>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 119     atgtaaaatacaaaggggca 138
               ||||||||||||||||||||
Sbjct: 1563664 atgtaaaatacaaaggggca 1563683

>ref|NM_007724.2| Mus musculus cyclic nucleotide gated channel alpha 2 (Cnga2), mRNA
          Length = 3073

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   aggcatggcaatgacaaaca 21
           ||||||||||||||||||||
Sbjct: 796 aggcatggcaatgacaaaca 777

>gb|AC098735.4| Mus musculus BAC clone RP23-121P5 from 16, complete sequence
          Length = 189844

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    atgataggcataaagtatga 47
             ||||||||||||||||||||
Sbjct: 98500 atgataggcataaagtatga 98519

>emb|X55519.1|RNOLFCH Rat mRNA for a cyclic nucleotide-activated olfactory channel
          Length = 3027

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   aggcatggcaatgacaaaca 21
           ||||||||||||||||||||
Sbjct: 795 aggcatggcaatgacaaaca 776

>dbj|AK132574.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched
           library, clone:4832423E21 product:cyclic nucleotide
           gated channel alpha 2, full insert sequence
          Length = 3066

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   aggcatggcaatgacaaaca 21
           ||||||||||||||||||||
Sbjct: 824 aggcatggcaatgacaaaca 805

>gb|AF126808.1|AF126808 Rattus norvegicus olfactory cyclic nucleotide-gated ion channel
           alpha subunit mRNA, complete cds
          Length = 2815

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   aggcatggcaatgacaaaca 21
           ||||||||||||||||||||
Sbjct: 689 aggcatggcaatgacaaaca 670

>gb|AC154770.2| Mus musculus BAC clone RP24-448C20 from chromosome 16, complete sequence
          Length = 196851

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     atgataggcataaagtatga 47
              ||||||||||||||||||||
Sbjct: 194813 atgataggcataaagtatga 194832

>gb|BC048775.1| Mus musculus cyclic nucleotide gated channel alpha 2, mRNA (cDNA
           clone MGC:54771 IMAGE:6310696), complete cds
          Length = 3073

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   aggcatggcaatgacaaaca 21
           ||||||||||||||||||||
Sbjct: 796 aggcatggcaatgacaaaca 777

>ref|NM_012928.1| Rattus norvegicus cyclic nucleotide gated channel alpha 2 (Cnga2),
           mRNA
          Length = 3027

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   aggcatggcaatgacaaaca 21
           ||||||||||||||||||||
Sbjct: 795 aggcatggcaatgacaaaca 776

>gb|U49391.1|MMU49391 Mus musculus cyclic nucleotide-gated olfactory channel protein gene,
            complete cds
          Length = 9618

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    aggcatggcaatgacaaaca 21
            ||||||||||||||||||||
Sbjct: 4858 aggcatggcaatgacaaaca 4839

>emb|AL731693.9| Mouse DNA sequence from clone RP23-233O1 on chromosome X, complete
              sequence
          Length = 177997

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      aggcatggcaatgacaaaca 21
              ||||||||||||||||||||
Sbjct: 134494 aggcatggcaatgacaaaca 134475


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,044,610
Number of Sequences: 3902068
Number of extensions: 2044610
Number of successful extensions: 36260
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36243
Number of HSP's gapped (non-prelim): 17
length of query: 329
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 307
effective length of database: 17,147,199,772
effective search space: 5264190330004
effective search space used: 5264190330004
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)