ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal22k05 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ315794.1|HVU315794 Hordeum vulgare mRNA for Ribosomal protein S7 (rps7 gene) Length = 852 Score = 813 bits (410), Expect = 0.0 Identities = 440/448 (98%), Gaps = 3/448 (0%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 92 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 151 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 152 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 211 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 212 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 271 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 |||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||| Sbjct: 272 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctcgag-aga--gtta 328 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 329 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 388 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 389 ctgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 448 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 449 atgttgtgtacccagctgagattgtggggaagcgcgtcaggtaccgtttggatggtgcca 508 Query: 421 aggtcatcaagatttacttggacccaaa 448 ||||||||||||| |||||||||||||| Sbjct: 509 aggtcatcaagatctacttggacccaaa 536
>gb|AY846832.1| Triticum aestivum ribosomal protein S7 mRNA, complete cds Length = 600 Score = 789 bits (398), Expect = 0.0 Identities = 433/445 (97%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| Sbjct: 43 agaaggacaagggcgtcgagccctccgagttcgaggacaccgttgcgcaggctttctttg 102 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 103 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 162 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 163 caatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccataccgtc 222 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 223 tgcgcaagcccttcaggaagatccatgtcaggctcgtcagggagctcgagaagaagttta 282 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 283 gcggcaaggatgttgtctttgttgcaacaagaaggatcgtgaggccacccaagaagggtt 342 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 343 ctgctgttcagcgccctcgcaccaggaccctgacagctgttcatgatggtatcttggagg 402 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| Sbjct: 403 atgttgtgtacccagctgagattgtggggaagcgtgtcaggtaccgtttggatggtgcca 462 Query: 421 aggtcatcaagatttacttggaccc 445 ||||||||||||| ||||||||||| Sbjct: 463 aggtcatcaagatctacttggaccc 487
>dbj|AK122143.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136J20, full insert sequence Length = 966 Score = 557 bits (281), Expect = e-155 Identities = 406/448 (90%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||| |||||| |||||||||| |||||||||||| ||||||||||||||||||||| Sbjct: 98 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcaggctttctttg 157 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| || Sbjct: 158 acctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgtacatcaacaatg 217 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | ||||||||||| ||| |||||||||||||| ||||||||||| ||||||||||||| Sbjct: 218 cagtccagatggatattgccgggaacaggaaggctgtggtgatccacgtgccgtaccgtc 277 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 | |||||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| | Sbjct: 278 tgcgcaaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttca 337 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 ||||||||||||| || ||||||||||||| |||||||||||||| ||||||||||| | Sbjct: 338 gcggcaaggatgtggtaattgttgcaacaaggaggattgtgaggcctcccaagaagggct 397 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | |||||||||||||||||||| ||||| || || ||||||||||||||||||||||||| Sbjct: 398 cggctgttcagcgccctcgcacaagaactcttactgctgttcatgatggtatcttggagg 457 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 |||| || ||||||||||||||||| || |||||| ||| |||||| |||||||||||| Sbjct: 458 atgtagtctacccagctgagattgttggcaagcgcatcagataccgtctggatggtgcca 517 Query: 421 aggtcatcaagatttacttggacccaaa 448 ||||||||||||||| |||||||||||| Sbjct: 518 aggtcatcaagattttcttggacccaaa 545
>dbj|AK059192.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-H09, full insert sequence Length = 830 Score = 557 bits (281), Expect = e-155 Identities = 406/448 (90%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||| |||||| |||||||||| |||||||||||| ||||||||||||||||||||| Sbjct: 97 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcaggctttctttg 156 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| || Sbjct: 157 acctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgtacatcaacaatg 216 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | ||||||||||| ||| |||||||||||||| ||||||||||| ||||||||||||| Sbjct: 217 cagtccagatggatattgccgggaacaggaaggctgtggtgatccacgtgccgtaccgtc 276 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 | |||||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| | Sbjct: 277 tgcgcaaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttca 336 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 ||||||||||||| || ||||||||||||| |||||||||||||| ||||||||||| | Sbjct: 337 gcggcaaggatgtggtaattgttgcaacaaggaggattgtgaggcctcccaagaagggct 396 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | |||||||||||||||||||| ||||| || || ||||||||||||||||||||||||| Sbjct: 397 cggctgttcagcgccctcgcacaagaactcttactgctgttcatgatggtatcttggagg 456 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 |||| || ||||||||||||||||| || |||||| ||| |||||| |||||||||||| Sbjct: 457 atgtagtctacccagctgagattgttggcaagcgcatcagataccgtctggatggtgcca 516 Query: 421 aggtcatcaagatttacttggacccaaa 448 ||||||||||||||| |||||||||||| Sbjct: 517 aggtcatcaagattttcttggacccaaa 544
>gb|BT016582.1| Zea mays clone Contig415 mRNA sequence Length = 907 Score = 502 bits (253), Expect = e-139 Identities = 399/448 (89%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||| |||||| | |||||||| |||||||||||| |||| || ||||||||||||| Sbjct: 131 agaaggagaagggccttgagccctccgagttcgaggactccgttgcccaggctttctttg 190 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 | |||||||| || ||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 191 atctggagaacgggaaccaggagctcaagagcgacctcaaggacctgtacatcaacaatg 250 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | ||||||||||||||| |||| ||||||||| || || ||||| || || ||||| | Sbjct: 251 ctatccagatggatgttaccgggagcaggaaggctgttgtcatccacgtcccataccgcc 310 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 | |||||| |||||||||||||||||||||| ||||||||||||||||||||||| || | Sbjct: 311 tgcgcaaggccttcaggaagatccatgtcagactcgtcagggagctggagaagaaattca 370 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 ||||||||||||| || ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 371 gcggcaaggatgtggtaattgttgctacaaggaggattgtgaggccacccaagaagggtt 430 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | ||||||| ||||||||||||||| || ||||| |||||||| ||||| |||||||||| Sbjct: 431 cagctgttctgcgccctcgcaccaggactctgactgctgttcacgatggcatcttggagg 490 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 ||||||| |||||||||||||||||||||||||| |||| |||||| |||||||| ||| Sbjct: 491 atgttgtctacccagctgagattgtggggaagcgtgtcagataccgtctggatggttcca 550 Query: 421 aggtcatcaagatttacttggacccaaa 448 || | |||||||||| |||||||||||| Sbjct: 551 agattatcaagattttcttggacccaaa 578
>gb|AY103554.1| Zea mays PCO154340 mRNA sequence Length = 1075 Score = 494 bits (249), Expect = e-136 Identities = 398/448 (88%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||| |||||| | |||||||| ||||| |||||| |||| || ||||||||||||| Sbjct: 170 agaaggagaagggccttgagccctccgagtttgaggactccgttgcccaggctttctttg 229 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 | |||||||| || ||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 230 atctggagaacgggaaccaggagctcaagagcgacctcaaggacctgtacatcaacaatg 289 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | ||||||||||||||| |||| ||||||||| || || ||||| || || ||||| | Sbjct: 290 ctatccagatggatgttaccgggagcaggaaggctgttgtcatccacgtcccataccgcc 349 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 | |||||| |||||||||||||||||||||| ||||||||||||||||||||||| || | Sbjct: 350 tgcgcaaggccttcaggaagatccatgtcagactcgtcagggagctggagaagaaattca 409 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 ||||||||||||| || ||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 410 gcggcaaggatgtggtaattgttgctacaaggaggattgtgaggccacccaagaagggtt 469 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | ||||||| ||||||||||||||| || ||||| |||||||| ||||| |||||||||| Sbjct: 470 cagctgttctgcgccctcgcaccaggactctgactgctgttcacgatggcatcttggagg 529 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 ||||||| |||||||||||||||||||||||||| |||| |||||| |||||||| ||| Sbjct: 530 atgttgtctacccagctgagattgtggggaagcgtgtcagataccgtctggatggttcca 589 Query: 421 aggtcatcaagatttacttggacccaaa 448 || | |||||||||| |||||||||||| Sbjct: 590 agattatcaagattttcttggacccaaa 617
>gb|AF118149.1|AF118149 Secale cereale ribosomal protein S7 mRNA, complete cds Length = 819 Score = 460 bits (232), Expect = e-126 Identities = 393/447 (87%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| | Sbjct: 61 agaaggacaagggcctcgagccctccgagttcgaggacaccgtcgcgcaggctttcttcg 120 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 ||||||||||||||||||||||||||||||||||| | || ||||| ||||||||| | | Sbjct: 121 acctggagaatggcaaccaggagctcaagagcgacgttaaagacctctacatcaacgccg 180 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | ||||||||||||||| |||||||||||||||||||| ||||| |||||||| | | Sbjct: 181 ccttccagatggatgttgcagggaacaggaaggccgtggtcatccacgtgccgtataggc 240 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 |||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||| | Sbjct: 241 tccgcaagaacttcaggaagatccacgtcaggctcgtcagggagctcgagaagaagttca 300 Query: 241 gcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggtt 300 |||||||||| ||||| ||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 301 gcggcaaggacgttgttattgttgctacaaggcggattgtgaggccacccaagaagggtt 360 Query: 301 ccgctgttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggagg 360 | |||||| |||||||| |||||||| |||| |||||||||||||| | ||||||| Sbjct: 361 ctgctgttgttcgccctcgtaccagaactttgactgctgttcatgatggccttttggagg 420 Query: 361 atgttgtgtacccagctgagattgtggggaagcgcgtcangtaccgtttggatggtgcca 420 ||||||||||||||||||||||||||||||| || |||| || ||| | ||||| | | Sbjct: 421 atgttgtgtacccagctgagattgtggggaaacgtgtcagatatcgtctagatggctcga 480 Query: 421 aggtcatcaagatttacttggacccaa 447 || |||| ||||| | ||||||||||| Sbjct: 481 agatcattaagatcttcttggacccaa 507
