcggcggcggcgatg 55
               ||||||||||||||||||||
Sbjct: 7647823 cagcggcggcggcggcgatg 7647842



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 37      agcggcggcggcggcgatga 56
               ||||||||||||||||||||
Sbjct: 2544707 agcggcggcggcggcgatga 2544726



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     ggccgcggaggccggcggcg 329
               ||||||||||||||||||||
Sbjct: 1959655 ggccgcggaggccggcggcg 1959636



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     cggcggcggcggcgatgacg 58
              ||||||||||||||||||||
Sbjct: 337468 cggcggcggcggcgatgacg 337487



to top

>gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genomic sequence, complete
             sequence
          Length = 133843

 Score =  400 bits (202), Expect = e-108
 Identities = 336/380 (88%), Gaps = 3/380 (0%)
 Strand = Plus / Minus

                                                                         
Query: 53    atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
             ||||| || ||| ||||||||||||| ||||||||||||||||| || ||||||||||||
Sbjct: 54543 atgacaacgcgcttcaagaagaaccggaagaagcgcggccacgtgtcggccgggcacggg 54484

                                                                         
Query: 113   cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
             ||  | || |||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 54483 cgcatcgggaagcaccgcaagcaccccggaggccgcggtaacgccggagggatgcaccac 54424

                                                                         
Query: 173   caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
             ||||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 54423 caccggatcctgttcgacaagtaccacccgggctacttcggcaaggtcggcatgcgctac 54364

                                                                         
Query: 233   ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtcc 292
             |||||||||||||||||||||||| ||  |||  |||||||||||||| | |||||||||
Sbjct: 54363 ttccacaagctcagcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtcc 54304

                                                                         
Query: 293   atggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtc 352
             ||||||||  ||||||||||||| |||||||||| || ||||||||||||| ||||||||
Sbjct: 54303 atggtgcccaccgacaaggccgccgaggccggcgccggcaaggcccccgtcatcgacgtc 54244

                                                                         
Query: 353   tcgcagttcggctacttcaaggtgctcggcaaggggatgct---gccggagaagcccatt 409
              | ||||||||||||  ||||||||||||||||||||||||    ||| ||| |||||| 
Sbjct: 54243 acccagttcggctacaccaaggtgctcggcaaggggatgcttcccccgcagaggcccatc 54184

                                 
Query: 410   gtcgtcaaggccaagctcat 429
             ||||||||||||||||||||
Sbjct: 54183 gtcgtcaaggccaagctcat 54164



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  400 bits (202), Expect = e-108
 Identities = 336/380 (88%), Gaps = 3/380 (0%)
 Strand = Plus / Plus

                                                                            
Query: 53       atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
                ||||| || ||| ||||||||||||| ||||||||||||||||| || ||||||||||||
Sbjct: 16593133 atgacaacgcgcttcaagaagaaccggaagaagcgcggccacgtgtcggccgggcacggg 16593192

                                                                            
Query: 113      cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
                ||  | || |||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 16593193 cgcatcgggaagcaccgcaagcaccccggaggccgcggtaacgccggagggatgcaccac 16593252

                                                                            
Query: 173      caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
                ||||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 16593253 caccggatcctgttcgacaagtaccacccgggctacttcggcaaggtcggcatgcgctac 16593312

                                                                            
Query: 233      ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtcc 292
                |||||||||||||||||||||||| ||  |||  |||||||||||||| | |||||||||
Sbjct: 16593313 ttccacaagctcagcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtcc 16593372

                                                                            
Query: 293      atggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtc 352
                ||||||||  ||||||||||||| |||||||||| || ||||||||||||| ||||||||
Sbjct: 16593373 atggtgcccaccgacaaggccgccgaggccggcgccggcaaggcccccgtcatcgacgtc 16593432

                                                                            
Query: 353      tcgcagttcggctacttcaaggtgctcggcaaggggatgct---gccggagaagcccatt 409
                 | ||||||||||||  ||||||||||||||||||||||||    ||| ||| |||||| 
Sbjct: 16593433 acccagttcggctacaccaaggtgctcggcaaggggatgcttcccccgcagaggcccatc 16593492

                                    
Query: 410      gtcgtcaaggccaagctcat 429
                ||||||||||||||||||||
Sbjct: 16593493 gtcgtcaaggccaagctcat 16593512



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 38      gcggcggcggcggcgatgacgacccg 63
               ||||||||||||||||||||||||||
Sbjct: 8593559 gcggcggcggcggcgatgacgacccg 8593584



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 36      cagcggcggcggcggcgatgacgac 60
               |||||||||||||||||||||||||
Sbjct: 8777703 cagcggcggcggcggcgatgacgac 8777727



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 34       gccagcggcggcggcggcgatgacgac 60
                |||||||||||||||||||| ||||||
Sbjct: 24568034 gccagcggcggcggcggcgacgacgac 24568008



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 34       gccagcggcggcggcggcga 53
                ||||||||||||||||||||
Sbjct: 27026965 gccagcggcggcggcggcga 27026946



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 32       aagccagcggcggcggcggcgatg 55
                ||||| ||||||||||||||||||
Sbjct: 21041731 aagccggcggcggcggcggcgatg 21041708



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 313      cgcggaggccggcggcgaca 332
                ||||||||||||||||||||
Sbjct: 11140193 cgcggaggccggcggcgaca 11140174



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      cagcggcggcggcggcgatg 55
               ||||||||||||||||||||
Sbjct: 9965233 cagcggcggcggcggcgatg 9965252



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      cagcggcggcggcggcgatg 55
               ||||||||||||||||||||
Sbjct: 7645658 cagcggcggcggcggcgatg 7645677



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 37      agcggcggcggcggcgatga 56
               ||||||||||||||||||||
Sbjct: 2544817 agcggcggcggcggcgatga 2544836



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     ggccgcggaggccggcggcg 329
               ||||||||||||||||||||
Sbjct: 1959653 ggccgcggaggccggcggcg 1959634



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     cggcggcggcggcgatgacg 58
              ||||||||||||||||||||
Sbjct: 337466 cggcggcggcggcgatgacg 337485



to top

>gb|BT017787.1| Zea mays clone EL01N0504C04.c mRNA sequence
          Length = 711

 Score =  389 bits (196), Expect = e-105
 Identities = 337/384 (87%)
 Strand = Plus / Plus

                                                                       
Query: 46  ggcggcgatgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgg 105
           |||||||||||| || ||| ||||||||||||||||||||||||||||||| ||||||||
Sbjct: 52  ggcggcgatgacaacgcgcttcaagaagaaccgcaagaagcgcggccacgtgtccgccgg 111

                                                                       
Query: 106 gcacgggcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcat 165
           |||||| ||  | ||||||||| | ||||| || ||||| |||||||||||||| |||||
Sbjct: 112 gcacggccgcatcggcaagcacaggaagcacccgggaggtcgcggtaacgccggtggcat 171

                                                                       
Query: 166 gcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtat 225
           |||||||||||| ||||||||||||||||||||||| |||||||||||||| || || ||
Sbjct: 172 gcaccaccaccgtatcctcttcgacaagtaccatccgggctacttcggcaaggttggcat 231

                                                                       
Query: 226 gaggtacttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggct 285
           | | |||||||| |||||| |||||| |||||||  |||  | |||||| ||||| | ||
Sbjct: 232 gcgttacttccataagctccgcaacaagttctactgccccgcggtcaacatcgagcgcct 291

                                                                       
Query: 286 ctggtccatggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccgtcgt 345
           |||||| ||||||||  |||||||||| ||||||||||||||||||||||||||     |
Sbjct: 292 ctggtcgatggtgcccaccgacaaggcggcggaggccggcggcgacaaggccccgcagat 351

                                                                       
Query: 346 cgacgtctcgcagttcggctacttcaaggtgctcggcaaggggatgctgccggagaagcc 405
           ||||||| |||||||||||||||||||||||||||| |||||| ||||||||   |||||
Sbjct: 352 cgacgtcacgcagttcggctacttcaaggtgctcgggaagggggtgctgccgccaaagcc 411

                                   
Query: 406 cattgtcgtcaaggccaagctcat 429
           ||||||||||||||||||||||||
Sbjct: 412 cattgtcgtcaaggccaagctcat 435



to top

>gb|BT016384.1| Zea mays clone Contig217 mRNA sequence
          Length = 696

 Score =  381 bits (192), Expect = e-102
 Identities = 339/388 (87%)
 Strand = Plus / Plus

                                                                       
Query: 42  cggcggcggcgatgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccg 101
           |||||||||||||||| || ||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 34  cggcggcggcgatgacaacgcgcttcaagaagaaccgcaagaagcgcggccacgtgtccg 93

