ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal22g04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY236227.1| Oryza sativa (indica cultivar-group) alanine amin... 472 e-130
2dbj|AK067732.1| Oryza sativa (japonica cultivar-group) cDNA clon... 472 e-130
3dbj|AK060835.1| Oryza sativa (japonica cultivar-group) cDNA clon... 315 7e-83
4dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 242 9e-61
5dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic D... 242 9e-61
6dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic D... 242 9e-61
7gb|DQ118094.1| Vitis labrusca AlaT1 mRNA, complete cds 100 8e-18
8gb|DQ118095.1| Vitis vinifera AlaT1 mRNA, complete cds 92 2e-15
9gb|DQ226853.1| Boechera divaricarpa isolate SLW-C-D09 mRNA sequence 74 5e-10
10gb|AY109741.1| Zea mays CL1839_2 mRNA sequence 74 5e-10
11ref|NM_102180.2| Arabidopsis thaliana GGT1 (ALANINE-2-OXOGLUTARA... 58 3e-05
12ref|NM_001036006.1| Arabidopsis thaliana GGT1 (ALANINE-2-OXOGLUT... 58 3e-05
13gb|AY150373.1| Arabidopsis thaliana putative alanine aminotransf... 58 3e-05
14gb|AF360195.1| Arabidopsis thaliana putative alanine aminotransf... 58 3e-05
15gb|AY056379.1| Arabidopsis thaliana At1g23310/F26F24_4 mRNA, com... 58 3e-05
16emb|BX814587.1|CNS0AAUD Arabidopsis thaliana Full-length cDNA Co... 58 3e-05
17gb|AF479639.1| Arabidopsis thaliana glutamate:glyoxylate aminotr... 58 3e-05
18gb|AY042902.1| Arabidopsis thaliana alanine aminotransferase-lik... 56 1e-04
19gb|U31975.1|CRU31975 Chlamydomonas reinhardtii alanine aminotran... 54 4e-04
20dbj|AP004918.1| Lotus japonicus genomic DNA, chromosome 2, clone... 52 0.002
21gb|AY058868.1| Arabidopsis thaliana At1g23310/F26F24_4 mRNA, com... 50 0.007
22gb|BT002643.1| Arabidopsis thaliana At1g23310/F26F24_4 gene, com... 50 0.007
23gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana... 48 0.027
24ref|XM_587589.2| PREDICTED: Bos taurus similar to kyphoscoliosis... 44 0.42
25ref|XM_573798.1| PREDICTED: Rattus norvegicus similar to Hypothe... 44 0.42
26ref|XM_515293.1| PREDICTED: Pan troglodytes a disintegrin and me... 42 1.7
27ref|NM_145463.3| Mus musculus transmembrane protein 46 (Tmem46),... 42 1.7
28gb|AC147044.2| Mus musculus BAC clone RP23-106B19 from chromosom... 42 1.7
29gb|AC123534.3| Mus musculus BAC clone RP23-356I5 from chromosome... 42 1.7
30gb|BC057640.1| Mus musculus transmembrane protein 46, mRNA (cDNA... 42 1.7
31gb|AC131961.1| Drosophila pseudoobscura FOSMID DPSF1-548A3 (Chi... 42 1.7
32dbj|AK087512.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 42 1.7
33dbj|AK034905.1| Mus musculus 12 days embryo embryonic body betwe... 42 1.7
34gb|AC080162.7| Homo sapiens BAC clone RP11-400L8 from 2, complet... 42 1.7
35gb|BC024118.1| Mus musculus transmembrane protein 46, mRNA (cDNA... 42 1.7
36gb|AY106411.1| Zea mays PCO106344 mRNA sequence 42 1.7
37gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome 42 1.7
38gb|AC124724.4| Mus musculus BAC clone RP23-446L16 from chromosom... 40 6.6
39ref|XM_537089.2| PREDICTED: Canis familiaris similar to collagen... 40 6.6
40ref|XM_503184.1| Yarrowia lipolytica CLIB122, YALI0D23287g predi... 40 6.6
41emb|AL162591.16| Human DNA sequence from clone RP11-350G8 on chr... 40 6.6
42emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB 40 6.6
43emb|BX571691.13| Zebrafish DNA sequence from clone CH211-142G20 ... 40 6.6
44gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete s... 40 6.6
45ref|XM_681871.1| PREDICTED: Danio rerio similar to Nedd4-binding... 40 6.6
46gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53... 40 6.6
47gb|AC007520.8|AC007520 Drosophila melanogaster, chromosome 2R, r... 40 6.6
48gb|AC108814.22| Mus musculus chromosome 19, clone RP23-235H21, c... 40 6.6
49emb|AJ299420.1|CRU299420 Capsella rubella ORF1 and ORF2 DNA for ... 40 6.6
50emb|AJ328439.1|HSA328439 Homo sapiens genomic sequence surroundi... 40 6.6
51gb|AE003804.4| Drosophila melanogaster chromosome 2R, section 46... 40 6.6
52gb|AC005757.1|AC005757 Homo sapiens chromosome 19, cosmid R32611... 40 6.6
53emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 6.6