>gb|BT017481.1| Zea mays clone EL01N0409H01.c mRNA sequence Length = 840 Score = 325 bits (164), Expect = 7e-86 Identities = 364/431 (84%) Strand = Plus / Plus Query: 18 gagccctcggagttcgaggacaccgtcgcgcaggctttctttgacctggagaatggcaac 77 |||||||| ||||||||| | ||| || |||||||||||||| |||||||| || ||| Sbjct: 111 gagccctccaagttcgagggctccgatgcccaggctttctttgatctggagaacgggaac 170 Query: 78 caggagctcaagagcgacctcaaggacctgtacatcaacactgcgatccagatggatgtt 137 |||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||| Sbjct: 171 caggaggtcaagagcgacctcaaggacctgtacatcaacaatgctatccagatggatgtt 230 Query: 138 gttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccgcaagcccttcagg 197 |||| |||||||| | || ||||| || || |||||||| |||||| ||||||| Sbjct: 231 accgggagcaggaagggtgatgtcatccacgtcccataccgtctgcgcaagggcttcagg 290 Query: 198 aagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgtc 257 |||||||||||||| ||| ||||||||||||||||||| || | ||| |||||||| || Sbjct: 291 aagatccatgtcagactcttcagggagctggagaagaaattcatcgggaaggatgtggta 350 Query: 258 tttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccct 317 ||||||| ||||| ||||||||||| |||||| |||||| || ||||||| ||||||| Sbjct: 351 attgttgctacaagggggattgtgagggcacccacgaaggggtcagctgttctgcgccct 410 Query: 318 cgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagct 377 | ||||| || |||| |||||||| ||||| || |||||||||||||| |||||| || Sbjct: 411 aggaccaggactgtgactgctgttcacgatggcattttggaggatgttgtctacccaact 470 Query: 378 gagattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaagatttac 437 ||||||| |||||||| |||| |||||| ||||||| ||||| | |||||||||| | Sbjct: 471 gagattgaggggaagcatgtcacataccgtgtggatgggtccaagattatcaagattttc 530 Query: 438 ttggacccaaa 448 ||||||||||| Sbjct: 531 ttggacccaaa 541
>dbj|AK061276.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-E11, full insert sequence Length = 811 Score = 319 bits (161), Expect = 4e-84 Identities = 230/253 (90%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||| |||||| |||||||||| |||||||||||| ||||||||||||||||||||| Sbjct: 108 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcaggctttctttg 167 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaacactg 120 |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| || Sbjct: 168 acctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgtacatcaacaatg 227 Query: 121 cgatccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtc 180 | ||||||||||| ||| |||||||||||||| |||||||| || ||||||||||||| Sbjct: 228 cagtccagatggatattgccgggaacaggaaggctgtggtgattcacgtgccgtaccgtc 287 Query: 181 tccgcaagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagttta 240 | |||||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| | Sbjct: 288 tgcgcaaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttca 347 Query: 241 gcggcaaggatgt 253 ||||||||||||| Sbjct: 348 gcggcaaggatgt 360 Score = 123 bits (62), Expect = 5e-25 Identities = 94/105 (89%) Strand = Plus / Plus Query: 344 tgatggtatcttggaggatgttgtgtacccagctgagattgtggggaagcgcgtcangta 403 |||| |||||||||| ||||| || ||||||||||||||||| || |||||| ||| || Sbjct: 363 tgattgtatcttggaagatgtagtctacccagctgagattgttggcaagcgcatcagata 422 Query: 404 ccgtttggatggtgccaaggtcatcaagatttacttggacccaaa 448 |||| ||||||||||||||||||||||||||| |||||||||||| Sbjct: 423 ccgtctggatggtgccaaggtcatcaagattttcttggacccaaa 467
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 218 bits (110), Expect = 1e-53 Identities = 157/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 10366956 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 10367015 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || ||||||||||||||||||||||||||||| || |||||||||| Sbjct: 10367016 gcacaagaactcttactgctgttcatgatggtatcttggaggatgtagtctacccagctg 10367075 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 10367076 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 10367128 Score = 210 bits (106), Expect = 3e-51 Identities = 156/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 10371211 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 10371270 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || |||||||||||| |||||||||||||||| || |||||||||| Sbjct: 10371271 gcacaagaactcttaccgctgttcatgattgtatcttggaggatgtagtctacccagctg 10371330 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 10371331 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 10371383 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| ||||||||||| |||||||||||||| || Sbjct: 10366211 ccagatggatattgccgggaacaggaaggctgtggtgatccacgtgccgtaccgtctgcg 10366270 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 10366271 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 10366330 Query: 245 caagg 249 ||||| Sbjct: 10366331 caagg 10366335 Score = 137 bits (69), Expect = 3e-29 Identities = 111/125 (88%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| |||||||| || |||||||||||||| || Sbjct: 10370455 ccagatggatattgccgggaacaggaaggctgtggtgattcacgtgccgtaccgtctgcg 10370514 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 10370515 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 10370574 Query: 245 caagg 249 ||||| Sbjct: 10370575 caagg 10370579 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 10370249 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 10370308 Query: 109 acatcaaca 117 ||||||||| Sbjct: 10370309 acatcaaca 10370317 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 10366009 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 10366068 Query: 109 acatcaaca 117 ||||||||| Sbjct: 10366069 acatcaaca 10366077 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 10370127 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 10370177 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 10365887 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 10365937
>gb|AC137931.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0039F10, complete sequence Length = 139714 Score = 218 bits (110), Expect = 1e-53 Identities = 157/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 23509 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 23568 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || ||||||||||||||||||||||||||||| || |||||||||| Sbjct: 23569 gcacaagaactcttactgctgttcatgatggtatcttggaggatgtagtctacccagctg 23628 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 23629 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 23681 Score = 210 bits (106), Expect = 3e-51 Identities = 156/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 27764 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 27823 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || |||||||||||| |||||||||||||||| || |||||||||| Sbjct: 27824 gcacaagaactcttaccgctgttcatgattgtatcttggaggatgtagtctacccagctg 27883 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 27884 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 27936 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| ||||||||||| |||||||||||||| || Sbjct: 22764 ccagatggatattgccgggaacaggaaggctgtggtgatccacgtgccgtaccgtctgcg 22823 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 22824 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 22883 Query: 245 caagg 249 ||||| Sbjct: 22884 caagg 22888 Score = 137 bits (69), Expect = 3e-29 Identities = 111/125 (88%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| |||||||| || |||||||||||||| || Sbjct: 27008 ccagatggatattgccgggaacaggaaggctgtggtgattcacgtgccgtaccgtctgcg 27067 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 27068 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 27127 Query: 245 caagg 249 ||||| Sbjct: 27128 caagg 27132 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 26802 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 26861 Query: 109 acatcaaca 117 ||||||||| Sbjct: 26862 acatcaaca 26870 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 22562 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 22621 Query: 109 acatcaaca 117 ||||||||| Sbjct: 22622 acatcaaca 22630 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 26680 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 26730 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 22440 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 22490
>gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare stain, clone OSJNBb0036D03, from chromosome 3, complete sequence Length = 125800 Score = 218 bits (110), Expect = 1e-53 Identities = 157/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 80422 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 80481 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || ||||||||||||||||||||||||||||| || |||||||||| Sbjct: 80482 gcacaagaactcttactgctgttcatgatggtatcttggaggatgtagtctacccagctg 80541 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 80542 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 80594 Score = 210 bits (106), Expect = 3e-51 Identities = 156/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 84677 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 84736 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || |||||||||||| |||||||||||||||| || |||||||||| Sbjct: 84737 gcacaagaactcttaccgctgttcatgattgtatcttggaggatgtagtctacccagctg 84796 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 84797 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 84849 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| ||||||||||| |||||||||||||| || Sbjct: 79677 ccagatggatattgccgggaacaggaaggctgtggtgatccacgtgccgtaccgtctgcg 79736 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 79737 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 79796 Query: 245 caagg 249 ||||| Sbjct: 79797 caagg 79801 Score = 137 bits (69), Expect = 3e-29 Identities = 111/125 (88%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| |||||||| || |||||||||||||| || Sbjct: 83921 ccagatggatattgccgggaacaggaaggctgtggtgattcacgtgccgtaccgtctgcg 83980 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 83981 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 84040 Query: 245 caagg 249 ||||| Sbjct: 84041 caagg 84045 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 83715 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 83774 Query: 109 acatcaaca 117 ||||||||| Sbjct: 83775 acatcaaca 83783 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 79475 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 79534 Query: 109 acatcaaca 117 ||||||||| Sbjct: 79535 acatcaaca 79543 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 83593 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 83643 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 79353 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 79403
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 218 bits (110), Expect = 1e-53 Identities = 157/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 10365057 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 10365116 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || ||||||||||||||||||||||||||||| || |||||||||| Sbjct: 10365117 gcacaagaactcttactgctgttcatgatggtatcttggaggatgtagtctacccagctg 10365176 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 10365177 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 10365229 Score = 210 bits (106), Expect = 3e-51 Identities = 156/173 (90%) Strand = Plus / Plus Query: 259 ttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctc 318 ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||| Sbjct: 10369312 ttgttgcaacaaggaggattgtgaggcctcccaagaagggctcggctgttcagcgccctc 10369371 Query: 319 gcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctg 378 |||| ||||| || || |||||||||||| |||||||||||||||| || |||||||||| Sbjct: 10369372 gcacaagaactcttaccgctgttcatgattgtatcttggaggatgtagtctacccagctg 10369431 Query: 379 agattgtggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaag 431 ||||||| || |||||| ||| |||||| ||||||||||||||||||||||| Sbjct: 10369432 agattgttggcaagcgcatcagataccgtctggatggtgccaaggtcatcaag 10369484 Score = 145 bits (73), Expect = 1e-31 Identities = 112/125 (89%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| ||||||||||| |||||||||||||| || Sbjct: 10364312 ccagatggatattgccgggaacaggaaggctgtggtgatccacgtgccgtaccgtctgcg 10364371 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 10364372 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 10364431 Query: 245 caagg 249 ||||| Sbjct: 10364432 caagg 10364436 Score = 137 bits (69), Expect = 3e-29 Identities = 111/125 (88%) Strand = Plus / Plus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||| ||| |||||||||||||| |||||||| || |||||||||||||| || Sbjct: 10368556 ccagatggatattgccgggaacaggaaggctgtggtgattcacgtgccgtaccgtctgcg 10368615 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 10368616 caaggcattcaagaaaatccatgtcaggcttgtcagggagctcgagaagaagttcagcgg 10368675 Query: 245 caagg 249 ||||| Sbjct: 10368676 caagg 10368680 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 10368350 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 10368409 Query: 109 acatcaaca 117 ||||||||| Sbjct: 10368410 acatcaaca 10368418 Score = 121 bits (61), Expect = 2e-24 Identities = 67/69 (97%) Strand = Plus / Plus Query: 49 aggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgt 108 |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 10364110 aggctttctttgacctcgagaatggcaaccaggagctcaagagcgagctcaaggacctgt 10364169 Query: 109 acatcaaca 117 ||||||||| Sbjct: 10364170 acatcaaca 10364178 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 10368228 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 10368278 Score = 69.9 bits (35), Expect = 7e-09 Identities = 47/51 (92%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcagg 51 ||||||| |||||| |||||||||| |||||||||||| |||||||||||| Sbjct: 10363988 agaaggagaagggcctcgagccctccgagttcgaggactccgtcgcgcagg 10364038
>ref|XM_465276.1| Oryza sativa (japonica cultivar-group), mRNA Length = 339 Score = 149 bits (75), Expect = 9e-33 Identities = 195/235 (82%) Strand = Plus / Plus Query: 129 atggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccgcaag 188 |||||||||| || ||| |||||| || |||||||||||| ||||| ||| ||||| Sbjct: 1 atggatgttgctgcgaattggaaggtggtagtgatccatgtgttgtaccatctgtgcaag 60 Query: 189 cccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaag 248 | |||| ||| |||||||| ||||| |||| |||||| ||||||||||| || |||||| Sbjct: 61 gcattcaagaaaatccatgttaggcttgtcaaggagcttgagaagaagttcagtggcaag 120 Query: 249 gatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgtt 308 ||||| ||||||| ||||||||| |||||||||||||| | ||| |||||||| |||||| Sbjct: 121 gatgtggtctttgatgcaacaaggaggattgtgaggcctctcaataagggttcagctgtt 180 Query: 309 cagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggaggatg 363 || | ||||| || ||||| ||| ||||||||||||| ||||||||||||| Sbjct: 181 catcatcctcgtacaagaactttgattactgttcatgatggaatcttggaggatg 235
>gb|AF529175.1| Oryza sativa (japonica cultivar-group) ribosomal protein S7 (RPS7) mRNA, complete cds Length = 919 Score = 129 bits (65), Expect = 8e-27 Identities = 181/220 (82%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgt 256 |||||||||||| ||||| || ||||| || |||||||| || || || |||||||| || Sbjct: 324 gaagatccatgtgaggcttgttagggaacttgagaagaaattcagtgggaaggatgtggt 383 Query: 257 ctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccc 316 | |||||||| ||||| || |||||||| || ||||| || || |||||| ||||| Sbjct: 384 tctggttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccc 443 Query: 317 tcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagc 376 ||| ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| Sbjct: 444 tcgtacccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagc 503 Query: 377 tgagattgtggggaagcgcgtcangtaccgtttggatggt 416 |||||||| |||||||| |||| |||| ||||||||| Sbjct: 504 agagattgttgggaagcgtgtcagataccacttggatggt 543 Score = 69.9 bits (35), Expect = 7e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||||||||| | ||||| | ||||| |||||||| || || ||||| || |||| Sbjct: 128 agaaggacaagggtctggagccaactgagtttgaggacactgttgctcaggcattttttg 187 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaa 115 |||| |||||||| || |||||||| ||||| ||| | |||||||| |||||||| Sbjct: 188 accttgagaatgggaatcaggagctgaagagtgacttgaaggacctttacatcaa 242
>dbj|AK104191.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-C09, full insert sequence Length = 910 Score = 129 bits (65), Expect = 8e-27 Identities = 181/220 (82%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgt 256 |||||||||||| ||||| || ||||| || |||||||| || || || |||||||| || Sbjct: 335 gaagatccatgtgaggcttgttagggaacttgagaagaaattcagtgggaaggatgtggt 394 Query: 257 ctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccc 316 | |||||||| ||||| || |||||||| || ||||| || || |||||| ||||| Sbjct: 395 tctggttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccc 454 Query: 317 tcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagc 376 ||| ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| Sbjct: 455 tcgtacccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagc 514 Query: 377 tgagattgtggggaagcgcgtcangtaccgtttggatggt 416 |||||||| |||||||| |||| |||| ||||||||| Sbjct: 515 agagattgttgggaagcgtgtcagataccacttggatggt 554 Score = 69.9 bits (35), Expect = 7e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||||||||| | ||||| | ||||| |||||||| || || ||||| || |||| Sbjct: 139 agaaggacaagggtctggagccaactgagtttgaggacactgttgctcaggcattttttg 198 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaa 115 |||| |||||||| || |||||||| ||||| ||| | |||||||| |||||||| Sbjct: 199 accttgagaatgggaatcaggagctgaagagtgacttgaaggacctttacatcaa 253
>dbj|AK061627.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-B02, full insert sequence Length = 910 Score = 129 bits (65), Expect = 8e-27 Identities = 181/220 (82%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgt 256 |||||||||||| ||||| || ||||| || |||||||| || || || |||||||| || Sbjct: 335 gaagatccatgtgaggcttgttagggaacttgagaagaaattcagtgggaaggatgtggt 394 Query: 257 ctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccc 316 | |||||||| ||||| || |||||||| || ||||| || || |||||| ||||| Sbjct: 395 tctggttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccc 454 Query: 317 tcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagc 376 ||| ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| Sbjct: 455 tcgtacccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagc 514 Query: 377 tgagattgtggggaagcgcgtcangtaccgtttggatggt 416 |||||||| |||||||| |||| |||| ||||||||| Sbjct: 515 agagattgttgggaagcgtgtcagataccacttggatggt 554 Score = 69.9 bits (35), Expect = 7e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||||||||| | ||||| | ||||| |||||||| || || ||||| || |||| Sbjct: 139 agaaggacaagggtctggagccaactgagtttgaggacactgttgctcaggcattttttg 198 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaa 115 |||| |||||||| || |||||||| ||||| ||| | |||||||| |||||||| Sbjct: 199 accttgagaatgggaatcaggagctgaagagtgacttgaaggacctttacatcaa 253