                                                                       
Query: 102 ccgggcacgggcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggag 161
           |||||||||| ||  | ||||||||| | ||||| || ||||| |||||||||||||| |
Sbjct: 94  ccgggcacggccgcatcggcaagcacaggaagcacccgggaggtcgcggtaacgccggtg 153

                                                                       
Query: 162 gcatgcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcg 221
           |||||||||||||||| ||||||  ||||||||||||||| |||||||||||||| || |
Sbjct: 154 gcatgcaccaccaccgtatcctcggcgacaagtaccatccgggctacttcggcaaggttg 213

                                                                       
Query: 222 gtatgaggtacttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgaga 281
           | ||| | |||||||| |||||| |||||| |||||||  |||  | |||||| ||||| 
Sbjct: 214 gcatgcgttacttccataagctccgcaacaagttctactgccccgcggtcaacatcgagc 273

                                                                       
Query: 282 ggctctggtccatggtgccgtccgacaaggccgcggaggccggcggcgacaaggcccccg 341
           | |||||||| ||||||||  |||||||||| ||||||||||||||||||||||||||  
Sbjct: 274 gcctctggtcgatggtgcccaccgacaaggcggcggaggccggcggcgacaaggccccgc 333

                                                                       
Query: 342 tcgtcgacgtctcgcagttcggctacttcaaggtgctcggcaaggggatgctgccggaga 401
              |||||||| |||||||||||||||||||||||||||| |||||| ||||||||   |
Sbjct: 334 agatcgacgtcacgcagttcggctacttcaaggtgctcgggaagggggtgctgccgccaa 393

                                       
Query: 402 agcccattgtcgtcaaggccaagctcat 429
           ||||||||||||||||||||||||||||
Sbjct: 394 agcccattgtcgtcaaggccaagctcat 421



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  361 bits (182), Expect = 1e-96
 Identities = 354/410 (86%), Gaps = 6/410 (1%)
 Strand = Plus / Minus

                                                                            
Query: 23       ccccaaggtaagccagcggcggcggcggcgatgacgacccgcctcaagaagaaccgcaag 82
                ||||||||||||||   |||||||||||||||||||||  |||| | |||||||||||||
Sbjct: 25183842 ccccaaggtaagcc---ggcggcggcggcgatgacgacgagcctgaggaagaaccgcaag 25183786

                                                                            
Query: 83       aagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcaccgcaagcatcccgga 142
                |||||||||||||| |||||||| ||||| ||  | || |||||||| ||||| || |||
Sbjct: 25183785 aagcgcggccacgtgtccgccggccacggccgcatcgggaagcaccggaagcacccggga 25183726

                                                                            
Query: 143      ggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccatccc 202
                ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 25183725 ggccggggcaacgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccacccg 25183666

                                                                            
Query: 203      ggctacttcggcaaagtcggtatgaggtacttccacaagctcagcaacaggttctacacc 262
                |||||||||||||| ||||| ||| | |||||||||| |||| |||||| ||||||| ||
Sbjct: 25183665 ggctacttcggcaaggtcggcatgcgctacttccacaggctccgcaacaagttctactcc 25183606

                                                                            
Query: 263      ccgaccgtcaacgtcgagaggctctggtccatggtgccgtccgacaaggccgcggaggcc 322
                ||| | || ||||| ||| |||||||||| ||||||||  ||||  |||| |||||||||
Sbjct: 25183605 ccggcggtgaacgtggagcggctctggtcgatggtgcccgccgagcaggcggcggaggcc 25183546

                                                                            
Query: 323      ggcggcgac---aaggcccccgtcgtcgacgtctcgcagttcggctacttcaaggtgctc 379
                | ||||| |   ||||| ||| |  | |||||  ||||||||||||||||||||||||||
Sbjct: 25183545 gccggcgccggcaaggcgcccctgctggacgtgacgcagttcggctacttcaaggtgctc 25183486

                                                                  
Query: 380      ggcaaggggatgctgccggagaagcccattgtcgtcaaggccaagctcat 429
                || |||||  ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 25183485 gggaagggtctgctgccggagaagcccatcgtcgtcaaggccaagctcat 25183436



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 33       agccagcggcggcggcggcgatg 55
                |||||||||||||||||||||||
Sbjct: 25315191 agccagcggcggcggcggcgatg 25315169



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 35       ccagcggcggcggcggcgatg 55
                |||||||||||||||||||||
Sbjct: 28178176 ccagcggcggcggcggcgatg 28178196



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 33      agccagcggcggcggcggcg 52
               ||||||||||||||||||||
Sbjct: 8021077 agccagcggcggcggcggcg 8021058



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 33      agccagcggcggcggcggcg 52
               ||||||||||||||||||||
Sbjct: 1247980 agccagcggcggcggcggcg 1247961



to top

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
           PAC clone:P0616D06
          Length = 153800

 Score =  361 bits (182), Expect = 1e-96
 Identities = 354/410 (86%), Gaps = 6/410 (1%)
 Strand = Plus / Minus

                                                                       
Query: 23  ccccaaggtaagccagcggcggcggcggcgatgacgacccgcctcaagaagaaccgcaag 82
           ||||||||||||||   |||||||||||||||||||||  |||| | |||||||||||||
Sbjct: 513 ccccaaggtaagcc---ggcggcggcggcgatgacgacgagcctgaggaagaaccgcaag 457

                                                                       
Query: 83  aagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcaccgcaagcatcccgga 142
           |||||||||||||| |||||||| ||||| ||  | || |||||||| ||||| || |||
Sbjct: 456 aagcgcggccacgtgtccgccggccacggccgcatcgggaagcaccggaagcacccggga 397

                                                                       
Query: 143 ggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccatccc 202
           ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 396 ggccggggcaacgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccacccg 337

                                                                       
Query: 203 ggctacttcggcaaagtcggtatgaggtacttccacaagctcagcaacaggttctacacc 262
           |||||||||||||| ||||| ||| | |||||||||| |||| |||||| ||||||| ||
Sbjct: 336 ggctacttcggcaaggtcggcatgcgctacttccacaggctccgcaacaagttctactcc 277

                                                                       
Query: 263 ccgaccgtcaacgtcgagaggctctggtccatggtgccgtccgacaaggccgcggaggcc 322
           ||| | || ||||| ||| |||||||||| ||||||||  ||||  |||| |||||||||
Sbjct: 276 ccggcggtgaacgtggagcggctctggtcgatggtgcccgccgagcaggcggcggaggcc 217

                                                                       
Query: 323 ggcggcgac---aaggcccccgtcgtcgacgtctcgcagttcggctacttcaaggtgctc 379
           | ||||| |   ||||| ||| |  | |||||  ||||||||||||||||||||||||||
Sbjct: 216 gccggcgccggcaaggcgcccctgctggacgtgacgcagttcggctacttcaaggtgctc 157

                                                             
Query: 380 ggcaaggggatgctgccggagaagcccattgtcgtcaaggccaagctcat 429
           || |||||  ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 156 gggaagggtctgctgccggagaagcccatcgtcgtcaaggccaagctcat 107



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 33     agccagcggcggcggcggcgatg 55
              |||||||||||||||||||||||
Sbjct: 131862 agccagcggcggcggcggcgatg 131840



to top

>dbj|AP003700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1003_H02
          Length = 124043

 Score =  361 bits (182), Expect = 1e-96
 Identities = 354/410 (86%), Gaps = 6/410 (1%)
 Strand = Plus / Minus

                                                                          
Query: 23     ccccaaggtaagccagcggcggcggcggcgatgacgacccgcctcaagaagaaccgcaag 82
              ||||||||||||||   |||||||||||||||||||||  |||| | |||||||||||||
Sbjct: 104329 ccccaaggtaagcc---ggcggcggcggcgatgacgacgagcctgaggaagaaccgcaag 104273

                                                                          
Query: 83     aagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcaccgcaagcatcccgga 142
              |||||||||||||| |||||||| ||||| ||  | || |||||||| ||||| || |||
Sbjct: 104272 aagcgcggccacgtgtccgccggccacggccgcatcgggaagcaccggaagcacccggga 104213

                                                                          
Query: 143    ggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccatccc 202
              ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 104212 ggccggggcaacgccggaggcatgcaccaccaccgcatcctcttcgacaagtaccacccg 104153

                                                                          
Query: 203    ggctacttcggcaaagtcggtatgaggtacttccacaagctcagcaacaggttctacacc 262
              |||||||||||||| ||||| ||| | |||||||||| |||| |||||| ||||||| ||
Sbjct: 104152 ggctacttcggcaaggtcggcatgcgctacttccacaggctccgcaacaagttctactcc 104093

                                                                          
Query: 263    ccgaccgtcaacgtcgagaggctctggtccatggtgccgtccgacaaggccgcggaggcc 322
              ||| | || ||||| ||| |||||||||| ||||||||  ||||  |||| |||||||||
Sbjct: 104092 ccggcggtgaacgtggagcggctctggtcgatggtgcccgccgagcaggcggcggaggcc 104033