>gb|AY236227.1| Oryza sativa (indica cultivar-group) alanine aminotransferase mRNA,
           complete cds
          Length = 1558

 Score =  472 bits (238), Expect = e-130
 Identities = 361/402 (89%)
 Strand = Plus / Plus

                                                                       
Query: 84  gggaggaaggcgctggactacgaggagctcaacgagaacgtcaagaaggtgcagtacgcc 143
           ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 64  gggaggaagccgctggactacgaggagctgaacgagaacgtgaagaaggtgcagtacgcg 123

                                                                       
Query: 144 gtgcgcggcgagctctacctccgcgcatccgagctccagaaggagggcaagaggatcatc 203
           ||||| || ||||| ||||| ||||| ||||||||||||||||||||||||| |||||||
Sbjct: 124 gtgcggggggagctgtacctgcgcgcctccgagctccagaaggagggcaagaagatcatc 183

                                                                       
Query: 204 ttcaccaacgtcggcaacccgcacgccctcggacagaagccactcaccttcccacgccag 263
           |||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 184 ttcaccaacgtcggcaacccacacgcgctcggccagaagccgctcaccttcccccgccag 243

                                                                       
Query: 264 gtggtggcgctctgccaggctcccttcctcctcgatgatcccaacgtcggtctcatcttc 323
           || |||||||| |||||||| |||||||| |||||||||||||||||||| || ||||||
Sbjct: 244 gttgtggcgctgtgccaggcccccttcctgctcgatgatcccaacgtcggccttatcttc 303

                                                                       
Query: 324 cccgccgatgccatcgcaagggccaagcactacctctccctcgcacccggcggcttaggt 383
           |||||||| ||||||||  ||||||||||||||||| || | |||||||| ||  |||||
Sbjct: 304 cccgccgacgccatcgcgcgggccaagcactacctcgccatggcacccggtggactaggt 363

                                                                       
Query: 384 gcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcattcag 443
           || |||||||| |||||||||||||||||  | ||||||||||| |||||||||||  ||
Sbjct: 364 gcttacagtgattcccgaggtatccctggtattaggaaggaagtcgccgagttcatcgag 423

                                                     
Query: 444 aggcgtgatgggtatccgagtgatccagagcttatttacctc 485
           ||||||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 424 aggcgtgatggttatccaagtgatccagaacttatttacctc 465



to top

>dbj|AK067732.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118J02, full
           insert sequence
          Length = 1970

 Score =  472 bits (238), Expect = e-130
 Identities = 361/402 (89%)
 Strand = Plus / Plus

                                                                       
Query: 84  gggaggaaggcgctggactacgaggagctcaacgagaacgtcaagaaggtgcagtacgcc 143
           ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 113 gggaggaagccgctggactacgaggagctgaacgagaacgtgaagaaggtgcagtacgcg 172

                                                                       
Query: 144 gtgcgcggcgagctctacctccgcgcatccgagctccagaaggagggcaagaggatcatc 203
           ||||| || ||||| ||||| ||||| ||||||||||||||||||||||||| |||||||
Sbjct: 173 gtgcggggggagctgtacctgcgcgcctccgagctccagaaggagggcaagaagatcatc 232

                                                                       
Query: 204 ttcaccaacgtcggcaacccgcacgccctcggacagaagccactcaccttcccacgccag 263
           |||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 233 ttcaccaacgtcggcaacccacacgcgctcggccagaagccgctcaccttcccccgccag 292

                                                                       
Query: 264 gtggtggcgctctgccaggctcccttcctcctcgatgatcccaacgtcggtctcatcttc 323
           || |||||||| |||||||| |||||||| |||||||||||||||||||| || ||||||
Sbjct: 293 gttgtggcgctgtgccaggcccccttcctgctcgatgatcccaacgtcggccttatcttc 352

                                                                       
Query: 324 cccgccgatgccatcgcaagggccaagcactacctctccctcgcacccggcggcttaggt 383
           |||||||| ||||||||  ||||||||||||||||| || | |||||||| ||  |||||
Sbjct: 353 cccgccgacgccatcgcgcgggccaagcactacctcgccatggcacccggtggactaggt 412

                                                                       
Query: 384 gcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcattcag 443
           || |||||||| |||||||||||||||||  | ||||||||||| |||||||||||  ||
Sbjct: 413 gcttacagtgattcccgaggtatccctggtattaggaaggaagtcgccgagttcatcgag 472

                                                     
Query: 444 aggcgtgatgggtatccgagtgatccagagcttatttacctc 485
           ||||||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 473 aggcgtgatggttatccaagtgatccagaacttatttacctc 514



to top

>dbj|AK060835.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-C09, full
           insert sequence
          Length = 1581