>dbj|AK103081.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033118F01, full insert sequence Length = 903 Score = 125 bits (63), Expect = 1e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgt 256 |||||||||||| ||||| || ||||| || |||||||| || || || |||||||| || Sbjct: 335 gaagatccatgtgaggcttgttagggaacttgagaagaaattcagtgggaaggatgtggt 394 Query: 257 ctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccc 316 | |||||||| ||||| || |||||||| || ||||| || || |||||| ||||| Sbjct: 395 tctggttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccc 454 Query: 317 tcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagc 376 ||| ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| Sbjct: 455 tcgtacccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagc 514 Query: 377 tgagattgtggggaagcgcgtca 399 |||||||| |||||||| |||| Sbjct: 515 agagattgttgggaagcgtgtca 537 Score = 69.9 bits (35), Expect = 7e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtcgcgcaggctttctttg 60 ||||||||||||| | ||||| | ||||| |||||||| || || ||||| || |||| Sbjct: 139 agaaggacaagggtctggagccaactgagtttgaggacactgttgctcaggcattttttg 198 Query: 61 acctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacatcaa 115 |||| |||||||| || |||||||| ||||| ||| | |||||||| |||||||| Sbjct: 199 accttgagaatgggaatcaggagctgaagagtgacttgaaggacctttacatcaa 253
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 107 bits (54), Expect = 3e-20 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 247 aggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctg 306 ||||||| ||||||| ||||||||| |||||||||||||| | ||| |||||||| |||| Sbjct: 13024802 aggatgtggtctttgatgcaacaaggaggattgtgaggcctctcaataagggttcagctg 13024743 Query: 307 ttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttg 366 |||| | ||||| || ||||| ||| ||||||||||||| |||||||||||||| | Sbjct: 13024742 ttcatcatcctcgtacaagaactttgattactgttcatgatggaatcttggaggatgtag 13024683 Query: 367 tgtacccagctgagattgtggggaag 392 | | ||||||||||||||| |||||| Sbjct: 13024682 tct-cccagctgagattgttgggaag 13024658 Score = 73.8 bits (37), Expect = 4e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||||||| || ||| |||||| || |||||||||||| ||||| ||| | Sbjct: 13025548 ccagatggatgttgctgcgaattggaaggtggtagtgatccatgtgttgtaccatctgtg 13025489 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||| ||||| |||| |||||| ||||||||||| || || Sbjct: 13025488 caaggcattcaagaaaatccatgttaggcttgtcaaggagcttgagaagaagttcagtgg 13025429 Query: 245 caagg 249 ||||| Sbjct: 13025428 caagg 13025424 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 53 tttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacat 112 |||||||||||| |||||||| ||||| ||||||||||||| ||||||||| | ||||| Sbjct: 13025744 tttctttgacctcgagaatggaaaccattagctcaagagcgagctcaaggacatctacat 13025685 Query: 113 c 113 | Sbjct: 13025684 c 13025684 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtc 44 ||||||| |||||| | ||||||| |||||||||||| ||||| Sbjct: 13025940 agaaggagaagggcctatagccctccgagttcgaggactccgtc 13025897
>dbj|AP004890.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0688H12 Length = 139279 Score = 107 bits (54), Expect = 3e-20 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 247 aggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctg 306 ||||||| ||||||| ||||||||| |||||||||||||| | ||| |||||||| |||| Sbjct: 134445 aggatgtggtctttgatgcaacaaggaggattgtgaggcctctcaataagggttcagctg 134386 Query: 307 ttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttg 366 |||| | ||||| || ||||| ||| ||||||||||||| |||||||||||||| | Sbjct: 134385 ttcatcatcctcgtacaagaactttgattactgttcatgatggaatcttggaggatgtag 134326 Query: 367 tgtacccagctgagattgtggggaag 392 | | ||||||||||||||| |||||| Sbjct: 134325 tct-cccagctgagattgttgggaag 134301 Score = 73.8 bits (37), Expect = 4e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||||||| || ||| |||||| || |||||||||||| ||||| ||| | Sbjct: 135191 ccagatggatgttgctgcgaattggaaggtggtagtgatccatgtgttgtaccatctgtg 135132 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||| ||||| |||| |||||| ||||||||||| || || Sbjct: 135131 caaggcattcaagaaaatccatgttaggcttgtcaaggagcttgagaagaagttcagtgg 135072 Query: 245 caagg 249 ||||| Sbjct: 135071 caagg 135067 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 53 tttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacat 112 |||||||||||| |||||||| ||||| ||||||||||||| ||||||||| | ||||| Sbjct: 135387 tttctttgacctcgagaatggaaaccattagctcaagagcgagctcaaggacatctacat 135328 Query: 113 c 113 | Sbjct: 135327 c 135327 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtc 44 ||||||| |||||| | ||||||| |||||||||||| ||||| Sbjct: 135583 agaaggagaagggcctatagccctccgagttcgaggactccgtc 135540
>dbj|AP004789.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0476C12 Length = 157570 Score = 107 bits (54), Expect = 3e-20 Identities = 124/146 (84%), Gaps = 1/146 (0%) Strand = Plus / Minus Query: 247 aggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctg 306 ||||||| ||||||| ||||||||| |||||||||||||| | ||| |||||||| |||| Sbjct: 1379 aggatgtggtctttgatgcaacaaggaggattgtgaggcctctcaataagggttcagctg 1320 Query: 307 ttcagcgccctcgcaccagaaccctgacagctgttcatgatggtatcttggaggatgttg 366 |||| | ||||| || ||||| ||| ||||||||||||| |||||||||||||| | Sbjct: 1319 ttcatcatcctcgtacaagaactttgattactgttcatgatggaatcttggaggatgtag 1260 Query: 367 tgtacccagctgagattgtggggaag 392 | | ||||||||||||||| |||||| Sbjct: 1259 tct-cccagctgagattgttgggaag 1235 Score = 73.8 bits (37), Expect = 4e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 125 ccagatggatgttgttgggaacaggaaggccgtggtgatccatgtgccgtaccgtctccg 184 |||||||||||||| || ||| |||||| || |||||||||||| ||||| ||| | Sbjct: 2125 ccagatggatgttgctgcgaattggaaggtggtagtgatccatgtgttgtaccatctgtg 2066 Query: 185 caagcccttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcgg 244 |||| | |||| ||| |||||||| ||||| |||| |||||| ||||||||||| || || Sbjct: 2065 caaggcattcaagaaaatccatgttaggcttgtcaaggagcttgagaagaagttcagtgg 2006 Query: 245 caagg 249 ||||| Sbjct: 2005 caagg 2001 Score = 65.9 bits (33), Expect = 1e-07 Identities = 54/61 (88%) Strand = Plus / Minus Query: 53 tttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctgtacat 112 |||||||||||| |||||||| ||||| ||||||||||||| ||||||||| | ||||| Sbjct: 2321 tttctttgacctcgagaatggaaaccattagctcaagagcgagctcaaggacatctacat 2262 Query: 113 c 113 | Sbjct: 2261 c 2261 Score = 40.1 bits (20), Expect = 6.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 1 agaaggacaagggcgtcgagccctcggagttcgaggacaccgtc 44 ||||||| |||||| | ||||||| |||||||||||| ||||| Sbjct: 2517 agaaggagaagggcctatagccctccgagttcgaggactccgtc 2474
>gb|AC134928.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1164G01, complete sequence Length = 151938 Score = 105 bits (53), Expect = 1e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 261 gttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctcgc 320 |||||||| ||||| || |||||||| || ||||| || || |||||| |||||||| Sbjct: 15763 gttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccctcgt 15704 Query: 321 accagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctgag 380 ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| ||| Sbjct: 15703 acccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagcagag 15644 Query: 381 attgtggggaagcgcgtcangtaccgtttggatggt 416 ||||| |||||||| |||| |||| ||||||||| Sbjct: 15643 attgttgggaagcgtgtcagataccacttggatggt 15608
>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete sequence Length = 143400 Score = 105 bits (53), Expect = 1e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 261 gttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctcgc 320 |||||||| ||||| || |||||||| || ||||| || || |||||| |||||||| Sbjct: 119576 gttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccctcgt 119517 Query: 321 accagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctgag 380 ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| ||| Sbjct: 119516 acccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagcagag 119457 Query: 381 attgtggggaagcgcgtcangtaccgtttggatggt 416 ||||| |||||||| |||| |||| ||||||||| Sbjct: 119456 attgttgggaagcgtgtcagataccacttggatggt 119421
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 105 bits (53), Expect = 1e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 261 gttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctcgc 320 |||||||| ||||| || |||||||| || ||||| || || |||||| |||||||| Sbjct: 16168406 gttgcaactagaagaatagtgaggcccccaaagaaaggctcagctgttgttcgccctcgt 16168347 Query: 321 accagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctgag 380 ||| | || || || |||||||||||||| |||||||||||||||||||| ||||| ||| Sbjct: 16168346 acccgcacacttactgctgttcatgatggcatcttggaggatgttgtgtatccagcagag 16168287 Query: 381 attgtggggaagcgcgtcangtaccgtttggatggt 416 ||||| |||||||| |||| |||| ||||||||| Sbjct: 16168286 attgttgggaagcgtgtcagataccacttggatggt 16168251
>gb|AF542971.1| Triticum aestivum ribosomal protein S7 mRNA, partial cds Length = 392 Score = 95.6 bits (48), Expect = 1e-16 Identities = 59/63 (93%) Strand = Plus / Plus Query: 386 ggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaagatttacttggaccc 445 ||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 3 ggggaagcgtgtcagataccgtttggatggtgccaaggtcatcaagatctacttggaccc 62 Query: 446 aaa 448 ||| Sbjct: 63 aaa 65