                                                                          
Query: 323    ggcggcgac---aaggcccccgtcgtcgacgtctcgcagttcggctacttcaaggtgctc 379
              | ||||| |   ||||| ||| |  | |||||  ||||||||||||||||||||||||||
Sbjct: 104032 gccggcgccggcaaggcgcccctgctggacgtgacgcagttcggctacttcaaggtgctc 103973

                                                                
Query: 380    ggcaaggggatgctgccggagaagcccattgtcgtcaaggccaagctcat 429
              || |||||  ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 103972 gggaagggtctgctgccggagaagcccatcgtcgtcaaggccaagctcat 103923



to top

>gb|AY103771.1| Zea mays PCO152633 mRNA sequence
          Length = 740

 Score =  345 bits (174), Expect = 7e-92
 Identities = 338/392 (86%), Gaps = 3/392 (0%)
 Strand = Plus / Plus

                                                                       
Query: 41  gcggcggcggcgatgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctcc 100
           ||||||||||||||||||||  |||| ||||||||||| ||||||||||| ||||| || 
Sbjct: 57  gcggcggcggcgatgacgacgagcctgaagaagaaccggaagaagcgcgggcacgtgtcg 116

                                                                       
Query: 101 gccgggcacgggcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccgga 160
           || |||||||| ||  | ||||||||||| ||||| || ||||||||||| |||||||| 
Sbjct: 117 gcggggcacggccgcatcggcaagcaccggaagcacccgggaggccgcggcaacgccggc 176

                                                                       
Query: 161 ggcatgcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtc 220
           ||||||||||||||||||||||||||||| |||||||| || |||||||||||||| || 
Sbjct: 177 ggcatgcaccaccaccgcatcctcttcgataagtaccacccgggctacttcggcaaggtg 236

                                                                       
Query: 221 ggtatgaggtacttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgag 280
           || ||| | |||||||||| |||| |||||| |||| ||  |||| | |||||||| |||
Sbjct: 237 ggcatgcgctacttccacaggctccgcaacaagttccactgcccgtcggtcaacgtggag 296

                                                                       
Query: 281 aggctctggtccatggtgccgtccgacaaggccgcgga---ggccggcggcgacaaggcc 337
            |||||||||| ||||||||  ||| ||||||||||||   ||||||||  ||| |||||
Sbjct: 297 cggctctggtcgatggtgcccgccggcaaggccgcggaggcggccggcgcggaccaggcc 356

                                                                       
Query: 338 cccgtcgtcgacgtctcgcagttcggctacttcaaggtgctcggcaaggggatgctgccg 397
           ||  ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 357 ccgctcgtcgacgtgacgcagttcggctacttcaaggtgctcggcaaggggatgctgccg 416

                                           
Query: 398 gagaagcccattgtcgtcaaggccaagctcat 429
              | |||||| ||||||||||||||||||||
Sbjct: 417 tccaggcccatcgtcgtcaaggccaagctcat 448



to top

>ref|XM_479144.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 441

 Score =  329 bits (166), Expect = 4e-87
 Identities = 327/380 (86%), Gaps = 3/380 (0%)
 Strand = Plus / Plus

                                                                       
Query: 53  atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
           ||||||||  |||| | ||||||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 1   atgacgacgagcctgaggaagaaccgcaagaagcgcggccacgtgtccgccggccacggc 60

                                                                       
Query: 113 cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
           ||  | || |||||||| ||||| || |||||||| || |||||||||||||||||||||
Sbjct: 61  cgcatcgggaagcaccggaagcacccgggaggccggggcaacgccggaggcatgcaccac 120

                                                                       
Query: 173 caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
           |||||||||||||||||||||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 121 caccgcatcctcttcgacaagtaccacccgggctacttcggcaaggtcggcatgcgctac 180

                                                                       
Query: 233 ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtcc 292
           ||||||| |||| |||||| ||||||| ||||| | || ||||| ||| |||||||||| 
Sbjct: 181 ttccacaggctccgcaacaagttctactccccggcggtgaacgtggagcggctctggtcg 240

                                                                       
Query: 293 atggtgccgtccgacaaggccgcggaggccggcggcgac---aaggcccccgtcgtcgac 349
           ||||||||  ||||  |||| |||||||||| ||||| |   ||||| ||| |  | |||
Sbjct: 241 atggtgcccgccgagcaggcggcggaggccgccggcgccggcaaggcgcccctgctggac 300

                                                                       
Query: 350 gtctcgcagttcggctacttcaaggtgctcggcaaggggatgctgccggagaagcccatt 409
           ||  |||||||||||||||||||||||||||| |||||  ||||||||||||||||||| 
Sbjct: 301 gtgacgcagttcggctacttcaaggtgctcgggaagggtctgctgccggagaagcccatc 360

                               
Query: 410 gtcgtcaaggccaagctcat 429
           ||||||||||||||||||||
Sbjct: 361 gtcgtcaaggccaagctcat 380



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  295 bits (149), Expect = 6e-77
 Identities = 314/367 (85%), Gaps = 9/367 (2%)
 Strand = Plus / Plus

                                                                           
Query: 66      tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
               ||||||||||||| ||||||||||| ||||| || ||||||||||||||  | || ||||
Sbjct: 4134967 tcaagaagaaccggaagaagcgcgggcacgtgtcggccgggcacgggcggatcgggaagc 4135026

                                                                           
Query: 126     accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
               |||| ||||| || ||||| ||||| |||||||| || |||||||||||||||||||| |
Sbjct: 4135027 accggaagcacccgggagggcgcgggaacgccggcgggatgcaccaccaccgcatcctgt 4135086

                                                                           
Query: 186     tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
               ||||||||||||| || |||||||||||||| ||||| ||| | |||||||||| |||||
Sbjct: 4135087 tcgacaagtaccacccgggctacttcggcaaggtcgggatgcgctacttccacaggctca 4135146

                                                                           
Query: 246     gcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtccatggtgccgtccg 305
               ||||||||||| ||  |||  |||||||||||||| | ||||||||||||||||   |||
Sbjct: 4135147 gcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtccatggtgc---ccg 4135203

                                                                           
Query: 306     acaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtctcgcagttcggct 365
                | |||||   |  ||||||| || ||||||||||||| |||||||| ||||||||||||
Sbjct: 4135204 ccgaggcc---ggcgccggcgccggcaaggcccccgtcatcgacgtcacgcagttcggct 4135260

                                                                           
Query: 366     acttcaaggtgctcggcaaggggatgct---gccggagaagcccattgtcgtcaaggcca 422
               ||  ||||||||||||||||||||||||    || |||| |||||| |||||||||||||
Sbjct: 4135261 acaccaaggtgctcggcaaggggatgctccccccagagaggcccatcgtcgtcaaggcca 4135320

                      
Query: 423     agctcat 429
               |||||||
Sbjct: 4135321 agctcat 4135327



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 37      agcggcggcggcggcgatgacg 58
               ||||||||||||||||||||||
Sbjct: 1574642 agcggcggcggcggcgatgacg 1574621



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 36       cagcggcggcggcggcgatg 55
                ||||||||||||||||||||
Sbjct: 35261986 cagcggcggcggcggcgatg 35262005



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 34       gccagcggcggcggcggcga 53
                ||||||||||||||||||||
Sbjct: 32632365 gccagcggcggcggcggcga 32632346



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 36       cagcggcggcggcggcgatg 55
                ||||||||||||||||||||
Sbjct: 32565471 cagcggcggcggcggcgatg 32565490



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 38       gcggcggcggcggcgatgac 57
                ||||||||||||||||||||
Sbjct: 12603204 gcggcggcggcggcgatgac 12603223



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 35       ccagcggcggcggcggcgatgacg 58
                ||||||||||||||||||| ||||
Sbjct: 10835658 ccagcggcggcggcggcgacgacg 10835681



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 313     cgcggaggccggcggcgaca 332
               ||||||||||||||||||||
Sbjct: 8040499 cgcggaggccggcggcgaca 8040518



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 38      gcggcggcggcggcgatgacgacc 61
               |||||||||||||||||| |||||
Sbjct: 5619380 gcggcggcggcggcgatgccgacc 5619357



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     agccagcggcggcggcggcg 52
              ||||||||||||||||||||
Sbjct: 623461 agccagcggcggcggcggcg 623442



to top

>dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1077_E05
          Length = 116305

 Score =  295 bits (149), Expect = 6e-77
 Identities = 314/367 (85%), Gaps = 9/367 (2%)
 Strand = Plus / Plus

                                                                         
Query: 66    tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
             ||||||||||||| ||||||||||| ||||| || ||||||||||||||  | || ||||
Sbjct: 44981 tcaagaagaaccggaagaagcgcgggcacgtgtcggccgggcacgggcggatcgggaagc 45040