 Score =  315 bits (159), Expect = 7e-83
 Identities = 252/283 (89%)
 Strand = Plus / Plus

                                                                       
Query: 203 cttcaccaacgtcggcaacccgcacgccctcggacagaagccactcaccttcccacgcca 262
           ||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 1   cttcaccaacgtcggcaacccacacgcgctcggccagaagccgctcaccttcccccgcca 60

                                                                       
Query: 263 ggtggtggcgctctgccaggctcccttcctcctcgatgatcccaacgtcggtctcatctt 322
           ||| |||||||| |||||||| |||||||| |||||||||||||||||||| || |||||
Sbjct: 61  ggttgtggcgctgtgccaggcccccttcctgctcgatgatcccaacgtcggccttatctt 120

                                                                       
Query: 323 ccccgccgatgccatcgcaagggccaagcactacctctccctcgcacccggcggcttagg 382
           ||||||||| ||||||||  ||||||||||||||||| || | |||||||| ||  ||||
Sbjct: 121 ccccgccgacgccatcgcgcgggccaagcactacctcgccatggcacccggtggactagg 180

                                                                       
Query: 383 tgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcattca 442
           ||| |||||||| |||||||||||||||||  | ||||||||||| |||||||||||  |
Sbjct: 181 tgcttacagtgattcccgaggtatccctggtattaggaaggaagtcgccgagttcatcga 240

                                                      
Query: 443 gaggcgtgatgggtatccgagtgatccagagcttatttacctc 485
           |||||||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 241 gaggcgtgatggttatccaagtgatccagaacttatttacctc 283



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score =  242 bits (122), Expect = 9e-61
 Identities = 167/182 (91%)
 Strand = Plus / Minus

                                                                          
Query: 84     gggaggaaggcgctggactacgaggagctcaacgagaacgtcaagaaggtgcagtacgcc 143
              ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 450138 gggaggaagccgctggactacgaggagctgaacgagaacgtgaagaaggtgcagtacgcg 450079

                                                                          
Query: 144    gtgcgcggcgagctctacctccgcgcatccgagctccagaaggagggcaagaggatcatc 203
              ||||| || ||||| ||||| ||||| ||||||||||||||||||||||||| |||||||
Sbjct: 450078 gtgcggggggagctgtacctgcgcgcctccgagctccagaaggagggcaagaagatcatc 450019

                                                                          
Query: 204    ttcaccaacgtcggcaacccgcacgccctcggacagaagccactcaccttcccacgccag 263
              |||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 450018 ttcaccaacgtcggcaacccacacgcgctcggccagaagccgctcaccttcccccgccag 449959

                
Query: 264    gt 265
              ||
Sbjct: 449958 gt 449957



 Score =  129 bits (65), Expect = 9e-27
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                          
Query: 261    caggtggtggcgctctgccaggctcccttcctcctcgatgatcccaacgtcggtctcatc 320
              ||||| |||||||| |||||||| |||||||| |||||||||||||||||||| || |||
Sbjct: 449877 caggttgtggcgctgtgccaggcccccttcctgctcgatgatcccaacgtcggccttatc 449818

                                                                   
Query: 321    ttccccgccgatgccatcgcaagggccaagcactacctctccctcgcacccgg 373
              ||||||||||| ||||||||  ||||||||||||||||| || | ||||||||
Sbjct: 449817 ttccccgccgacgccatcgcgcgggccaagcactacctcgccatggcacccgg 449765



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                          
Query: 380    aggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcat 439
              |||||| |||||||| |||||||||||||||||  | ||||||||||| |||||||||||
Sbjct: 449575 aggtgcttacagtgattcccgaggtatccctggtattaggaaggaagtcgccgagttcat 449516

                                   
Query: 440    tcagaggcgtgatgggtatcc 460
                ||||||||||||| |||||
Sbjct: 449515 cgagaggcgtgatggttatcc 449495



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 462    agtgatccagagcttatttacctc 485
              ||||||||||| ||||||||||||
Sbjct: 449386 agtgatccagaacttatttacctc 449363



to top

>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0585H11
          Length = 149371

 Score =  242 bits (122), Expect = 9e-61
 Identities = 167/182 (91%)
 Strand = Plus / Minus

                                                                         
Query: 84    gggaggaaggcgctggactacgaggagctcaacgagaacgtcaagaaggtgcagtacgcc 143
             ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 52302 gggaggaagccgctggactacgaggagctgaacgagaacgtgaagaaggtgcagtacgcg 52243

                                                                         
Query: 144   gtgcgcggcgagctctacctccgcgcatccgagctccagaaggagggcaagaggatcatc 203
             ||||| || ||||| ||||| ||||| ||||||||||||||||||||||||| |||||||
Sbjct: 52242 gtgcggggggagctgtacctgcgcgcctccgagctccagaaggagggcaagaagatcatc 52183