>gb|AY290724.1| Triticum aestivum ribosomal protein S7-like mRNA, partial sequence Length = 393 Score = 95.6 bits (48), Expect = 1e-16 Identities = 59/63 (93%) Strand = Plus / Plus Query: 386 ggggaagcgcgtcangtaccgtttggatggtgccaaggtcatcaagatttacttggaccc 445 ||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 4 ggggaagcgtgtcagataccgtttggatggtgccaaggtcatcaagatctacttggaccc 63 Query: 446 aaa 448 ||| Sbjct: 64 aaa 66
>gb|BT009440.1| Triticum aestivum clone wlmk4.pk0019.f5:fis, full insert mRNA sequence Length = 1907 Score = 83.8 bits (42), Expect = 4e-13 Identities = 42/42 (100%) Strand = Plus / Plus Query: 50 ggctttctttgacctggagaatggcaaccaggagctcaagag 91 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 1595 ggctttctttgacctggagaatggcaaccaggagctcaagag 1636
>gb|DQ228355.1| Solanum tuberosum clone 153A08 ribosomal protein S7-like protein mRNA, complete cds Length = 881 Score = 79.8 bits (40), Expect = 7e-12 Identities = 118/144 (81%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggatt 278 |||||| |||||||||| || || ||||||||||| ||||| |||| || || ||||| Sbjct: 337 agggagttggagaagaaattcagtggcaaggatgtgatctttattgcgaccaggaggata 396 Query: 279 gtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaaccctgacagct 338 ||||| || ||||||| ||||| |||| ||| || || ||||||||||| || ||| || Sbjct: 397 gtgagacctcccaagagaggttcagctgctcaacgaccccgcaccagaactcttacatct 456 Query: 339 gttcatgatggtatcttggaggat 362 |||||||||| || ||||||||| Sbjct: 457 gttcatgatgccatattggaggat 480
>gb|DQ200382.1| Solanum tuberosum clone 063A09 unknown mRNA Length = 817 Score = 79.8 bits (40), Expect = 7e-12 Identities = 118/144 (81%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggatt 278 |||||| |||||||||| || || ||||||||||| ||||| |||| || || ||||| Sbjct: 324 agggagttggagaagaaattcagtggcaaggatgtgatctttattgcgaccaggaggata 383 Query: 279 gtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaaccctgacagct 338 ||||| || ||||||| ||||| |||| ||| || || ||||||||||| || ||| || Sbjct: 384 gtgagacctcccaagagaggttcagctgctcaacgaccccgcaccagaactcttacatct 443 Query: 339 gttcatgatggtatcttggaggat 362 |||||||||| || ||||||||| Sbjct: 444 gttcatgatgccatattggaggat 467
>ref|NM_121618.2| Arabidopsis thaliana structural constituent of ribosome AT5G16130 mRNA, complete cds Length = 878 Score = 77.8 bits (39), Expect = 3e-11 Identities = 84/99 (84%) Strand = Plus / Plus Query: 213 ctcgtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaaga 272 |||||||| ||||| ||||||||||| || || ||||||||| |||||||| | |||||| Sbjct: 367 ctcgtcagagagcttgagaagaagttcagtggaaaggatgttatctttgttaccacaaga 426 Query: 273 aggattgtgaggccacccaagaagggttccgctgttcag 311 ||||| || | || |||||||||||| | ||||||||| Sbjct: 427 aggatcatgcgtccccccaagaagggtgctgctgttcag 465
>gb|BT024914.1| Arabidopsis thaliana At5g16130 mRNA, complete cds Length = 573 Score = 77.8 bits (39), Expect = 3e-11 Identities = 84/99 (84%) Strand = Plus / Plus Query: 213 ctcgtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaaga 272 |||||||| ||||| ||||||||||| || || ||||||||| |||||||| | |||||| Sbjct: 238 ctcgtcagagagcttgagaagaagttcagtggaaaggatgttatctttgttaccacaaga 297 Query: 273 aggattgtgaggccacccaagaagggttccgctgttcag 311 ||||| || | || |||||||||||| | ||||||||| Sbjct: 298 aggatcatgcgtccccccaagaagggtgctgctgttcag 336
>emb|BX832565.1|CNS09ZKS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZG09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 797 Score = 77.8 bits (39), Expect = 3e-11 Identities = 84/99 (84%) Strand = Plus / Plus Query: 213 ctcgtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaaga 272 |||||||| ||||| ||||||||||| || || ||||||||| |||||||| | |||||| Sbjct: 293 ctcgtcagagagcttgagaagaagttcagtggaaaggatgttatctttgttaccacaaga 352 Query: 273 aggattgtgaggccacccaagaagggttccgctgttcag 311 ||||| || | || |||||||||||| | ||||||||| Sbjct: 353 aggatcatgcgtccccccaagaagggtgctgctgttcag 391
>gb|AY086292.1| Arabidopsis thaliana clone 23518 mRNA, complete sequence Length = 872 Score = 77.8 bits (39), Expect = 3e-11 Identities = 84/99 (84%) Strand = Plus / Plus Query: 213 ctcgtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaaga 272 |||||||| ||||| ||||||||||| || || ||||||||| |||||||| | |||||| Sbjct: 367 ctcgtcagagagcttgagaagaagttcagtggaaaggatgttatctttgttaccacaaga 426 Query: 273 aggattgtgaggccacccaagaagggttccgctgttcag 311 ||||| || | || |||||||||||| | ||||||||| Sbjct: 427 aggatcatgcgtccccccaagaagggtgctgctgttcag 465
>gb|DQ191636.1| Solanum tuberosum 40S ribosomal protein S7-like protein mRNA, complete cds Length = 893 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggatt 278 |||||| |||||||||| || || ||||||||||| ||||| |||| || || ||||| Sbjct: 320 agggagttggagaagaaattcagtggcaaggatgtgatctttattgccaccaggaggata 379 Query: 279 gtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaaccctgacagct 338 ||||| || || |||| ||||| |||| ||| || || ||||||||||| || ||| || Sbjct: 380 gtgagacctcctaagagaggttcagctgctcaacgaccccgcaccagaactcttacatct 439 Query: 339 gttcatgatggtatcttggaggat 362 |||||||||| || ||||||||| Sbjct: 440 gttcatgatgccatattggaggat 463
>gb|DQ241830.1| Solanum tuberosum clone 174B09 40S ribosomal protein S7-like protein-like mRNA, complete cds Length = 894 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggatt 278 |||||| |||||||||| || || ||||||||||| ||||| |||| || || ||||| Sbjct: 327 agggagttggagaagaaattcagtggcaaggatgtgatctttattgccaccaggaggata 386 Query: 279 gtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaaccctgacagct 338 ||||| || || |||| ||||| |||| ||| || || ||||||||||| || ||| || Sbjct: 387 gtgagacctcctaagagaggttcagctgctcaacgaccccgcaccagaactcttacatct 446 Query: 339 gttcatgatggtatcttggaggat 362 |||||||||| || ||||||||| Sbjct: 447 gttcatgatgccatattggaggat 470
>gb|DQ377970.1| Populus x canadensis putative 40S ribosomal protein S7 mRNA, partial cds Length = 546 Score = 61.9 bits (31), Expect = 2e-06 Identities = 79/95 (83%) Strand = Plus / Plus Query: 222 gagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggattgtg 281 ||||||||||| ||||| || || ||||||||||| | |||| || ||||||||||| Sbjct: 300 gagctggagaaaaagttcagtgggaaggatgttgttctgcttgctacccgaaggattgtg 359 Query: 282 aggccacccaagaagggttccgctgttcagcgccc 316 | ||||||||||| || || |||||||||||||| Sbjct: 360 cgtccacccaagaaaggctctgctgttcagcgccc 394
>gb|AY086866.1| Arabidopsis thaliana clone 28739 mRNA, complete sequence Length = 841 Score = 60.0 bits (30), Expect = 6e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 228 gagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggcca 287 ||||||||||| || || |||||||| || | |||| ||||| |||||||||||||| Sbjct: 354 gagaagaagttcagtggaaaggatgtgatcctcattgctacaaggaggattgtgaggccg 413 Query: 288 cccaagaagggttc 301 |||||||||||||| Sbjct: 414 cccaagaagggttc 427
>dbj|AP004915.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT16G15, TM0073, complete sequence Length = 90077 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 192 ttcaggaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaagg 249 ||||||||| | ||||| | ||| ||||||||||| |||||||||||||| ||||||| Sbjct: 13996 ttcaggaaggttcatgttaagcttgtcagggagcttgagaagaagtttagtggcaagg 14053 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 198 aagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaagg 249 ||||| ||||| ||||| ||||||||||| ||||||||||||| ||||||| Sbjct: 24388 aagattcatgttaggctagtcagggagcttaagaagaagtttagtggcaagg 24439 Score = 48.1 bits (24), Expect = 0.025 Identities = 90/112 (80%) Strand = Plus / Plus Query: 280 tgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaaccctgacagctg 339 |||||||||| ||||| ||||| |||| ||| || || |||||| | ||||| || |||| Sbjct: 14637 tgaggccaccaaagaaaggttcagctgctcaacgtccccgcacccgtaccctcaccgctg 14696 Query: 340 ttcatgatggtatcttggaggatgttgtgtacccagctgagattgtggggaa 391 ||||||| | || |||||||||| || | || ||||||||||| ||||| Sbjct: 14697 ttcatgaagcaatgctggaggatgtcgtattgcctgctgagattgttgggaa 14748
>ref|XM_784661.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal protein S7 (S8) (LOC584812), mRNA Length = 667 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgt 253 ||||||||| |||||||| ||| | ||||| ||||||||||| ||||||||| |||| Sbjct: 239 gaagatccaggtcaggctagtccgagagcttgagaagaagttcagcggcaagcatgt 295
>gb|AY130375.1| Branchiostoma lanceolatum ribosomal protein S7 mRNA, partial cds Length = 530 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 220 gggagctggagaagaagtttagcggcaaggatgttgtctt 259 ||||||||||||||||||| || |||||| |||||||||| Sbjct: 213 gggagctggagaagaagttcagtggcaagcatgttgtctt 252
>gb|AF526221.1| Argopecten irradians isolate iolsaicl205ct237cn254 ribosomal protein S7 mRNA, complete cds Length = 651 Score = 54.0 bits (27), Expect = 4e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgca 266 |||||||||||||| |||||||| ||||| ||| ||||||| ||| ||||| Sbjct: 248 gtcagggagctggaaaagaagttcagcggaaagcatgttgtatttattgca 298
>ref|NM_103777.2| Arabidopsis thaliana structural constituent of ribosome AT1G48830 transcript variant AT1G48830.1 mRNA, complete cds Length = 842 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Plus Query: 228 gagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggcca 287 ||||||||||| || || |||||||| || | |||| ||||| |||||||||||||| Sbjct: 356 gagaagaagttcagtggaaaggatgtgatcctcattgctacaaggaggattgtgaggccg 415 Query: 288 cccaagaagggttc 301 || ||||||||||| Sbjct: 416 ccaaagaagggttc 429
>ref|NM_179455.2| Arabidopsis thaliana structural constituent of ribosome AT1G48830 transcript variant AT1G48830.2 mRNA, complete cds Length = 837 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Plus Query: 228 gagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggcca 287 ||||||||||| || || |||||||| || | |||| ||||| |||||||||||||| Sbjct: 296 gagaagaagttcagtggaaaggatgtgatcctcattgctacaaggaggattgtgaggccg 355 Query: 288 cccaagaagggttc 301 || ||||||||||| Sbjct: 356 ccaaagaagggttc 369