                                                                         
Query: 126   accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
             |||| ||||| || ||||| ||||| |||||||| || |||||||||||||||||||| |
Sbjct: 45041 accggaagcacccgggagggcgcgggaacgccggcgggatgcaccaccaccgcatcctgt 45100

                                                                         
Query: 186   tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
             ||||||||||||| || |||||||||||||| ||||| ||| | |||||||||| |||||
Sbjct: 45101 tcgacaagtaccacccgggctacttcggcaaggtcgggatgcgctacttccacaggctca 45160

                                                                         
Query: 246   gcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtccatggtgccgtccg 305
             ||||||||||| ||  |||  |||||||||||||| | ||||||||||||||||   |||
Sbjct: 45161 gcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtccatggtgc---ccg 45217

                                                                         
Query: 306   acaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtctcgcagttcggct 365
              | |||||   |  ||||||| || ||||||||||||| |||||||| ||||||||||||
Sbjct: 45218 ccgaggcc---ggcgccggcgccggcaaggcccccgtcatcgacgtcacgcagttcggct 45274

                                                                         
Query: 366   acttcaaggtgctcggcaaggggatgct---gccggagaagcccattgtcgtcaaggcca 422
             ||  ||||||||||||||||||||||||    || |||| |||||| |||||||||||||
Sbjct: 45275 acaccaaggtgctcggcaaggggatgctccccccagagaggcccatcgtcgtcaaggcca 45334

                    
Query: 423   agctcat 429
             |||||||
Sbjct: 45335 agctcat 45341



to top

>dbj|AK121069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061G23, full
           insert sequence
          Length = 727

 Score =  295 bits (149), Expect = 6e-77
 Identities = 314/367 (85%), Gaps = 9/367 (2%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||||| ||||||||||| ||||| || ||||||||||||||  | || ||||
Sbjct: 69  tcaagaagaaccggaagaagcgcgggcacgtgtcggccgggcacgggcggatcgggaagc 128

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| ||||| || ||||| ||||| |||||||| || |||||||||||||||||||| |
Sbjct: 129 accggaagcacccgggagggcgcgggaacgccggcgggatgcaccaccaccgcatcctgt 188

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           ||||||||||||| || |||||||||||||| ||||| ||| | |||||||||| |||||
Sbjct: 189 tcgacaagtaccacccgggctacttcggcaaggtcgggatgcgctacttccacaggctca 248

                                                                       
Query: 246 gcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtccatggtgccgtccg 305
           ||||||||||| ||  |||  |||||||||||||| | ||||||||||||||||   |||
Sbjct: 249 gcaacaggttccactgccccgccgtcaacgtcgagcgcctctggtccatggtgc---ccg 305

                                                                       
Query: 306 acaaggccgcggaggccggcggcgacaaggcccccgtcgtcgacgtctcgcagttcggct 365
            | |||||   |  ||||||| || ||||||||||||| |||||||| ||||||||||||
Sbjct: 306 ccgaggcc---ggcgccggcgccggcaaggcccccgtcatcgacgtcacgcagttcggct 362

                                                                       
Query: 366 acttcaaggtgctcggcaaggggatgct---gccggagaagcccattgtcgtcaaggcca 422
           ||  ||||||||||||||||||||||||    || |||| |||||| |||||||||||||
Sbjct: 363 acaccaaggtgctcggcaaggggatgctccccccagagaggcccatcgtcgtcaaggcca 422

                  
Query: 423 agctcat 429
           |||||||
Sbjct: 423 agctcat 429



to top

>dbj|AB077113.1| Prunus persica mRNA, microsatellite marker M9a
          Length = 630

 Score =  252 bits (127), Expect = 8e-64
 Identities = 211/239 (88%)
 Strand = Plus / Plus

                                                                       
Query: 53  atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
           |||||||||||  |||||||||||||||||||| | |||||||||  ||||||||| || 
Sbjct: 51  atgacgacccgattcaagaagaaccgcaagaagagaggccacgtcagcgccgggcatggt 110

                                                                       
Query: 113 cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
           ||| | |||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 111 cgtatcggcaagcaccgcaagcatcctggaggtcgcggtaacgccggaggcatgcaccac 170

                                                                       
Query: 173 caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
           ||||||||||||||||||||||||||||| || || || || ||||| |||||| | |||
Sbjct: 171 caccgcatcctcttcgacaagtaccatccggggtattttggtaaagttggtatgcgctac 230

                                                                      
Query: 233 ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtc 291
           |||||||||||| |||||| |||||||  ||| | |||||||||||| | |||||||||
Sbjct: 231 ttccacaagctccgcaacaagttctactgccccatcgtcaacgtcgacaagctctggtc 289



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 402 agcccattgtcgtcaaggccaagctcat 429
           ||||| |||| |||||||||||||||||
Sbjct: 403 agcccgttgtggtcaaggccaagctcat 430



to top

>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172,
             complete sequence
          Length = 127731

 Score =  220 bits (111), Expect = 3e-54
 Identities = 207/239 (86%)
 Strand = Plus / Minus

                                                                         
Query: 53    atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
             ||||||||| |  ||||||||||| | |||||| | |||||||||  |||||| ||||| 
Sbjct: 97724 atgacgaccagattcaagaagaacaggaagaagagaggccacgtcagcgccggccacggt 97665

                                                                         
Query: 113   cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
             ||  | |||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 97664 cgaatcggcaagcaccgcaagcatccaggaggtcgcggtaacgccggaggcatgcaccac 97605

                                                                         
Query: 173   caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
             |||||||||||||||||||||||||||||||| ||||||||||| || |||||| | |||
Sbjct: 97604 caccgcatcctcttcgacaagtaccatcccggttacttcggcaaggttggtatgcgctac 97545

                                                                        
Query: 233   ttccacaagctcagcaacaggttctacaccccgaccgtcaacgtcgagaggctctggtc 291
             |||||||||||| |||||  |||||    ||| ||||||||| |||| | |||||||||
Sbjct: 97544 ttccacaagctccgcaaccagttcttttgccccaccgtcaacatcgacaagctctggtc 97486



to top

>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence
          Length = 117437

 Score =  174 bits (88), Expect = 2e-40
 Identities = 166/192 (86%)
 Strand = Plus / Plus

                                                                        
Query: 53   atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
            ||||| |||||  ||||||||||| | ||||||||||||||||||   ||||| ||||| 
Sbjct: 6890 atgacaacccgattcaagaagaacaggaagaagcgcggccacgtcagtgccggtcacggt 6949

                                                                        
Query: 113  cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
            ||| | || || |||||||||||||||||||| || |||||||||||||| ||||| |||
Sbjct: 6950 cgtatcggaaaacaccgcaagcatcccggaggtcgtggtaacgccggaggtatgcatcac 7009

                                                                        
Query: 173  caccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtac 232
            || |||||||||||||||||||||||||| || |||||||| ||||| |||||| | |||
Sbjct: 7010 catcgcatcctcttcgacaagtaccatccaggttacttcggtaaagttggtatgcgttac 7069

                        
Query: 233  ttccacaagctc 244
            || |||||||||
Sbjct: 7070 tttcacaagctc 7081



to top

>ref|NM_105728.2| Arabidopsis thaliana structural constituent of ribosome AT1G70600
           mRNA, complete cds
          Length = 737

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 65  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 124

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 125 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 184

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 185 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 244

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 245 ggaacaagttct 256



to top

>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence
          Length = 122251

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Minus

                                                                          
Query: 52     gatgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgg 111
              ||||||||||||| ||||||||||| | |||||| | || |||||   |||||| |||||
Sbjct: 106028 gatgacgacccgcttcaagaagaacaggaagaagagaggtcacgtgagcgccggtcacgg 105969

                                                                          
Query: 112    gcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcacca 171
               ||| | || ||||| ||||||||||||||||| || |||||||||||||| ||||||||
Sbjct: 105968 tcgtatcggaaagcatcgcaagcatcccggaggtcgtggtaacgccggaggaatgcacca 105909

                                                                          
Query: 172    ccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggta 231
              ||| || ||||||||||||||||| ||||| || |||||||| || || |||||| | ||
Sbjct: 105908 ccatcgtatcctcttcgacaagtatcatccaggttacttcggtaaggttggtatgcgcta 105849

                          
Query: 232    cttccacaagct 243
              ||| ||||||||
Sbjct: 105848 ctttcacaagct 105837



to top

>gb|AY091706.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds
          Length = 441

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 14  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 73

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 74  accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 133

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 134 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 193

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 194 ggaacaagttct 205



to top

>gb|AY048228.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds
          Length = 665

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 63  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 122

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 123 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 182

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 183 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 242

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 243 ggaacaagttct 254



to top

>gb|AY039519.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds
          Length = 644

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 63  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 122