                                                                         
Query: 204   ttcaccaacgtcggcaacccgcacgccctcggacagaagccactcaccttcccacgccag 263
             |||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 52182 ttcaccaacgtcggcaacccacacgcgctcggccagaagccgctcaccttcccccgccag 52123

               
Query: 264   gt 265
             ||
Sbjct: 52122 gt 52121



 Score =  129 bits (65), Expect = 9e-27
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                         
Query: 261   caggtggtggcgctctgccaggctcccttcctcctcgatgatcccaacgtcggtctcatc 320
             ||||| |||||||| |||||||| |||||||| |||||||||||||||||||| || |||
Sbjct: 52041 caggttgtggcgctgtgccaggcccccttcctgctcgatgatcccaacgtcggccttatc 51982

                                                                  
Query: 321   ttccccgccgatgccatcgcaagggccaagcactacctctccctcgcacccgg 373
             ||||||||||| ||||||||  ||||||||||||||||| || | ||||||||
Sbjct: 51981 ttccccgccgacgccatcgcgcgggccaagcactacctcgccatggcacccgg 51929



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                         
Query: 380   aggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcat 439
             |||||| |||||||| |||||||||||||||||  | ||||||||||| |||||||||||
Sbjct: 51739 aggtgcttacagtgattcccgaggtatccctggtattaggaaggaagtcgccgagttcat 51680

                                  
Query: 440   tcagaggcgtgatgggtatcc 460
               ||||||||||||| |||||
Sbjct: 51679 cgagaggcgtgatggttatcc 51659



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 462   agtgatccagagcttatttacctc 485
             ||||||||||| ||||||||||||
Sbjct: 51550 agtgatccagaacttatttacctc 51527



to top

>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OJ1567_G09
          Length = 121388

 Score =  242 bits (122), Expect = 9e-61
 Identities = 167/182 (91%)
 Strand = Plus / Minus

                                                                        
Query: 84   gggaggaaggcgctggactacgaggagctcaacgagaacgtcaagaaggtgcagtacgcc 143
            ||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 4050 gggaggaagccgctggactacgaggagctgaacgagaacgtgaagaaggtgcagtacgcg 3991

                                                                        
Query: 144  gtgcgcggcgagctctacctccgcgcatccgagctccagaaggagggcaagaggatcatc 203
            ||||| || ||||| ||||| ||||| ||||||||||||||||||||||||| |||||||
Sbjct: 3990 gtgcggggggagctgtacctgcgcgcctccgagctccagaaggagggcaagaagatcatc 3931

                                                                        
Query: 204  ttcaccaacgtcggcaacccgcacgccctcggacagaagccactcaccttcccacgccag 263
            |||||||||||||||||||| ||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 3930 ttcaccaacgtcggcaacccacacgcgctcggccagaagccgctcaccttcccccgccag 3871

              
Query: 264  gt 265
            ||
Sbjct: 3870 gt 3869



 Score =  129 bits (65), Expect = 9e-27
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                        
Query: 261  caggtggtggcgctctgccaggctcccttcctcctcgatgatcccaacgtcggtctcatc 320
            ||||| |||||||| |||||||| |||||||| |||||||||||||||||||| || |||
Sbjct: 3789 caggttgtggcgctgtgccaggcccccttcctgctcgatgatcccaacgtcggccttatc 3730

                                                                 
Query: 321  ttccccgccgatgccatcgcaagggccaagcactacctctccctcgcacccgg 373
            ||||||||||| ||||||||  ||||||||||||||||| || | ||||||||
Sbjct: 3729 ttccccgccgacgccatcgcgcgggccaagcactacctcgccatggcacccgg 3677



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                        
Query: 380  aggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcat 439
            |||||| |||||||| |||||||||||||||||  | ||||||||||| |||||||||||
Sbjct: 3487 aggtgcttacagtgattcccgaggtatccctggtattaggaaggaagtcgccgagttcat 3428

                                 
Query: 440  tcagaggcgtgatgggtatcc 460
              ||||||||||||| |||||
Sbjct: 3427 cgagaggcgtgatggttatcc 3407



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 462  agtgatccagagcttatttacctc 485
            ||||||||||| ||||||||||||
Sbjct: 3298 agtgatccagaacttatttacctc 3275



to top

>gb|DQ118094.1| Vitis labrusca AlaT1 mRNA, complete cds
          Length = 1434

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 239/302 (79%)
 Strand = Plus / Plus

                                                                       
Query: 174 gagctccagaaggagggcaagaggatcatcttcaccaacgtcggcaacccgcacgccctc 233
           ||||| |||||||| || || | ||| || ||||| ||||| |||||||| || || || 
Sbjct: 94  gagcttcagaaggaagggaaaaagattattttcacaaacgtgggcaaccctcatgctcta 153