>gb|AY072617.1| Arabidopsis thaliana At1g48830/T24P22_5 mRNA, complete cds Length = 576 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Plus Query: 228 gagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggcca 287 ||||||||||| || || |||||||| || | |||| ||||| |||||||||||||| Sbjct: 253 gagaagaagttcagtggaaaggatgtgatcctcattgctacaaggaggattgtgaggccg 312 Query: 288 cccaagaagggttc 301 || ||||||||||| Sbjct: 313 ccaaagaagggttc 326
>gb|AF412048.1|AF412048 Arabidopsis thaliana At1g48830/T24P22_5 mRNA, complete cds Length = 814 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Plus Query: 228 gagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaaggattgtgaggcca 287 ||||||||||| || || |||||||| || | |||| ||||| |||||||||||||| Sbjct: 350 gagaagaagttcagtggaaaggatgtgatcctcattgctacaaggaggattgtgaggccg 409 Query: 288 cccaagaagggttc 301 || ||||||||||| Sbjct: 410 ccaaagaagggttc 423
>gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence Length = 132380 Score = 50.1 bits (25), Expect = 0.006 Identities = 58/69 (84%) Strand = Plus / Plus Query: 48 caggctttctttgacctggagaatggcaaccaggagctcaagagcgacctcaaggacctg 107 |||||||||||||| ||||||||| |||||||||| | || ||||| | || || ||| Sbjct: 125409 caggctttctttgatctggagaataccaaccaggagttgaaaagcgatttgaaagatctg 125468 Query: 108 tacatcaac 116 ||||||||| Sbjct: 125469 tacatcaac 125477
>emb|AL391148.1|ATT21H19 Arabidopsis thaliana DNA chromosome 5, BAC clone T21H19 (ESSA project) Length = 77311 Score = 50.1 bits (25), Expect = 0.006 Identities = 55/65 (84%) Strand = Plus / Plus Query: 247 aggatgttgtctttgttgcaacaagaaggattgtgaggccacccaagaagggttccgctg 306 |||||||| |||||||| | ||||||||||| || | || |||||||||||| | |||| Sbjct: 13541 aggatgttatctttgttaccacaagaaggatcatgcgtccccccaagaagggtgctgctg 13600 Query: 307 ttcag 311 ||||| Sbjct: 13601 ttcag 13605
>gb|AF402815.1| Ictalurus punctatus 40S ribosomal protein S7 mRNA, complete cds Length = 641 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Plus Query: 211 ggctcgtcagggagctggagaagaagtttagcggcaaggatgttgtctt 259 ||||||| ||||||||||||||||||| || |||||| |||| ||||| Sbjct: 255 ggctcgtgcgggagctggagaagaagttcagtggcaagcatgtggtctt 303
>dbj|AK173962.1| Ciona intestinalis cDNA, clone:cixxx00042, full insert sequence Length = 675 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 219 agggagctggagaagaagtttagcggcaa 247 |||||||| |||||||||||||||||||| Sbjct: 389 agggagctagagaagaagtttagcggcaa 361
>dbj|AK112218.1| Ciona intestinalis cDNA, clone:ciad004i11, full insert sequence Length = 730 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaa 247 |||||||| |||||||||||||||||||| Sbjct: 323 agggagctagagaagaagtttagcggcaa 351
>emb|CR940311.11| M.truncatula DNA sequence from clone MTH2-17E17 on chromosome 3, complete sequence Length = 122868 Score = 48.1 bits (24), Expect = 0.025 Identities = 45/52 (86%) Strand = Plus / Plus Query: 198 aagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaagg 249 ||||| ||||||||||| || |||||||| |||||||| || ||||| |||| Sbjct: 45441 aagattcatgtcaggcttgttagggagctcgagaagaaattcagcggaaagg 45492
>gb|AC073555.9|AC073555 Arabidopsis thaliana chromosome 1 BAC F11I4 genomic sequence, complete sequence Length = 80561 Score = 48.1 bits (24), Expect = 0.025 Identities = 36/40 (90%) Strand = Plus / Plus Query: 262 ttgcaacaagaaggattgtgaggccacccaagaagggttc 301 |||| ||||| |||||||||||||| || ||||||||||| Sbjct: 1818 ttgctacaaggaggattgtgaggccgccaaagaagggttc 1857
>gb|AC084242.4|AC084242 Arabidopsis thaliana chromosome 1 BAC T24P22 genomic sequence, complete sequence Length = 18062 Score = 48.1 bits (24), Expect = 0.025 Identities = 36/40 (90%) Strand = Plus / Plus Query: 262 ttgcaacaagaaggattgtgaggccacccaagaagggttc 301 |||| ||||| |||||||||||||| || ||||||||||| Sbjct: 15507 ttgctacaaggaggattgtgaggccgccaaagaagggttc 15546
>gb|BC041282.1| Xenopus laevis ribosomal protein S8 (rpS8B), mRNA (cDNA clone MGC:53555 IMAGE:4681493), complete cds Length = 660 Score = 46.1 bits (23), Expect = 0.098 Identities = 53/63 (84%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgt 256 ||||||||| || ||||| || | ||| |||||||||| ||||||||||| ||||||| Sbjct: 244 gaagatccaagtaaggctagttcgcgagttggagaagaaatttagcggcaaacatgttgt 303 Query: 257 ctt 259 ||| Sbjct: 304 ctt 306
>gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence Length = 146078 Score = 46.1 bits (23), Expect = 0.098 Identities = 107/135 (79%) Strand = Plus / Plus Query: 261 gttgcaacaagaaggattgtgaggccacccaagaagggttccgctgttcagcgccctcgc 320 ||||| || |||||||| |||| || || |||||||| || |||||||| | || ||| Sbjct: 143087 gttgccaccagaaggatcttgagacctccgaagaagggatctgctgttcaaaggccacgc 143146 Query: 321 accagaaccctgacagctgttcatgatggtatcttggaggatgttgtgtacccagctgag 380 |||||||| ||||| ||||| ||||| | | | ||||||||||||| || || ||| Sbjct: 143147 accagaactctgaccgctgtccatgaagccacgctcgaggatgttgtgtttcctgccgag 143206 Query: 381 attgtggggaagcgc 395 ||||| ||||||||| Sbjct: 143207 attgtcgggaagcgc 143221 Score = 46.1 bits (23), Expect = 0.098 Identities = 29/31 (93%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaagg 249 |||||||||||||||||||| || ||||||| Sbjct: 142858 agggagctggagaagaagttcagtggcaagg 142888
>emb|X94942.1|FRRPS7U17 F.rubripes rpS7 and snoRNA U17 genes Length = 4298 Score = 46.1 bits (23), Expect = 0.098 Identities = 41/47 (87%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtttagcggcaaggatgttgtctttgttgc 265 |||||||||||||||||||| ||||| ||| | || |||||| |||| Sbjct: 1969 agggagctggagaagaagttcagcggaaagcacgtagtctttattgc 2015
>gb|AF144752.1|AF144752 Brassica oleracea 40S ribosomal protein S7 homolog mRNA, complete cds Length = 798 Score = 46.1 bits (23), Expect = 0.098 Identities = 50/59 (84%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaag 274 ||||| ||||| ||||||||||| || || || |||||| |||||||||| || ||||| Sbjct: 322 gtcagagagctcgagaagaagttcagtggtaacgatgttatctttgttgccaccagaag 380
>emb|CT032508.1| Platynereis dumerilii EST IB0AAA37AE02FM1 Length = 682 Score = 46.1 bits (23), Expect = 0.098 Identities = 44/51 (86%) Strand = Plus / Minus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaa 247 ||||||||| |||| || ||| | ||| |||||||||||||||||||||| Sbjct: 455 gaagatccagatcagactggtccgtgagttggagaagaagtttagcggcaa 405
>gb|M21486.1|XELRPS8B X.laevis ribosomal protein S8 (rpS8B) mRNA, complete cds Length = 638 Score = 46.1 bits (23), Expect = 0.098 Identities = 53/63 (84%) Strand = Plus / Plus Query: 197 gaagatccatgtcaggctcgtcagggagctggagaagaagtttagcggcaaggatgttgt 256 ||||||||| || ||||| || | ||| |||||||||| ||||||||||| ||||||| Sbjct: 227 gaagatccaagtaaggctagttcgcgagttggagaagaaatttagcggcaaacatgttgt 286 Query: 257 ctt 259 ||| Sbjct: 287 ctt 289
>gb|BC041307.1| Xenopus laevis ribosomal protein S8, mRNA (cDNA clone MGC:53608 IMAGE:4684065), complete cds Length = 650 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 226 tggagaagaagtttagcggcaaggatgttgtctt 259 |||||||||| ||||||||||| |||||||||| Sbjct: 258 tggagaagaaatttagcggcaaacatgttgtctt 291
>emb|V01442.1|XLRIB5 Fragment of Xenopus laevis mRNA for ribosomal protein S8 Length = 512 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 226 tggagaagaagtttagcggcaaggatgttgtctt 259 |||||||||| ||||||||||| |||||||||| Sbjct: 195 tggagaagaaatttagcggcaaacatgttgtctt 228
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 86 caagagcgacctcaaggacctg 107 |||||||||||||||||||||| Sbjct: 2899927 caagagcgacctcaaggacctg 2899948
>gb|M21485.1|XELRPS8A X.laevis ribosomal protein S8 (rpS8A) mRNA, complete cds Length = 671 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 226 tggagaagaagtttagcggcaaggatgttgtctt 259 |||||||||| ||||||||||| |||||||||| Sbjct: 285 tggagaagaaatttagcggcaaacatgttgtctt 318
>ref|NM_180173.1| Arabidopsis thaliana structural constituent of ribosome AT3G02560 transcript variant AT3G02560.2 mRNA, complete cds Length = 860 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 359 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 418 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 419 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 471
>ref|NM_111124.2| Arabidopsis thaliana structural constituent of ribosome AT3G02560 transcript variant AT3G02560.1 mRNA, complete cds Length = 859 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 358 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 417 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 418 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 470
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 ggagttcgaggacaccgtcgc 46 ||||||||||||||||||||| Sbjct: 1359294 ggagttcgaggacaccgtcgc 1359274
>gb|AC021640.7|ATAC021640 Arabidopsis thaliana chromosome III BAC F16B3 genomic sequence, complete sequence Length = 103904 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 58388 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 58447 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 58448 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 58500
>gb|AY072616.1| Arabidopsis thaliana AT3g02560/F16B3_19 mRNA, complete cds Length = 576 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 241 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 300 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 301 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 353
>gb|AY062673.1| Arabidopsis thaliana putative 40S ribosomal protein (At3g02560; F16B3.19) mRNA, complete cds Length = 776 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 315 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 374 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 375 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 427
>gb|AF428416.1|AF428416 Arabidopsis thaliana AT3g02560/F16B3_19 mRNA, complete cds Length = 764 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 319 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 378 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 379 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 431