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 123 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 182

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 183 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 242

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 243 ggaacaagttct 254



to top

>emb|BX813428.1|CNS0AARB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 682

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 57  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 116

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 117 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 176

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 177 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 236

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 237 ggaacaagttct 248



to top

>emb|BX827775.1|CNS0A4FW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH20ZA08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 633

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Minus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 585 tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 526

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 525 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 466

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 465 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 406

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 405 ggaacaagttct 394



to top

>gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24J13 genomic sequence, complete
             sequence
          Length = 87400

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Minus

                                                                         
Query: 66    tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
             ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 71508 tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 71449

                                                                         
Query: 126   accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
             |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 71448 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 71389

                                                                         
Query: 186   tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
             |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 71388 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 71329

                         
Query: 246   gcaacaggttct 257
             | |||| |||||
Sbjct: 71328 ggaacaagttct 71317



to top

>gb|AC011663.7|AC011663 Arabidopsis thaliana chromosome 1 BAC F5A18 genomic sequence, complete
             sequence
          Length = 108582

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                         
Query: 66    tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
             ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 82994 tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 83053

                                                                         
Query: 126   accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
             |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 83054 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 83113

                                                                         
Query: 186   tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
             |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 83114 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 83173

                         
Query: 246   gcaacaggttct 257
             | |||| |||||
Sbjct: 83174 ggaacaagttct 83185



to top

>gb|AY085573.1| Arabidopsis thaliana clone 15789 mRNA, complete sequence
          Length = 628

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 65  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 124

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 125 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 184

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 185 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 244

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 245 ggaacaagttct 256



to top

>emb|X91959.1|AT60SRL27 A.thaliana mRNA for 60S ribosomal protein L27a
          Length = 641

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||
Sbjct: 46  tcaagaagaacaggaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagc 105

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           |||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||||||
Sbjct: 106 accgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatcctct 165

                                                                       
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagctca 245
           |||||||||||||||| || |||||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 166 tcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaagctga 225

                       
Query: 246 gcaacaggttct 257
           | |||| |||||
Sbjct: 226 ggaacaagttct 237



to top

>emb|CT573365.4| M.truncatula DNA sequence from clone MTH2-89E15 on chromosome 3,
             complete sequence
          Length = 123679

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Minus

                                                                         
Query: 52    gatgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgg 111
             ||||||||||||| ||||||||||| | |||||| | || |||||   |||||| |||||
Sbjct: 19110 gatgacgacccgcttcaagaagaacaggaagaagagaggtcacgtgagcgccggtcacgg 19051

                                                                         
Query: 112   gcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcacca 171
              ||| | || ||||| ||||||||||||||||| || |||||||||||||| ||||||||
Sbjct: 19050 tcgtatcggaaagcatcgcaagcatcccggaggtcgtggtaacgccggaggaatgcacca 18991

                                                                         
Query: 172   ccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggta 231
             ||| || ||||||||||||||||| ||||| || |||||||| || || |||||| | ||
Sbjct: 18990 ccatcgtatcctcttcgacaagtatcatccaggttacttcggtaaggttggtatgcgcta 18931

                         
Query: 232   cttccacaagct 243
             ||| ||||||||
Sbjct: 18930 ctttcacaagct 18919



to top

>gb|AY804547.1| Drosophila yakuba strain Tai18 ribosomal protein L27A (RpL27A)
           gene, partial cds
          Length = 866

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 289 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 348

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 349 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 407



to top

>gb|AY804546.1| Drosophila santomea strain STO.4 ribosomal protein L27A (RpL27A)
           gene, partial cds
          Length = 862

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 285 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 344

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 345 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 403



to top

>gb|AY804956.1| Drosophila yakuba isolate 1250_4 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804955.1| Drosophila yakuba isolate 1250_3 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804953.1| Drosophila yakuba isolate 1250_1 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804952.1| Drosophila santomea isolate 1250_3 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804951.1| Drosophila santomea isolate 1250_2 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804950.1| Drosophila santomea isolate 1250_1 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804949.1| Drosophila santomea isolate 1566_4 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804948.1| Drosophila santomea isolate 1566_3 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804947.1| Drosophila santomea isolate 1566_2 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804946.1| Drosophila santomea isolate 1566_1 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804944.1| Drosophila yakuba isolate SaoT_2 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804943.1| Drosophila yakuba isolate SaoT_1 RpL27A gene, partial sequence
          Length = 822

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY232080.1| Drosophila yakuba clone yak-ad_RpL27A mRNA sequence
          Length = 432

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 55  ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 114

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 115 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 173



to top

>gb|AY231794.1| Drosophila yakuba clone yak-em_RpL27A mRNA sequence
          Length = 444

 Score =  149 bits (75), Expect = 9e-33
 Identities = 108/119 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 67  ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 126

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 127 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 185



to top

>gb|AY804954.1| Drosophila yakuba isolate 1250_2 RpL27A gene, partial sequence
          Length = 822

 Score =  145 bits (73), Expect = 1e-31
 Identities = 107/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||| ||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttygacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>gb|AY804945.1| Drosophila yakuba isolate SaoT_3 RpL27A gene, partial sequence
          Length = 822

 Score =  145 bits (73), Expect = 1e-31
 Identities = 107/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           || ||||||||||||||||||||||| ||||||||||| || || |||||||||||||||
Sbjct: 291 ggyaagcaccgcaagcatcccggaggtcgcggtaacgctggtggtatgcaccaccaccgc 350

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| |||||||||||| |||||||
Sbjct: 351 atcaacttcgacaaataccatcctggttacttcggcaaggtcggtatgaggaacttcca 409



to top

>emb|BX817859.1|CNS0AEEA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL45ZD07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 646

 Score =  143 bits (72), Expect = 5e-31
 Identities = 120/136 (88%)
 Strand = Plus / Plus

                                                                       
Query: 122 aagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatc 181
           |||||||| |||||||||||||| || |||||||| ||||| ||||| |||||| | |||
Sbjct: 108 aagcaccgtaagcatcccggaggtcgtggtaacgctggaggtatgcatcaccacaggatc 167

                                                                       
Query: 182 ctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaag 241
           |||||||||||||||||||| || |||||||| ||||| ||||||||||| |||||||||
Sbjct: 168 ctcttcgacaagtaccatccaggttacttcggtaaagttggtatgaggtatttccacaag 227

                           
Query: 242 ctcagcaacaggttct 257
           || || |||| |||||
Sbjct: 228 ctgaggaacaagttct 243



to top

>gb|DQ191629.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA,
           complete cds
          Length = 649

 Score =  139 bits (70), Expect = 8e-30
 Identities = 151/178 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||||| |||||||||  |||||| || || |||||||| ||||
Sbjct: 66  tcaagaagaacaggaagaagcgtggccacgtcagcgccggacatggtcgtgtgggaaagc 125

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           || | |||||||| |||||  | |||||||||||||| |||||||| ||| | ||||| |
Sbjct: 126 acaggaagcatccaggaggaagaggtaacgccggaggtatgcaccatcacaggatccttt 185

                                                                     
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||||| || |||||||| ||||| |||||| | || |||||||||||
Sbjct: 186 tcgacaagtaccatcctggttacttcggtaaagtaggtatgcgttatttccacaagct 243



to top

>ref|NM_102178.2| Arabidopsis thaliana RPL27A (RIBOSOMAL PROTEIN L27A); structural
           constituent of ribosome AT1G23290 (RPL27A) mRNA,
           complete cds
          Length = 604

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 68  aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
           ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 39  aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 98

                                                                       
Query: 128 cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
           || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 99  cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 158

                                                                   
Query: 188 gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 159 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 214



to top

>gb|AF349525.1| Arabidopsis thaliana putative 60s ribosomal protein l27a
           (At1g23290) mRNA, complete cds
          Length = 491

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 68  aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
           ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 16  aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 75

                                                                       
Query: 128 cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
           || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 76  cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 135

                                                                   
Query: 188 gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 136 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 191



to top

>gb|AF324716.2| Arabidopsis thaliana At1g23290 (At1g23290/F26F24_23) mRNA, complete
           cds
          Length = 572

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 68  aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
           ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 40  aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 99

                                                                       
Query: 128 cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
           || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 100 cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 159

                                                                   
Query: 188 gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 160 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 215



to top

>emb|BX814201.1|CNS0AC9G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 568

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 68  aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
           ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 21  aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 80

                                                                       
Query: 128 cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
           || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 81  cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 140

                                                                   
Query: 188 gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 141 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 196



to top

>emb|BX814197.1|CNS0AC79 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 568

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 68  aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
           ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 21  aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 80

                                                                       
Query: 128 cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
           || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 81  cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 140

                                                                   
Query: 188 gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 141 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 196



to top

>emb|BX814930.1|CNS0ABGE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS19ZG02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 545

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 68  aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
           ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 28  aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 87