                                                                       
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcccttcctc 293
           |||||||||||||| || || || ||||||||||| || || ||||| ||||| || || 
Sbjct: 154 ggacagaagccactgacttttcctcgccaggtggttgctctatgccaagctccatttcta 213

                                                                       
Query: 294 ctcgatgatcccaacgtcggtctcatcttccccgccgatgccatcgcaagggccaagcac 353
            | |||||||| || || || ||| | ||||| || ||||| || ||||| || || |||
Sbjct: 214 ttagatgatcctaatgtaggactcgtattcccagcagatgcaattgcaagagctaaacac 273

                                                                       
Query: 354 tacctctccctcgcacccggcggcttaggtgcgtacagtgactcccgaggtatccctggg 413
           ||||| ||  |  |  | || ||  ||||||| || |||||||| |||||| | ||||| 
Sbjct: 274 tacctttcattgactacgggtggtctaggtgcttatagtgactctcgaggtcttcctgga 333

                                                                       
Query: 414 gtcaggaaggaagttgccgagttcattcagaggcgtgatgggtatccgagtgatccagag 473
            | ||||||||||| || |||||||||  |||||||||||||||||| ||||||||||||
Sbjct: 334 ataaggaaggaagtggcagagttcattgggaggcgtgatgggtatccaagtgatccagag 393

             
Query: 474 ct 475
           ||
Sbjct: 394 ct 395



to top

>gb|DQ118095.1| Vitis vinifera AlaT1 mRNA, complete cds
          Length = 1455

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 238/302 (78%)
 Strand = Plus / Plus

                                                                       
Query: 174 gagctccagaaggagggcaagaggatcatcttcaccaacgtcggcaacccgcacgccctc 233
           ||||| |||||||| || || | ||| || ||||| ||||| |||||||| || || || 
Sbjct: 94  gagcttcagaaggaagggaaaaagattattttcacaaacgtgggcaaccctcatgctcta 153

                                                                       
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcccttcctc 293
           |||||||| ||||| || || || ||||||||||| || || ||||| ||||| || || 
Sbjct: 154 ggacagaaaccactgacttttcctcgccaggtggttgctctatgccaagctccatttcta 213

                                                                       
Query: 294 ctcgatgatcccaacgtcggtctcatcttccccgccgatgccatcgcaagggccaagcac 353
            | |||||||| || || || ||| | ||||| || ||||| || ||||| || || |||
Sbjct: 214 ttagatgatcctaatgtaggactcgtattcccagcagatgcaattgcaagagctaaacac 273

                                                                       
Query: 354 tacctctccctcgcacccggcggcttaggtgcgtacagtgactcccgaggtatccctggg 413
           ||||| ||  |  |  | || ||  ||||||| || |||||||| |||||| | ||||| 
Sbjct: 274 tacctttcattgacttcgggtggtctaggtgcttatagtgactctcgaggtcttcctgga 333

                                                                       
Query: 414 gtcaggaaggaagttgccgagttcattcagaggcgtgatgggtatccgagtgatccagag 473
            | ||||||||||| || |||||||||  |||||||||||||||||| ||||||||||||
Sbjct: 334 ataaggaaggaagtggcagagttcattgggaggcgtgatgggtatccaagtgatccagag 393

             
Query: 474 ct 475
           ||
Sbjct: 394 ct 395



to top

>gb|DQ226853.1| Boechera divaricarpa isolate SLW-C-D09 mRNA sequence
          Length = 646

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||||||  |||| || || || || ||||| || ||||| 
Sbjct: 407 ggcggtttaggtgcttacagtgactcaagaggcattccaggagttaggaaagaggttgct 466

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 467 gagttcattcaacggcgtgatgggtatccaagtgacccaga 507



to top

>gb|AY109741.1| Zea mays CL1839_2 mRNA sequence
          Length = 1303

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 74/85 (87%), Gaps = 1/85 (1%)
 Strand = Plus / Minus

                                                                        
Query: 385  cgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttcattcaga 444
            |||||||||||||||| || ||||| ||  ||||||||||||||||||| ||||| || |
Sbjct: 1302 cgtacagtgactcccgcgg-atcccgggaatcaggaaggaagttgccgacttcatccaca 1244

                                     
Query: 445  ggcgtgatgggtatccgagtgatcc 469
             ||||||||| ||||| ||||||||
Sbjct: 1243 agcgtgatggatatcccagtgatcc 1219



to top

>ref|NM_102180.2| Arabidopsis thaliana GGT1 (ALANINE-2-OXOGLUTARATE AMINOTRANSFERASE
           1) AT1G23310 (GGT1) transcript variant AT1G23310.1 mRNA,
           complete cds
          Length = 2052

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 594 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 653

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 654 gagttcattcaacggcgtgatgggtatccaagtgacccaga 694