>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold Length = 1889755 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 252 gttgtctttgttgcaacaagaagga 276 |||||||||| |||||||||||||| Sbjct: 1001641 gttgtctttgatgcaacaagaagga 1001617
>gb|AF412046.1|AF412046 Arabidopsis thaliana AT3g02560/F16B3_19 mRNA, complete cds Length = 776 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 319 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 378 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 379 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 431
>gb|AY087001.1| Arabidopsis thaliana clone 30349 mRNA, complete sequence Length = 844 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 358 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 417 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 418 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 470
>gb|AC104781.4| Homo sapiens BAC clone RP11-30C22 from 2, complete sequence Length = 109843 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 418 ccaaggtcatcaagatttact 438 ||||||||||||||||||||| Sbjct: 3852 ccaaggtcatcaagatttact 3872
>gb|AC151390.3| Oryctolagus cuniculus clone LB1-118M16, complete sequence Length = 41753 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 252 gttgtctttgttgcaacaagaagga 276 |||||||||| |||||||||||||| Sbjct: 37727 gttgtctttgatgcaacaagaagga 37703
>gb|BT001226.1| Arabidopsis thaliana putative 40S ribosomal protein (At3g02560) mRNA, complete cds Length = 682 Score = 42.1 bits (21), Expect = 1.5 Identities = 90/113 (79%) Strand = Plus / Plus Query: 216 gtcagggagctggagaagaagtttagcggcaaggatgttgtctttgttgcaacaagaagg 275 ||||| ||||| ||||||||||| || || || ||||| |||||||||| || ||||| Sbjct: 241 gtcagagagcttgagaagaagttcagtggaaaagatgtgatctttgttgctaccagaaga 300 Query: 276 attgtgaggccacccaagaagggttccgctgttcagcgccctcgcaccagaac 328 || || | ||||| ||||| || || ||||||||| | || |||| |||||| Sbjct: 301 atcatgcgcccaccaaagaaaggctcagctgttcagagaccacgcaacagaac 353
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 cagctgagattgtggggaag 392 |||||||||||||||||||| Sbjct: 313622 cagctgagattgtggggaag 313603
>ref|XM_594321.2| PREDICTED: Bos taurus similar to RAP2C, member of RAS oncogene family (LOC516177), mRNA Length = 604 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 ctcaaggacctgtacatcaa 115 |||||||||||||||||||| Sbjct: 224 ctcaaggacctgtacatcaa 243
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 gacaagggcgtcgagccctc 25 |||||||||||||||||||| Sbjct: 4951542 gacaagggcgtcgagccctc 4951523
>ref|XM_537559.2| PREDICTED: Canis familiaris similar to RAP2C, member of RAS oncogene family (LOC480441), mRNA Length = 603 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 ctcaaggacctgtacatcaa 115 |||||||||||||||||||| Sbjct: 223 ctcaaggacctgtacatcaa 242
>emb|CR711820.2|CNS0GC6W Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR720286.2|CNS0GIPW Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR722596.2|CNS0GKI2 Tetraodon nigroviridis full-length cDNA Length = 653 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR722272.2|CNS0GK92 Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR722014.2|CNS0GK1W Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR721102.2|CNS0GJCK Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR721055.2|CNS0GJB9 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR720630.2|CNS0GIZG Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR720474.2|CNS0GIV4 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR719557.2|CNS0GI5N Tetraodon nigroviridis full-length cDNA Length = 622 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR717871.2|CNS0GGUT Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR716365.2|CNS0GFP2 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR716183.2|CNS0GFK0 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR715976.2|CNS0GFEC Tetraodon nigroviridis full-length cDNA Length = 653 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR715924.2|CNS0GFCW Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR715755.2|CNS0GF87 Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR715586.2|CNS0GF3I Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 279 agggagctggagaagaagtt 298
>emb|CR715394.2|CNS0GEY6 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR714863.2|CNS0GEJF Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR714165.2|CNS0GE01 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR714642.2|CNS0GEDA Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR712550.2|CNS0GCR6 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR713581.2|CNS0GDJT Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR713259.2|CNS0GDAV Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR710309.2|CNS0GB0X Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR710261.2|CNS0GAZL Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR710166.2|CNS0GAWY Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR710162.2|CNS0GAWU Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR709317.2|CNS0GA9D Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR708638.2|CNS0G9QI Tetraodon nigroviridis full-length cDNA Length = 653 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 275 agggagctggagaagaagtt 294
>emb|CR708403.2|CNS0G9JZ Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR708252.2|CNS0G9FS Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR708004.2|CNS0G98W Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR707515.2|CNS0G8VB Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR707486.2|CNS0G8UI Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR706076.2|CNS0G7RC Tetraodon nigroviridis full-length cDNA Length = 653 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR706039.2|CNS0G7QB Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR706717.2|CNS0G895 Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR705742.2|CNS0G7I2 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR705273.2|CNS0G751 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR704967.2|CNS0G6WJ Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR702853.2|CNS0G59T Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR701221.2|CNS0G40H Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR700029.2|CNS0G33D Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR698114.2|CNS0G1M6 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR697947.2|CNS0G1HJ Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR697385.2|CNS0G11X Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR697796.2|CNS0G1DC Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR697612.2|CNS0G188 Tetraodon nigroviridis full-length cDNA Length = 630 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR696361.2|CNS0G09H Tetraodon nigroviridis full-length cDNA Length = 630 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR694149.2|CNS0FYK1 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR693705.2|CNS0FY7P Tetraodon nigroviridis full-length cDNA Length = 652 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR693499.2|CNS0FY1Z Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR692930.2|CNS0FXM6 Tetraodon nigroviridis full-length cDNA Length = 627 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR692928.2|CNS0FXM4 Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR692739.2|CNS0FXGV Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR692662.2|CNS0FXEQ Tetraodon nigroviridis full-length cDNA Length = 652 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR690969.2|CNS0FW3P Tetraodon nigroviridis full-length cDNA Length = 595 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 219 agggagctggagaagaagtt 238
>emb|CR690351.2|CNS0FVMJ Tetraodon nigroviridis full-length cDNA Length = 648 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR690232.2|CNS0FVJ8 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR689455.2|CNS0FUXN Tetraodon nigroviridis full-length cDNA Length = 652 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR687730.2|CNS0FTLQ Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR687368.2|CNS0FTBO Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 146 agggagctggagaagaagtt 165
>emb|CR687003.2|CNS0FT1J Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR686806.2|CNS0FSW2 Tetraodon nigroviridis full-length cDNA Length = 630 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR685440.2|CNS0FRU4 Tetraodon nigroviridis full-length cDNA Length = 652 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR684931.2|CNS0FRFZ Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR683128.2|CNS0FQ1W Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR682568.2|CNS0FPMC Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR682273.2|CNS0FPE5 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR680863.2|CNS0FOAZ Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR680771.2|CNS0FO8F Tetraodon nigroviridis full-length cDNA Length = 610 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 231 agggagctggagaagaagtt 250
>emb|CR680576.2|CNS0FO30 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR680495.2|CNS0FO0R Tetraodon nigroviridis full-length cDNA Length = 633 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 255 agggagctggagaagaagtt 274
>emb|CR677819.2|CNS0FLYR Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR675752.2|CNS0FKDQ Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR675399.2|CNS0FK3X Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR674027.2|CNS0FJ1T Tetraodon nigroviridis full-length cDNA Length = 657 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 279 agggagctggagaagaagtt 298