                                                                       
Query: 128 cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
           || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 88  cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 147

                                                                   
Query: 188 gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 148 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 203



to top

>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I,
             complete sequence
          Length = 99053

 Score =  135 bits (68), Expect = 1e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                         
Query: 68    aagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcac 127
             ||||||||| | |||||| | || ||||||  |||||| || || ||| | || ||||||
Sbjct: 39378 aagaagaacagaaagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcac 39437

                                                                         
Query: 128   cgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttc 187
             || |||||||||||||| || || ||||| ||||| ||||| |||||| | |||||||||
Sbjct: 39438 cgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatcctcttc 39497

                                                                     
Query: 188   gacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
             |||||||||||||| || |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 39498 gacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaagct 39553



to top

>gb|BT022137.2| Drosophila melanogaster IP01552 full insert cDNA
          Length = 2992

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 525 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 466

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 465 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 407



to top

>ref|NM_057615.3| Drosophila melanogaster Ribosomal protein L27A CG15442-RA (RpL27A),
           mRNA
          Length = 643

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 143 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 202

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 203 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 261



to top

>gb|AY071144.1| Drosophila melanogaster RE17991 full length cDNA
          Length = 649

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 143 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 202

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 203 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 261



to top

>gb|AC092232.1|AC092232 Drosophila melanogaster, chromosome 2L, region 24E-24F, BAC clone
             BACR28K16, complete sequence
          Length = 182897

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                         
Query: 119   ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
             |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 70928 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 70987

                                                                        
Query: 179   atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
             |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 70988 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 71046



to top

>gb|AE003576.5| Drosophila melanogaster chromosome 2L, section 15 of 83 of the complete
              sequence
          Length = 289893

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Minus

                                                                          
Query: 119    ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
              |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 136739 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 136680

                                                                         
Query: 179    atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
              |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 136679 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 136621



to top

>gb|U66357.1|DMU66357 Drosophila melanogaster ribosomal protein RpL27a gene, complete cds
          Length = 1099

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 313 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 372

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 373 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 431



to top

>gb|U66358.1|DMU66358 Drosophila melanogaster ribosomal protein L27a homolog mRNA,
           complete cds
          Length = 565

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 83  ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 142

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 143 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 201



to top

>gb|AC004267.1|AC004267 Drosophila melanogaster DNA sequence (P1 DS07968 (D117)), complete
             sequence
          Length = 31557

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Minus

                                                                         
Query: 119   ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
             |||||||||||||||||||||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 10960 ggcaagcaccgcaagcatcccggaggtcgcggtaacgctggtggcatgcaccatcaccgc 10901

                                                                        
Query: 179   atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
             |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 10900 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 10842



to top

>gb|DQ191661.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA,
           complete cds
          Length = 665

 Score =  131 bits (66), Expect = 2e-27
 Identities = 150/178 (84%)
 Strand = Plus / Plus

                                                                       
Query: 66  tcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagc 125
           ||||||||||| | |||||||| |||||||||  |||||| || || ||||| || ||||
Sbjct: 63  tcaagaagaacaggaagaagcgtggccacgtcagcgccggacatggtcgtgtcggaaagc 122

                                                                       
Query: 126 accgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctct 185
           || | |||||||| |||||  | |||||||||||||| |||||||| ||| | ||||| |
Sbjct: 123 acaggaagcatccaggaggaagaggtaacgccggaggtatgcaccatcacaggatccttt 182

                                                                     
Query: 186 tcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaagct 243
           |||||||||||||||| || |||||||| ||||| |||||| | || |||||||||||
Sbjct: 183 tcgacaagtaccatcctggttacttcggtaaagtaggtatgcgttatttccacaagct 240



to top

>gb|BT000542.1| Arabidopsis thaliana 60s ribosomal protein l27a.
           (At1g23290/F26F24_23) mRNA, complete cds
          Length = 441

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Plus

                                                                       
Query: 122 aagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatc 181
           |||||||| |||||||||||||| || || ||||| ||||| ||||| |||||| | |||
Sbjct: 70  aagcaccgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatc 129

                                                                       
Query: 182 ctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaag 241
           |||||||||||||||||||| || |||||||| ||||| ||||||||||| |||||||||
Sbjct: 130 ctcttcgacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaag 189

             
Query: 242 ct 243
           ||
Sbjct: 190 ct 191



to top

>gb|AF410280.1|AF410280 Arabidopsis thaliana At1g23290/F26F24_23 mRNA, complete cds
          Length = 571

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Plus

                                                                       
Query: 122 aagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatc 181
           |||||||| |||||||||||||| || || ||||| ||||| ||||| |||||| | |||
Sbjct: 94  aagcaccgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatc 153

                                                                       
Query: 182 ctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaag 241
           |||||||||||||||||||| || |||||||| ||||| ||||||||||| |||||||||
Sbjct: 154 ctcttcgacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaag 213

             
Query: 242 ct 243
           ||
Sbjct: 214 ct 215



to top

>gb|AY086256.1| Arabidopsis thaliana clone 23092 mRNA, complete sequence
          Length = 570

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Plus

                                                                       
Query: 122 aagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatc 181
           |||||||| |||||||||||||| || || ||||| ||||| ||||| |||||| | |||
Sbjct: 95  aagcaccgtaagcatcccggaggtcgtggaaacgcaggaggtatgcatcaccacaggatc 154

                                                                       
Query: 182 ctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccacaag 241
           |||||||||||||||||||| || |||||||| ||||| ||||||||||| |||||||||
Sbjct: 155 ctcttcgacaagtaccatccaggttacttcgggaaagttggtatgaggtatttccacaag 214

             
Query: 242 ct 243
           ||
Sbjct: 215 ct 216



to top

>gb|BT016406.1| Zea mays clone Contig239 mRNA sequence
          Length = 1257

 Score =  127 bits (64), Expect = 3e-26
 Identities = 97/108 (89%)
 Strand = Plus / Minus

                                                                       
Query: 322 cggcggcgacaaggcccccgtcgtcgacgtctcgcagttcggctacttcaaggtgctcgg 381
           ||||||||||||||||||     |||||||| ||||||||||||||||||||||||||||
Sbjct: 368 cggcggcgacaaggccccgcagatcgacgtcacgcagttcggctacttcaaggtgctcgg 309

                                                           
Query: 382 caaggggatgctgccggagaagcccattgtcgtcaaggccaagctcat 429
            |||||| ||||||||   |||||||||||||||||||||||||||||
Sbjct: 308 gaagggggtgctgccgccaaagcccattgtcgtcaaggccaagctcat 261



to top

>dbj|AB042856.1| Panax ginseng mRNA for 60S ribosomal protein L27a, complete cds
          Length = 590

 Score =  127 bits (64), Expect = 3e-26
 Identities = 136/160 (85%)
 Strand = Plus / Plus

                                                                       
Query: 100 cgccgggcacgggcgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccgg 159
           |||||| ||||| ||| | ||||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 64  cgccggtcacggccgtatcggcaagcaccgtaagcatcccggaggtcgcggaaacgccgg 123

                                                                       
Query: 160 aggcatgcaccaccaccgcatcctcttcgacaagtaccatcccggctacttcggcaaagt 219
           ||| |||||||||||||| ||| | ||||||||||||||||| || || || || || ||
Sbjct: 124 aggaatgcaccaccaccggatcttgttcgacaagtaccatccgggttattttgggaaggt 183

                                                   
Query: 220 cggtatgaggtacttccacaagctcagcaacaggttctac 259
            || |||||||| ||||| | |||| |||||| |||||||
Sbjct: 184 gggaatgaggtatttccataggctccgcaacaagttctac 223



to top

>gb|AF459726.1| Elaeocarpus angustifolius clone scu22Eg microsatellite sequence
          Length = 229

 Score =  123 bits (62), Expect = 5e-25
 Identities = 122/142 (85%)
 Strand = Plus / Minus

                                                                       
Query: 53  atgacgacccgcctcaagaagaaccgcaagaagcgcggccacgtctccgccgggcacggg 112
           ||||| |||||  ||||||||||||| ||||||||||| |||||   ||| || ||||| 
Sbjct: 142 atgacaacccgtttcaagaagaaccgtaagaagcgcgggcacgtgagcgcaggacacggt 83

                                                                       
Query: 113 cgtgtgggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccac 172
           ||| | ||||||||||| || ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 82  cgtatcggcaagcaccgaaaacatccaggaggtcgcggtaacgccggaggtatgcaccac 23

                                 
Query: 173 caccgcatcctcttcgacaagt 194
           ||| | ||||||||||||||||
Sbjct: 22  cacaggatcctcttcgacaagt 1



to top

>emb|X74484.1|DMRPL27A D.melanogaster mRNA for ribosomal protein L27a
          Length = 456