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 456 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 508



to top

>ref|NM_001036006.1| Arabidopsis thaliana GGT1 (ALANINE-2-OXOGLUTARATE AMINOTRANSFERASE
           1) AT1G23310 (GGT1) transcript variant AT1G23310.2 mRNA,
           complete cds
          Length = 2066

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 628 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 687

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 688 gagttcattcaacggcgtgatgggtatccaagtgacccaga 728



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 490 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 542



to top

>gb|AY150373.1| Arabidopsis thaliana putative alanine aminotransferase (At1g23310)
           mRNA, complete cds
          Length = 1477

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 292 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 351

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 352 gagttcattcaacggcgtgatgggtatccaagtgacccaga 392



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 154 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 206



to top

>gb|AF360195.1| Arabidopsis thaliana putative alanine aminotransferase (At1g23310)
           mRNA, complete cds
          Length = 1768

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 416 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 475

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 476 gagttcattcaacggcgtgatgggtatccaagtgacccaga 516



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 278 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 330



to top

>gb|AY056379.1| Arabidopsis thaliana At1g23310/F26F24_4 mRNA, complete cds
          Length = 1647

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 398 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 457

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 458 gagttcattcaacggcgtgatgggtatccaagtgacccaga 498



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 260 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 312



to top

>emb|BX814587.1|CNS0AAUD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB82ZG03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1707

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 382 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 441

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 442 gagttcattcaacggcgtgatgggtatccaagtgacccaga 482



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 244 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 296



to top

>gb|AF479639.1| Arabidopsis thaliana glutamate:glyoxylate aminotransferase 1 (GGT1)
           mRNA, complete cds
          Length = 1714

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 439 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 498

                                                    
Query: 432 gagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 499 gagttcattcaacggcgtgatgggtatccaagtgacccaga 539



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 301 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 353



to top

>gb|AY042902.1| Arabidopsis thaliana alanine aminotransferase-like protein
           (F26F24.16) mRNA, partial cds
          Length = 1328

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 417 aggaaggaagttgccgagttcattcagaggcgtgatgggtatccgagtgatccaga 472
           ||||| || ||||| |||||||||||  |||||||||||||||| ||||| |||||
Sbjct: 32  aggaaagaggttgctgagttcattcaacggcgtgatgggtatccaagtgacccaga 87



to top

>gb|U31975.1|CRU31975 Chlamydomonas reinhardtii alanine aminotransferase mRNA, complete
           cds
          Length = 2534

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 183 aaggagggcaagaggatcatcttcaccaacgtcggcaacccgcacgc 229
           ||||||||||||  |||||| ||||| |||||||| |||||||||||
Sbjct: 313 aaggagggcaaggagatcattttcacaaacgtcggaaacccgcacgc 359



to top

>dbj|AP004918.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT13I21, TM0076a,
             complete sequence
          Length = 71794

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                         
Query: 379   taggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgccgagttca 438
             ||||||| || ||||||||||||||  | || || || ||| ||||||| || |||||||
Sbjct: 35227 taggtgcttatagtgactcccgaggccttccaggagtgaggcaggaagtggcagagttca 35168

                                   
Query: 439   ttcagaggcgtgatgggtatcc 460
             | || ||||||||||| |||||
Sbjct: 35167 tacaaaggcgtgatggttatcc 35146



to top

>gb|AY058868.1| Arabidopsis thaliana At1g23310/F26F24_4 mRNA, complete cds
          Length = 1762

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 398 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 457

                                        
Query: 432 gagttcattcagaggcgtgatgggtatcc 460
           |||||||||||  ||||||||||||||||
Sbjct: 458 gagttcattcaacggcgtgatgggtatcc 486



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 260 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 312



to top

>gb|BT002643.1| Arabidopsis thaliana At1g23310/F26F24_4 gene, complete cds
          Length = 1446

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 ggcggcttaggtgcgtacagtgactcccgaggtatccctggggtcaggaaggaagttgcc 431
           ||||| |||||||| |||||||| ||  ||||  | || || || ||||| || ||||| 
Sbjct: 292 ggcggtttaggtgcttacagtgattcaagaggccttccaggagttaggaaagaggttgct 351

                                        
Query: 432 gagttcattcagaggcgtgatgggtatcc 460
           |||||||||||  ||||||||||||||||
Sbjct: 352 gagttcattcaacggcgtgatgggtatcc 380



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 234 ggacagaagccactcaccttcccacgccaggtggtggcgctctgccaggctcc 286
           |||||||||||| | || || || ||||||||||| ||||| ||||| |||||
Sbjct: 154 ggacagaagccattgacatttcctcgccaggtggttgcgctttgccaagctcc 206



to top

>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I,
             complete sequence
          Length = 99053

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 417   aggaaggaagttgccgagttcattcagaggcgtgatgggtatcc 460
             ||||| || ||||| |||||||||||  ||||||||||||||||
Sbjct: 46944 aggaaagaggttgctgagttcattcaacggcgtgatgggtatcc 46901



to top

>ref|XM_587589.2| PREDICTED: Bos taurus similar to kyphoscoliosis peptidase
           (LOC510448), partial mRNA
          Length = 766

