ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal23i04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ581660.1|HVU581660 Hordeum vulgare chloroplast partial mRN... 214 5e-53
2emb|AJ250662.1|HVU250662 Hordeum vulgare partial mRNA for putati... 214 5e-53
3gb|AC092048.2| Homo sapiens chromosome 3 clone RP11-241P3, compl... 42 0.37
4gb|AC006060.1| Homo sapiens 3 PAC RPCI4-736H12 (Roswell Park Can... 42 0.37
5ref|XM_592083.2| PREDICTED: Bos taurus similar to COP9 signaloso... 40 1.5
6ref|XM_611709.2| PREDICTED: Bos taurus similar to COP9 signaloso... 40 1.5
7gb|DP000015.1| Xenopus tropicalis target 1 genomic scaffold 38 5.8
8gb|AY350711.1| Sisymbrium irio clone BAC Sio11E11, complete sequ... 38 5.8
9gb|AC121981.3| Mus musculus BAC clone RP24-290K9 from 5, complet... 38 5.8
10emb|BX284698.6| Human DNA sequence from clone RP11-41M24 on chro... 38 5.8
11emb|AL590964.8| Human DNA sequence from clone RP11-505O14 on chr... 38 5.8
12gb|AY144986.1| Saccharomyces castellii clone Contig1869 BUL1 gen... 38 5.8
13gb|AC149515.2| Xenopus tropicalis clone CH216-35C7, complete seq... 38 5.8

>emb|AJ581660.1|HVU581660 Hordeum vulgare chloroplast partial mRNA for nucleotide
            pyrophosphatase/phosphodiesterase (npp gene)
          Length = 1268

 Score =  214 bits (108), Expect = 5e-53
 Identities = 108/108 (100%)
 Strand = Plus / Plus

                                                                        
Query: 8    tatcgtccggccgtcatgtcaatgtaatggagggtcatccatccaataaaattgtgggca 67
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1059 tatcgtccggccgtcatgtcaatgtaatggagggtcatccatccaataaaattgtgggca 1118

                                                            
Query: 68   tgtgttgagtaataaaattggtcagctgcacaatttatatgtgctagt 115
            ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1119 tgtgttgagtaataaaattggtcagctgcacaatttatatgtgctagt 1166



to top

>emb|AJ250662.1|HVU250662 Hordeum vulgare partial mRNA for putative protein (bci-6 gene)
          Length = 321

 Score =  214 bits (108), Expect = 5e-53
 Identities = 108/108 (100%)
 Strand = Plus / Plus

                                                                       
Query: 8   tatcgtccggccgtcatgtcaatgtaatggagggtcatccatccaataaaattgtgggca 67
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118 tatcgtccggccgtcatgtcaatgtaatggagggtcatccatccaataaaattgtgggca 177

                                                           
Query: 68  tgtgttgagtaataaaattggtcagctgcacaatttatatgtgctagt 115
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 178 tgtgttgagtaataaaattggtcagctgcacaatttatatgtgctagt 225



to top

>gb|AC092048.2| Homo sapiens chromosome 3 clone RP11-241P3, complete sequence
          Length = 155663

 Score = 42.1 bits (21), Expect = 0.37
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 47     catccaataaaattgtgggcatgtg 71
              ||||||| |||||||||||||||||
Sbjct: 148898 catccaaaaaaattgtgggcatgtg 148874



to top

>gb|AC006060.1| Homo sapiens 3 PAC RPCI4-736H12 (Roswell Park Cancer Institute Human PAC
              Library) complete sequence
          Length = 135039

 Score = 42.1 bits (21), Expect = 0.37
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 47     catccaataaaattgtgggcatgtg 71
              ||||||| |||||||||||||||||
Sbjct: 108088 catccaaaaaaattgtgggcatgtg 108064



to top

>ref|XM_592083.2| PREDICTED: Bos taurus similar to COP9 signalosome complex subunit 8
           (Signalosome subunit 8) (SGN8) (JAB1-containing
           signalosome subunit 8) (COP9 homolog) (hCOP9),
           transcript variant 1 (LOC540180), mRNA
          Length = 1598

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  tcatccatccaataaaattg 61
           ||||||||||||||||||||
Sbjct: 763 tcatccatccaataaaattg 744



to top

>ref|XM_611709.2| PREDICTED: Bos taurus similar to COP9 signalosome complex subunit 8
           (Signalosome subunit 8) (SGN8) (JAB1-containing
           signalosome subunit 8) (COP9 homolog) (hCOP9)
           (LOC540493), mRNA
          Length = 1927

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  tcatccatccaataaaattg 61
           ||||||||||||||||||||
Sbjct: 968 tcatccatccaataaaattg 949



to top

>gb|DP000015.1| Xenopus tropicalis target 1 genomic scaffold
          Length = 292204

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    atccatccaataaaattgt 62
             |||||||||||||||||||
Sbjct: 77982 atccatccaataaaattgt 78000



to top

>gb|AY350711.1| Sisymbrium irio clone BAC Sio11E11, complete sequence
          Length = 95357

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    catgtgttgagtaataaaa 84
             |||||||||||||||||||
Sbjct: 40278 catgtgttgagtaataaaa 40260



to top

>gb|AC121981.3| Mus musculus BAC clone RP24-290K9 from 5, complete sequence
          Length = 184908

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    atccatccaataaaattgt 62
             |||||||||||||||||||
Sbjct: 67837 atccatccaataaaattgt 67855



to top

>emb|BX284698.6| Human DNA sequence from clone RP11-41M24 on chromosome 1, complete
             sequence
          Length = 84876

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 34    atggagggtcatccatcca 52
             |||||||||||||||||||
Sbjct: 66837 atggagggtcatccatcca 66819



to top

>emb|AL590964.8| Human DNA sequence from clone RP11-505O14 on chromosome 6, complete
             sequence
          Length = 198644

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 78    aataaaattggtcagctgcacaattta 104
             |||||||||  ||||||||||||||||
Sbjct: 33967 aataaaattcatcagctgcacaattta 33941



to top

>gb|AY144986.1| Saccharomyces castellii clone Contig1869 BUL1 gene, complete cds
          Length = 2913

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 70   tgttgagtaataaaattgg 88
            |||||||||||||||||||
Sbjct: 2441 tgttgagtaataaaattgg 2423



to top

>gb|AC149515.2| Xenopus tropicalis clone CH216-35C7, complete sequence
          Length = 174535

 Score = 38.2 bits (19), Expect = 5.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 44     atccatccaataaaattgt 62
              |||||||||||||||||||
Sbjct: 109702 atccatccaataaaattgt 109684


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,183,111
Number of Sequences: 3902068
Number of extensions: 1183111
Number of successful extensions: 70554
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70533
Number of HSP's gapped (non-prelim): 21
length of query: 125
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 104
effective length of database: 17,151,101,840
effective search space: 1783714591360
effective search space used: 1783714591360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top