 Score =  117 bits (59), Expect = 3e-23
 Identities = 104/119 (87%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           |||||||||||||||||||||||||| |||||||||   || ||||||||||| ||||||
Sbjct: 70  ggcaagcaccgcaagcatcccggaggtcgcggtaacctgggtggcatgcaccatcaccgc 129

                                                                      
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttcca 237
           |||  ||||||||| |||||||| || ||||||||||| || || |||||| |||||||
Sbjct: 130 atcaacttcgacaaataccatcctggttacttcggcaaggtgggcatgaggaacttcca 188



to top

>gb|AY432710.1| Aedes aegypti ASAP ID: 34035 cytosolic large ribosomal subunit L27A
           mRNA sequence
          Length = 658

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| ||||| || || || ||||||||||| || ||||||||||| ||||||
Sbjct: 154 ggcaagcaccgtaagcaccctggtggtcgcggtaacgctggtggcatgcaccatcaccgc 213

                                                                       
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccac 238
           |||  ||||||||| ||||| || || ||||||||||| |||||||||||| ||||||||
Sbjct: 214 atcaacttcgacaaataccaccctggatacttcggcaaggtcggtatgaggaacttccac 273



to top

>gb|DQ440054.1| Aedes aegypti clone AE-306 60S ribosomal protein L15/L27 mRNA,
           complete cds
          Length = 450

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| ||||| || || || ||||||||||| || ||||||||||| ||||||
Sbjct: 73  ggcaagcaccgtaagcaccctggtggtcgcggtaacgctggtggcatgcaccatcaccgc 132

                                                                       
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatgaggtacttccac 238
           |||  ||||||||| ||||| || || ||||||||||| |||||||||||| ||||||||
Sbjct: 133 atcaacttcgacaaataccaccctggatacttcggcaaggtcggtatgaggaacttccac 192



to top

>gb|AY961477.1| Phytophthora infestans clone MY-19-H-09 ribosomal protein L27 mRNA,
           complete cds
          Length = 545

 Score =  103 bits (52), Expect = 5e-19
 Identities = 130/156 (83%)
 Strand = Plus / Plus

                                                                       
Query: 71  aagaaccgcaagaagcgcggccacgtctccgccgggcacgggcgtgtgggcaagcaccgc 130
           |||||||||||||| ||||| |||||   |||||| ||||| ||| | ||||||||||||
Sbjct: 26  aagaaccgcaagaaacgcggacacgtgagcgccggccacggtcgtatcggcaagcaccgc 85

                                                                       
Query: 131 aagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgcatcctcttcgac 190
           ||||| || || || |||||||||||||| |||  |||||||||||| |||||  | |||
Sbjct: 86  aagcacccgggtggtcgcggtaacgccggtggccagcaccaccaccgtatccttatggac 145

                                               
Query: 191 aagtaccatcccggctacttcggcaaagtcggtatg 226
           |||| ||| || || |||||||| || |||||||||
Sbjct: 146 aagttccaccctggttacttcggtaaggtcggtatg 181



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 361 cggctacttcaaggtgctcggcaaggg 387
           |||||||||||||||||||||||||||
Sbjct: 325 cggctacttcaaggtgctcggcaaggg 351



to top

>emb|BX071844.1|CNS09RLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 722 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 663

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 662 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 615



to top

>emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 158 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 217

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 218 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 265



to top

>emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 732 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 673

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 672 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 625



to top

>emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 142 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 201

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 202 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 249



to top

>emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 153 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 212

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 213 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 260



to top

>emb|BX071150.1|CNS09R2A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 738 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 679

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 678 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 631



to top

>emb|BX071149.1|CNS09R29 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 131 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 190

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 191 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 238



to top

>emb|BX071048.1|CNS09QZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 723 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 664

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 663 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 616



to top

>emb|BX071325.1|CNS09R75 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 715 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 656

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 655 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 608



to top

>emb|BX071324.1|CNS09R74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 136 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 195

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 196 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 243



to top

>emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 157 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 216

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 217 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 264



to top

>emb|BX070688.1|CNS09QPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 711 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 652

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 651 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 604



to top

>emb|BX070687.1|CNS09QPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 139 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 198

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 199 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 246



to top

>emb|BX070669.1|CNS09QOX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX070195.1|CNS09QBR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 145 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 204

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 205 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 252



to top

>emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 744 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 685

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 684 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 637



to top

>emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 139 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 198

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 199 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 246



to top

>emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 725 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 666

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 665 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 618



to top

>emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 175 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 234

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 235 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 282



to top

>emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 153 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 212

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 213 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 260



to top

>emb|BX069763.1|CNS09PZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 138 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 197

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 198 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 245



to top

>emb|BX069694.1|CNS09PXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 150 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 209

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 210 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 257



to top

>emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 170 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 229

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 230 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 277



to top

>emb|BX069225.1|CNS09PKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 661 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 602

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 601 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 554



to top

>emb|BX069118.1|CNS09PHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 139 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 198

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 199 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 246



to top

>emb|BX069067.1|CNS09PGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 732 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 673

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 672 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 625



to top

>emb|BX069066.1|CNS09PGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 152 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 211

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 212 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 259



to top

>emb|BX068786.1|CNS09P8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 154 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 213

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 214 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 261



to top

>emb|BX068729.1|CNS09P71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 145 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 204

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 205 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 252



to top

>emb|BX068402.1|CNS09OXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 746 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 687

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 686 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 639



to top

>emb|BX068401.1|CNS09OXX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 224 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 283

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 284 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 331



to top

>emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 749 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 690

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 689 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 642



to top

>emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 146 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 205

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 206 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 253



to top

>emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 134 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 193

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 194 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 241



to top

>emb|BX067750.1|CNS09OFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 383

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 160 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 219

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 220 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 267



to top

>emb|BX067375.1|CNS09O5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 725 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 666

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 665 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 618



to top

>emb|BX067374.1|CNS09O5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 138 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 197

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 198 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 245



to top

>emb|BX067204.1|CNS09O0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 724 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 665

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 664 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 617



to top

>emb|BX067203.1|CNS09O0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 143 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 202

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 203 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 250



to top

>emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 139 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 198

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 199 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 246



to top

>emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 717 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 658

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 657 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 610



to top

>emb|BX066485.1|CNS09NGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 144 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 203

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 204 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 251



to top

>emb|BX066475.1|CNS09NGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 717 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 658

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 657 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 610



to top

>emb|BX066474.1|CNS09NGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 728 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 669

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 668 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 621



to top

>emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 156 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 215

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 216 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 263



to top

>emb|BX065859.1|CNS09MZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 149 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 208

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 209 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 256



to top

>emb|BX065576.1|CNS09MRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 20  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 79

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 80  atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 127



to top

>emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 145 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 204

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 205 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 252



to top

>emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 722 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 663

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 662 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 615



to top

>emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 171 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 230

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 231 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 278



to top

>emb|BX064810.1|CNS09M66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 229

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 20  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 79

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 80  atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 127



to top

>emb|BX064779.1|CNS09M5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 714 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 655

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 654 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 607



to top

>emb|BX064778.1|CNS09M5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 108 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 167

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 168 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 215



to top

>emb|BX064611.1|CNS09M0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX064509.1|CNS09LXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 740 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 681

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 680 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 633



to top

>emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 750 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 691

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 690 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 643



to top

>emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 181 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 240

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 241 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 288



to top

>emb|BX063825.1|CNS09LET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 519 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 460

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 459 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 412



to top

>emb|BX063744.1|CNS09LCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 724

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 160 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 219

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 220 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 267



to top

>emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 148 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 207

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 208 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 255



to top

>emb|BX063616.1|CNS09L90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX063581.1|CNS09L81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 138 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 197

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 198 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 245



to top

>emb|BX063323.1|CNS09L0V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 741 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 682

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 681 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 634



to top

>emb|BX062743.1|CNS09KKR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 273 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 332

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 333 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 380



to top

>emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 131 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 190

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 191 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 238



to top

>emb|BX062417.1|CNS09KBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 735 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 676

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 675 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 628



to top

>emb|BX062386.1|CNS09KAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 743 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 684

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 683 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 636



to top

>emb|BX061846.1|CNS09JVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 144 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 203

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 204 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 251



to top

>emb|BX061653.1|CNS09JQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 713 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 654

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 653 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 606



to top

>emb|BX061652.1|CNS09JQG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 137 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 196

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 197 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 244



to top

>emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 136 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 195

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 196 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 243



to top

>emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 143 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 202

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 203 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 250



to top

>emb|BX061418.1|CNS09JJY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 134 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 193

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 194 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 241



to top

>emb|BX061372.1|CNS09JIO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 693 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 634

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 633 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 586



to top

>emb|BX061371.1|CNS09JIN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 118 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 177

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 178 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 225



to top

>emb|BX060850.1|CNS09J46 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 629