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 27  ctctgctctgcggcggcgcgccaggg 52
           |||||| |||||||||||||||||||
Sbjct: 307 ctctgcgctgcggcggcgcgccaggg 282



to top

>ref|XM_573798.1| PREDICTED: Rattus norvegicus similar to Hypothetical protein
           BC024118 (LOC498528), mRNA
          Length = 905

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 12  ccccctggggctctgctctgct 33
           ||||||||||||||||||||||
Sbjct: 485 ccccctggggctctgctctgct 464



to top

>ref|XM_515293.1| PREDICTED: Pan troglodytes a disintegrin and metalloproteinase domain
            17 (LOC459018), mRNA
          Length = 2565

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 274  tctgccaggctcccttcctcc 294
            |||||||||||||||||||||
Sbjct: 1833 tctgccaggctcccttcctcc 1853



to top

>ref|NM_145463.3| Mus musculus transmembrane protein 46 (Tmem46), mRNA
          Length = 3144

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 13   cccctggggctctgctctgct 33
            |||||||||||||||||||||
Sbjct: 1230 cccctggggctctgctctgct 1210



to top

>gb|AC147044.2| Mus musculus BAC clone RP23-106B19 from chromosome 14, complete
            sequence
          Length = 181146

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 13   cccctggggctctgctctgct 33
            |||||||||||||||||||||
Sbjct: 1895 cccctggggctctgctctgct 1915



to top

>gb|AC123534.3| Mus musculus BAC clone RP23-356I5 from chromosome 14, complete sequence
          Length = 205222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 13     cccctggggctctgctctgct 33
              |||||||||||||||||||||
Sbjct: 117062 cccctggggctctgctctgct 117082



to top

>gb|BC057640.1| Mus musculus transmembrane protein 46, mRNA (cDNA clone MGC:67809
           IMAGE:4018213), complete cds
          Length = 2740

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 13  cccctggggctctgctctgct 33
           |||||||||||||||||||||
Sbjct: 819 cccctggggctctgctctgct 799



to top

>gb|AC131961.1| Drosophila pseudoobscura  FOSMID DPSF1-548A3 (Children's Hospital
             Oakland Research Institute Drosophila pseudoobscura FOSMID
             Library) complete sequence
          Length = 39990

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    tggggctctgctctgctctgc 37
             |||||||||||||||||||||
Sbjct: 32123 tggggctctgctctgctctgc 32103



to top

>dbj|AK087512.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130308O13 product:hypothetical protein,
            full insert sequence
          Length = 2236

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 13   cccctggggctctgctctgct 33
            |||||||||||||||||||||
Sbjct: 1225 cccctggggctctgctctgct 1205



to top

>dbj|AK034905.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430059P22 product:hypothetical protein, full
            insert sequence
          Length = 3144

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 13   cccctggggctctgctctgct 33
            |||||||||||||||||||||
Sbjct: 1230 cccctggggctctgctctgct 1210



to top

>gb|AC080162.7| Homo sapiens BAC clone RP11-400L8 from 2, complete sequence
          Length = 171653

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 274    tctgccaggctcccttcctcc 294
              |||||||||||||||||||||
Sbjct: 144125 tctgccaggctcccttcctcc 144105



to top

>gb|BC024118.1| Mus musculus transmembrane protein 46, mRNA (cDNA clone MGC:37759
           IMAGE:5068886), complete cds
          Length = 2603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 13  cccctggggctctgctctgct 33
           |||||||||||||||||||||
Sbjct: 691 cccctggggctctgctctgct 671



to top

>gb|AY106411.1| Zea mays PCO106344 mRNA sequence
          Length = 1217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 21 gctctgctctgctctgcggcg 41
          |||||||||||||||||||||
Sbjct: 67 gctctgctctgctctgcggcg 47



to top

>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome
          Length = 2153922

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 209    caacgtcggcaacccgcacgccctc 233
              ||||| |||||||||||||||||||
Sbjct: 788135 caacgacggcaacccgcacgccctc 788159



to top

>gb|AC124724.4| Mus musculus BAC clone RP23-446L16 from chromosome 19, complete sequence
          Length = 179952

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     gctctgctctgctctgcggc 40
              ||||||||||||||||||||
Sbjct: 131321 gctctgctctgctctgcggc 131340



to top

>ref|XM_537089.2| PREDICTED: Canis familiaris similar to collagen, type XXIV, alpha 1
            (LOC479965), mRNA
          Length = 5145

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    acacccttttccccctgggg 21
            ||||||||||||||||||||
Sbjct: 2666 acacccttttccccctgggg 2647



to top

>ref|XM_503184.1| Yarrowia lipolytica CLIB122, YALI0D23287g predicted mRNA
          Length = 4983