>emb|CR673781.2|CNS0FIUZ Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR673668.2|CNS0FIRU Tetraodon nigroviridis full-length cDNA Length = 634 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR673249.2|CNS0FIG7 Tetraodon nigroviridis full-length cDNA Length = 681 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 303 agggagctggagaagaagtt 322
>emb|CR673157.2|CNS0FIDN Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR672906.2|CNS0FI6O Tetraodon nigroviridis full-length cDNA Length = 657 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 279 agggagctggagaagaagtt 298
>emb|CR671190.2|CNS0FGV0 Tetraodon nigroviridis full-length cDNA Length = 662 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 279 agggagctggagaagaagtt 298
>emb|CR671018.2|CNS0FGQ8 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR671550.2|CNS0FH50 Tetraodon nigroviridis full-length cDNA Length = 631 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR669863.2|CNS0FFU5 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR669389.2|CNS0FFGZ Tetraodon nigroviridis full-length cDNA Length = 629 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR668276.2|CNS0FEM2 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR667678.2|CNS0FE5G Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR667608.2|CNS0FE3I Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR666868.2|CNS0FDIY Tetraodon nigroviridis full-length cDNA Length = 651 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 275 agggagctggagaagaagtt 294
>emb|CR666865.2|CNS0FDIV Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR665266.2|CNS0FCAG Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR664906.2|CNS0FC0G Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR664875.2|CNS0FBZL Tetraodon nigroviridis full-length cDNA Length = 625 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR663179.2|CNS0FAOH Tetraodon nigroviridis full-length cDNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 277 agggagctggagaagaagtt 296
>emb|CR662635.2|CNS0FA9D Tetraodon nigroviridis full-length cDNA Length = 649 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR662065.2|CNS0F9TJ Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR661584.2|CNS0F9G6 Tetraodon nigroviridis full-length cDNA Length = 630 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR661286.2|CNS0F97W Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR660780.2|CNS0F8TU Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR660630.2|CNS0F8PO Tetraodon nigroviridis full-length cDNA Length = 657 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 279 agggagctggagaagaagtt 298
>emb|CR659913.2|CNS0F85R Tetraodon nigroviridis full-length cDNA Length = 676 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 300 agggagctggagaagaagtt 319
>emb|CR659516.2|CNS0F7UQ Tetraodon nigroviridis full-length cDNA Length = 629 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 251 agggagctggagaagaagtt 270
>emb|CR658407.2|CNS0F6ZX Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR657635.2|CNS0F6EH Tetraodon nigroviridis full-length cDNA Length = 679 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 303 agggagctggagaagaagtt 322
>emb|CR657432.2|CNS0F68U Tetraodon nigroviridis full-length cDNA Length = 633 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 255 agggagctggagaagaagtt 274
>emb|CR653809.2|CNS0F3G7 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR653664.2|CNS0F3C6 Tetraodon nigroviridis full-length cDNA Length = 596 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 218 agggagctggagaagaagtt 237
>emb|CR653618.2|CNS0F3AW Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR652430.2|CNS0F2DW Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR652211.2|CNS0F27T Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR650802.2|CNS0F14O Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR650603.2|CNS0F0Z5 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR648532.2|CNS0EZDM Tetraodon nigroviridis full-length cDNA Length = 651 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 275 agggagctggagaagaagtt 294
>emb|CR646794.2|CNS0EY1C Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR643181.2|CNS0EV8Z Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR646327.2|CNS0EXOD Tetraodon nigroviridis full-length cDNA Length = 653 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 275 agggagctggagaagaagtt 294
>emb|CR645314.2|CNS0EWW8 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR645130.2|CNS0EWR4 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR644637.2|CNS0EWDF Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR644142.2|CNS0EVZO Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR643445.2|CNS0EVGB Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR643443.2|CNS0EVG9 Tetraodon nigroviridis full-length cDNA Length = 449 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 73 agggagctggagaagaagtt 92
>emb|CR641141.2|CNS0ETOB Tetraodon nigroviridis full-length cDNA Length = 405 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 29 agggagctggagaagaagtt 48
>emb|CR640323.2|CNS0ET1L Tetraodon nigroviridis full-length cDNA Length = 596 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 220 agggagctggagaagaagtt 239
>emb|CR638719.2|CNS0ERT1 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR637142.2|CNS0EQL8 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR635971.2|CNS0EPOP Tetraodon nigroviridis full-length cDNA Length = 652 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 276 agggagctggagaagaagtt 295
>emb|CR635904.2|CNS0EPMU Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR635119.2|CNS0EP11 Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR634019.2|CNS0EO6H Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR633461.2|CNS0ENQZ Tetraodon nigroviridis full-length cDNA Length = 631 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR633415.2|CNS0ENPP Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR632667.2|CNS0EN4X Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR632627.2|CNS0EN3T Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR632617.2|CNS0EN3J Tetraodon nigroviridis full-length cDNA Length = 631 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR631166.2|CNS0ELZ7 Tetraodon nigroviridis full-length cDNA Length = 656 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>emb|CR632404.2|CNS0EMXM Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR632058.2|CNS0EMO0 Tetraodon nigroviridis full-length cDNA Length = 623 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR631618.2|CNS0EMBS Tetraodon nigroviridis full-length cDNA Length = 632 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 254 agggagctggagaagaagtt 273
>emb|CR631612.2|CNS0EMBM Tetraodon nigroviridis full-length cDNA Length = 654 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 agggagctggagaagaagtt 238 |||||||||||||||||||| Sbjct: 278 agggagctggagaagaagtt 297
>gb|AC091867.3| Homo sapiens chromosome 5 clone CTD-2365E22, complete sequence Length = 98183 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 218 cagggagctggagaagaagt 237 |||||||||||||||||||| Sbjct: 50548 cagggagctggagaagaagt 50567
>gb|DQ066326.1| Ixodes scapularis isolate IS-6-12L-109 40S ribosomal protein S7-like mRNA, partial cds Length = 594 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 222 gagctggagaagaagtttagcggc 245 ||||||||||||||||| |||||| Sbjct: 277 gagctggagaagaagttcagcggc 300
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence Length = 439641 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 216 gtcagggagctggagaagaagttt 239 |||||| ||||||||||||||||| Sbjct: 300317 gtcaggaagctggagaagaagttt 300294
>gb|AF543540.1| Oncorhynchus mykiss 40S ribosomal protein S7 mRNA, partial cds Length = 132 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 213 ctcgtcagggagctggagaagaagtttagcgg 244 ||||| ||||||||||| |||||||| ||||| Sbjct: 7 ctcgtgagggagctggaaaagaagttcagcgg 38
>ref|XM_345725.2| PREDICTED: Rattus norvegicus similar to RAP2A, member of RAS oncogene family (LOC366733), mRNA Length = 603 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cctcaaggacctgtacatca 114 |||||||||||||||||||| Sbjct: 222 cctcaaggacctgtacatca 241
>gb|AC020576.2|T12C22 Sequence of BAC T12C22 from Arabidopsis thaliana chromosome 1, complete sequence Length = 115421 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 337 ctgttcatgatggtatcttg 356 |||||||||||||||||||| Sbjct: 41652 ctgttcatgatggtatcttg 41671
>emb|AM159218.1| Oncorhynchus mykiss mRNA for 40S ribosomal protein S7 (rps7 gene) Length = 718 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 213 ctcgtcagggagctggagaagaagtttagcgg 244 ||||| ||||||||||| |||||||| ||||| Sbjct: 368 ctcgtgagggagctggaaaagaagttcagcgg 399
>emb|AL691430.6| Mouse DNA sequence from clone RP23-206C1 on chromosome 2, complete sequence Length = 119748 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 atgttgtctttgttgcaaca 269 |||||||||||||||||||| Sbjct: 26534 atgttgtctttgttgcaaca 26515 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,521,872 Number of Sequences: 3902068 Number of extensions: 3521872 Number of successful extensions: 66375 Number of sequences better than 10.0: 231 Number of HSP's better than 10.0 without gapping: 231 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65835 Number of HSP's gapped (non-prelim): 525 length of query: 448 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 426 effective length of database: 17,147,199,772 effective search space: 7304707102872 effective search space used: 7304707102872 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
