>gb|AC008324.3| Drosophila melanogaster clone BACR25K01, complete sequence
          Length = 172939

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 223    tggtatcattttcataatgttttca 247
              |||||||||||||||||| ||||||
Sbjct: 154835 tggtatcattttcataattttttca 154859

>gb|AC008325.5| Drosophila melanogaster clone BACR05M06, complete sequence
          Length = 166423

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 223   tggtatcattttcataatgttttca 247
             |||||||||||||||||| ||||||
Sbjct: 85000 tggtatcattttcataattttttca 85024

>emb|AL606752.11| Human DNA sequence from clone RP11-740C1 on chromosome 1 Contains the
             OR10J5 gene for olfactory receptor family 10 subfamily J
             member 5 and an amyloid P component serum (APCS)
             pseudogene, complete sequence
          Length = 87134

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 135   atatttcaaacggctatatcttttt 159
             ||||||||||| |||||||||||||
Sbjct: 39850 atatttcaaactgctatatcttttt 39826

>gb|AC092809.2| Homo sapiens chromosome 1 clone RP11-365O16, complete sequence
          Length = 197621

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 240    tgttttcacacaatgaaaatg 260
              |||||||||||||||||||||
Sbjct: 151203 tgttttcacacaatgaaaatg 151183

>gb|AE003609.4| Drosophila melanogaster chromosome 2L, section 18 of 83 of the complete
              sequence
          Length = 319287

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 223    tggtatcattttcataatgttttca 247
              |||||||||||||||||| ||||||
Sbjct: 195239 tggtatcattttcataattttttca 195263

>emb|BX000705.13| Zebrafish DNA sequence from clone DKEY-76D18, complete sequence
          Length = 255779

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 31    accgaagtacgctttcctttt 51
             |||||||||||||||||||||
Sbjct: 26561 accgaagtacgctttcctttt 26581

>gb|BC106621.1| Xenopus laevis similar to midnolin, mRNA (cDNA clone MGC:132104
            IMAGE:5079334), complete cds
          Length = 2341

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  ttttcacacaatgaaaatga 261
            ||||||||||||||||||||
Sbjct: 2288 ttttcacacaatgaaaatga 2307

>gb|AC122002.2| Mus musculus BAC clone RP24-335H15 from 7, complete sequence
          Length = 114070

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   ttgtgtgtcaatagtttttt 120
             ||||||||||||||||||||
Sbjct: 78236 ttgtgtgtcaatagtttttt 78255

>gb|BC046658.1| Xenopus laevis similar to midnolin, mRNA (cDNA clone MGC:52897
            IMAGE:4889244), complete cds
          Length = 3395

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  ttttcacacaatgaaaatga 261
            ||||||||||||||||||||
Sbjct: 2275 ttttcacacaatgaaaatga 2294

>emb|AL499582.13| Human DNA sequence from clone RP11-371O12 on chromosome 10 Contains the
             5' end of the gene for double-stranded RNA specific
             adenosine deaminase (ADAR3) and a CpG island, complete
             sequence
          Length = 181532

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    tttccttttaagaaaacgta 62
             ||||||||||||||||||||
Sbjct: 97603 tttccttttaagaaaacgta 97622

>emb|AL133473.5| Human DNA sequence from clone RP1-236A3 on chromosome 6 Contains the 3'
             end of the gene for phenylalanine-tRNA synthetase (FARS1),
             complete sequence
          Length = 57423

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   ttcataatgttttcacacaa 252
             ||||||||||||||||||||
Sbjct: 25582 ttcataatgttttcacacaa 25563

>gb|AC100322.8| Mus musculus chromosome 7, clone RP23-124O24, complete sequence
          Length = 219314

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    ttgtgtgtcaatagtttttt 120
              ||||||||||||||||||||
Sbjct: 181912 ttgtgtgtcaatagtttttt 181893

>gb|AC026347.17| Homo sapiens 3 BAC RP11-362A9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 195430

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 222    atggtatcattttcataatg 241
              ||||||||||||||||||||
Sbjct: 166374 atggtatcattttcataatg 166355

>gb|AC069242.13| Homo sapiens 3 BAC RP11-554J1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 184664

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    atggtatcattttcataatg 241
              ||||||||||||||||||||
Sbjct: 120144 atggtatcattttcataatg 120163

>ref|NM_075405.3| Caenorhabditis elegans Y43F8C.6 (Y43F8C.6) mRNA, complete cds
          Length = 1462

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 305  cagtttccggcgattccttccgcgaact 332
            ||||||||||||||| ||||||| ||||
Sbjct: 1298 cagtttccggcgatttcttccgccaact 1271

>emb|AL032637.1|CEY43F8C Caenorhabditis elegans YAC Y43F8C, complete sequence
          Length = 120492

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 305   cagtttccggcgattccttccgcgaact 332
             ||||||||||||||| ||||||| ||||
Sbjct: 36387 cagtttccggcgatttcttccgccaact 36414

>dbj|AP007287.1| Lotus japonicus genomic DNA, clone:LjT12M13, TM0054b, complete sequence
          Length = 77961

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   attttcataatgttttcaca 249
             ||||||||||||||||||||
Sbjct: 61892 attttcataatgttttcaca 61911


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,191,938
Number of Sequences: 3902068
Number of extensions: 3191938
Number of successful extensions: 50700
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50670
Number of HSP's gapped (non-prelim): 30
length of query: 378
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 356
effective length of database: 17,147,199,772
effective search space: 6104403118832
effective search space used: 6104403118832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)