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 97   tggactacgaggagctcaacgaga 120
            ||||| ||||||||||||||||||
Sbjct: 3584 tggacgacgaggagctcaacgaga 3607



to top

>emb|AL162591.16| Human DNA sequence from clone RP11-350G8 on chromosome 1 Contains the 3'
              end of the AQP10 gene for aquaporin 10, the ATP8B2 gene for
              ATPase, Class I, type 8B, member 2, a mitochondrial
              ribosomal protein S33 (MRPS33) pseudogene, a novel gene,
              the IL6R gene for interleukin 6 receptor, a proteasome
              (prosome, macropain) 26S subunit, non-ATPase, 8 (PSMD8)
              pseduogene, a novel gene (LOC126669), the 5' end of a novel
              gene (DKFZp434M202) and a CpG island, complete sequence
          Length = 201167

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 14     ccctggggctctgctctgctctgc 37
              |||| |||||||||||||||||||
Sbjct: 180882 cccttgggctctgctctgctctgc 180859



to top

>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB
          Length = 1683333

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 327    gccgatgccatcgcaagggc 346
              ||||||||||||||||||||
Sbjct: 292803 gccgatgccatcgcaagggc 292784



to top

>emb|BX571691.13| Zebrafish DNA sequence from clone CH211-142G20 in linkage group 7,
           complete sequence
          Length = 79440

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 185 ggagggcaagaggatcatct 204
           ||||||||||||||||||||
Sbjct: 736 ggagggcaagaggatcatct 717



to top

>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence
          Length = 117437

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 417   aggaaggaagttgccgagttcattcagaggcgtgatgggtatcc 460
             ||||| ||||| || ||||| || |||||||||||||| |||||
Sbjct: 80405 aggaaagaagtggcagagtttatacagaggcgtgatggttatcc 80362



to top

>ref|XM_681871.1| PREDICTED: Danio rerio similar to Nedd4-binding protein 1 (N4BP1)
           (LOC558641), partial mRNA
          Length = 458

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 ggagggcaagaggatcatct 204
           ||||||||||||||||||||
Sbjct: 216 ggagggcaagaggatcatct 235



to top

>gb|AC099032.1| Drosophila melanogaster, chromosome 2R, region 53F-54A, BAC clone
              BACR32P08, complete sequence
          Length = 163072

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     ggggctctgctctgctctgc 37
              ||||||||||||||||||||
Sbjct: 138034 ggggctctgctctgctctgc 138015



to top

>gb|AC007520.8|AC007520 Drosophila melanogaster, chromosome 2R, region 53D-54A, BAC clone
             BACR11M15, complete sequence
          Length = 170994

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    ggggctctgctctgctctgc 37
             ||||||||||||||||||||
Sbjct: 62201 ggggctctgctctgctctgc 62182



to top

>gb|AC108814.22| Mus musculus chromosome 19, clone RP23-235H21, complete sequence
          Length = 196556

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    gctctgctctgctctgcggc 40
             ||||||||||||||||||||
Sbjct: 25508 gctctgctctgctctgcggc 25527



to top

>emb|AJ299420.1|CRU299420 Capsella rubella ORF1 and ORF2 DNA for hypothetical proteins
          Length = 5138

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 320 cttccccgccgatgccatcg 339
           ||||||||||||||||||||
Sbjct: 434 cttccccgccgatgccatcg 453



to top

>emb|AJ328439.1|HSA328439 Homo sapiens genomic sequence surrounding NotI site, clone
           HSJ4-AD9RS
          Length = 715

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 371 cggcggcttaggtgcgtaca 390
           ||||||||||||||||||||
Sbjct: 11  cggcggcttaggtgcgtaca 30



to top

>gb|AE003804.4| Drosophila melanogaster chromosome 2R, section 46 of 73 of the complete
              sequence
          Length = 260337

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     ggggctctgctctgctctgc 37
              ||||||||||||||||||||
Sbjct: 125326 ggggctctgctctgctctgc 125307



to top

>gb|AC005757.1|AC005757 Homo sapiens chromosome 19, cosmid R32611, complete sequence
          Length = 45929

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 278   ccaggctcccttcctcctcgatga 301
             ||||||||||||||||||| ||||
Sbjct: 30098 ccaggctcccttcctcctccatga 30121



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 97      tggactacgaggagctcaacgaga 120
               ||||| ||||||||||||||||||
Sbjct: 3030212 tggacgacgaggagctcaacgaga 3030235


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,534,116
Number of Sequences: 3902068
Number of extensions: 3534116
Number of successful extensions: 80047
Number of sequences better than 10.0: 53
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79850
Number of HSP's gapped (non-prelim): 196
length of query: 485
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 463
effective length of database: 17,147,199,772
effective search space: 7939153494436
effective search space used: 7939153494436
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top