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 151 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 210

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 211 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 258



to top

>emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 150 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 209

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 210 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 257



to top

>emb|BX060638.1|CNS09IYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 135 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 194

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 195 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 242



to top

>emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 718 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 659

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 658 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 611



to top

>emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 132 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 191

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 192 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 239



to top

>emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 724 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 665

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 664 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 617



to top

>emb|BX060482.1|CNS09ITY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 137 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 196

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 197 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 244



to top

>emb|BX060103.1|CNS09IJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 151 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 210

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 211 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 258



to top

>emb|BX060038.1|CNS09IHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX059961.1|CNS09IFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 149 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 208

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 209 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 256



to top

>emb|BX059617.1|CNS09I5X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 294

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 144 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 203

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 204 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 251



to top

>emb|BX059580.1|CNS09I4W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 157 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 216

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 217 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 264



to top

>emb|BX059462.1|CNS09I1M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 724 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 665

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 664 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 617



to top

>emb|BX059461.1|CNS09I1L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 149 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 208

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 209 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 256



to top

>emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 158 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 217

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 218 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 265



to top

>emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX058666.1|CNS09HFI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 132 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 191

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 192 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 239



to top

>emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 704 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 645

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 644 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 597



to top

>emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 161 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 220

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 221 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 268



to top

>emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 738 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 679

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 678 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 631



to top

>emb|BX058454.1|CNS09H9M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 600

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 156 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 215

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 216 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 263



to top

>emb|BX058452.1|CNS09H9K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 725 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 666

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 665 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 618



to top

>emb|BX058451.1|CNS09H9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 150 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 209

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 210 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 257



to top

>emb|BX058229.1|CNS09H3D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 162 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 221

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 222 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 269



to top

>emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 715 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 656

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 655 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 608



to top

>emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 142 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 201

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 202 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 249



to top

>emb|BX057878.1|CNS09GTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 716 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 657

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 656 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 609



to top

>emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 159 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 218

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 219 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 266



to top

>emb|BX057633.1|CNS09GMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 146 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 205

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 206 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 253



to top

>emb|BX057505.1|CNS09GJ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 150 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 209

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 210 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 257



to top

>emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX055833.1|CNS09F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 164 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 223

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 224 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 271



to top

>emb|BX055484.1|CNS09EZ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 150 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 209

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 210 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 257



to top

>emb|BX053216.1|CNS09D84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 133 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 192

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 193 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 240



to top

>emb|BX053162.1|CNS09D6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 81  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 140

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 141 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 188



to top

>emb|BX053144.1|CNS09D64 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 82  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 141

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 142 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 189



to top

>emb|BX055141.1|CNS09EPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX054882.1|CNS09EIE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 105 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 164

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 165 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 212



to top

>emb|BX053068.1|CNS09D40 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 80  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 139

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 140 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 187



to top

>emb|BX054081.1|CNS09DW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 143 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 202

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 203 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 250



to top

>emb|BX053881.1|CNS09DQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 162 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 221

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 222 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 269



to top

>emb|BX053707.1|CNS09DLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 750 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 691

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 690 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 643



to top

>emb|BX053706.1|CNS09DLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 162 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 221

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 222 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 269



to top

>emb|BX053663.1|CNS09DKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 421

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 143 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 202

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 203 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 250



to top

>emb|BX052674.1|CNS09CT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 146 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 205

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 206 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 253



to top

>emb|BX052301.1|CNS09CIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 137 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 196

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 197 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 244



to top

>emb|BX051916.1|CNS09C80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 716 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 657

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 656 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 609



to top

>emb|BX051464.1|CNS09BVG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 145 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 204

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 205 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 252



to top

>emb|BX051169.1|CNS09BN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 266

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 20  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 79

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 80  atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 127



to top

>emb|BX050918.1|CNS09BGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 312

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 20  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 79

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 80  atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 127



to top

>emb|BX050847.1|CNS09BEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 725 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 666

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 665 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 618



to top

>emb|BX050846.1|CNS09BEA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 124 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 183

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 184 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 231



to top

>emb|BX050735.1|CNS09BB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 153 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 212

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 213 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 260



to top

>emb|BX050637.1|CNS09B8H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 124 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 183

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 184 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 231



to top

>emb|BX050473.1|CNS09B3X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 157 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 216

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 217 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 264



to top

>emb|BX050285.1|CNS09AYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 414

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 20  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 79

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 80  atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 127



to top

>emb|BX049853.1|CNS09AMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 717 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 658

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 657 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 610



to top

>emb|BX049852.1|CNS09AMO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 122 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 181

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 182 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 229



to top

>emb|BX049352.1|CNS09A8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 157 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 216

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 217 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 264



to top

>emb|BX049279.1|CNS09A6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 736 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 677

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 676 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 629



to top

>emb|BX049134.1|CNS09A2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 150 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 209

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 210 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 257



to top

>emb|BX048838.1|CNS099UI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 135 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 194

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 195 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 242



to top

>emb|BX048660.1|CNS099PK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 137 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 196

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 197 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 244



to top

>emb|BX046531.1|CNS0982F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX046527.1|CNS0982B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 144 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 203

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 204 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 251



to top

>emb|BX048302.1|CNS099FM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 165 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 224

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 225 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 272



to top

>emb|BX048147.1|CNS099BB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 774

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 752 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 693

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 692 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 645



to top

>emb|BX048146.1|CNS099BA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 163 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 222

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 223 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 270



to top

>emb|BX048050.1|CNS0998M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 183 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 242

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 243 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 290



to top

>emb|BX047926.1|CNS09956 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 140 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 199

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 200 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 247



to top

>emb|BX047906.1|CNS0994M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 137 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 196

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 197 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 244



to top

>emb|BX047760.1|CNS0990K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 267

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 101 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 160

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 161 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 208



to top

>emb|BX047689.1|CNS098YL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 766

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 145 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 204

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 205 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 252



to top

>emb|BX047677.1|CNS098Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 772 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 713

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 712 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 665



to top

>emb|BX047676.1|CNS098Y8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 160 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 219

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 220 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 267



to top

>emb|BX047547.1|CNS098UN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 53  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 112

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 113 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 160



to top

>emb|BX047520.1|CNS098TW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 167 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 226

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 227 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 274



to top

>emb|BX047255.1|CNS098MJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 20  ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 79

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 80  atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 127



to top

>emb|BX047102.1|CNS098IA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 157 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 216

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 217 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 264



to top

>emb|BX046950.1|CNS098E2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 169 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 228

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 229 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 276



to top

>emb|BX046739.1|CNS09887 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX046675.1|CNS0986F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX046022.1|CNS097OA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 737 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 678

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 677 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 630



to top

>emb|BX046021.1|CNS097O9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 164 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 223

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 224 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 271



to top

>emb|BX045808.1|CNS097IC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 141 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 200

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 201 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 248



to top

>emb|BX045791.1|CNS097HV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 148 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 207

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 208 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 255



to top

>emb|BX045765.1|CNS097H5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 733 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 674

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 673 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 626



to top

>emb|BX045764.1|CNS097H4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 147 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 206

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 207 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 254



to top

>emb|BX045565.1|CNS097BL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 181 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 240

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 241 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 288



to top

>emb|BX043029.1|CNS095D5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 160 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 219

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 220 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 267



to top

>emb|BX044717.1|CNS096O1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC18CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 739 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 680

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 679 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 632



to top

>emb|BX044716.1|CNS096O0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 161 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 220

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 221 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 268



to top

>emb|BX044419.1|CNS096FR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 136 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 195

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 196 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 243



to top

>emb|BX044308.1|CNS096CO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 129 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 188

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 189 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 236



to top

>emb|BX044225.1|CNS096AD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 168 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 227

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 228 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 275



to top

>emb|BX044005.1|CNS09649 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 157 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 216

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 217 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 264



to top

>emb|BX043494.1|CNS095Q2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 119 ggcaagcaccgcaagcatcccggaggccgcggtaacgccggaggcatgcaccaccaccgc 178
           ||||||||||| |||||||| || || ||||||||||| || || |||||||| ||||| 
Sbjct: 147 ggcaagcaccgtaagcatcctggtggtcgcggtaacgctggtggtatgcaccatcaccgt 206

                                                           
Query: 179 atcctcttcgacaagtaccatcccggctacttcggcaaagtcggtatg 226
           |||  ||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 207 atcaacttcgacaaataccatccgggttacttcggcaaggtcggtatg 254


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,519,850
Number of Sequences: 3902068
Number of extensions: 3519850
Number of successful extensions: 337028
Number of sequences better than 10.0: 1169
Number of HSP's better than 10.0 without gapping: 1199
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 310435
Number of HSP's gapped (non-prelim): 26475
length of query: 429
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 407
effective length of database: 17,147,199,772
effective search space: 6978910307204
effective search space used: 6978910307204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top