Clone Name	baal22f10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	143	5e-31
2	gb|AC146619.1| Genomic sequence for Oryza sativa, Nipponbare str...	143	5e-31
3	gb|AC134241.2| Oryza sativa (japonica cultivar-group) chromosome...	143	5e-31
4	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	143	5e-31
5	gb|BT024025.1| Zea mays clone EL01N0417D02 mRNA sequence	54	3e-04
6	gb|AC137529.3| Carollia perspicillata clone 6M17, complete sequence	46	0.082
7	gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold	46	0.082
8	gb|AY656992.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
9	gb|AY656991.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
10	gb|AF396844.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
11	gb|AF396843.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
12	gb|AF396842.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
13	gb|AY545985.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
14	ref|NM_013385.2| Homo sapiens pleckstrin homology, Sec7 and coil...	44	0.32
15	gb|DQ494267.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
16	gb|AY424271.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
17	gb|AY318772.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
18	gb|AY318771.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
19	gb|AY318770.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
20	gb|AY318769.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
21	gb|AY318768.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
22	gb|AY318767.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
23	gb|AY318766.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
24	gb|DQ478397.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
25	gb|DQ478390.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
26	gb|DQ478349.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
27	gb|DQ478330.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
28	gb|DQ478297.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
29	gb|DQ478288.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
30	gb|DQ478285.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
31	gb|DQ478255.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
32	gb|DQ478241.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
33	gb|DQ478199.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
34	gb|DQ478173.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
35	gb|DQ478153.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
36	gb|DQ478152.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
37	gb|DQ478145.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
38	gb|DQ478133.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
39	gb|DQ478123.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
40	gb|DQ478098.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
41	gb|DQ478097.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
42	gb|DQ478074.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
43	gb|DQ478037.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
44	gb|DQ478018.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
45	gb|DQ477997.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
46	gb|DQ477977.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
47	gb|DQ477961.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
48	gb|DQ477952.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
49	gb|DQ477950.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
50	gb|DQ477948.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
51	gb|DQ477940.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
52	gb|DQ477937.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
53	gb|DQ477930.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
54	gb|DQ477922.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
55	gb|DQ477898.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
56	gb|DQ477806.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
57	gb|DQ477796.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
58	gb|DQ477625.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
59	gb|DQ477613.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
60	gb|DQ477442.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
61	gb|DQ477317.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
62	gb|DQ477272.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
63	gb|DQ477246.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
64	gb|DQ477239.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
65	gb|DQ477197.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
66	gb|DQ477189.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
67	gb|DQ477184.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
68	gb|DQ477165.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
69	gb|DQ477157.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
70	gb|DQ477146.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
71	gb|DQ477132.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
72	gb|DQ477128.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
73	gb|DQ477121.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
74	gb|DQ477109.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
75	gb|DQ477091.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
76	gb|DQ477082.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
77	gb|DQ477067.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
78	gb|DQ477024.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
79	gb|DQ477018.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
80	gb|DQ476905.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
81	gb|DQ476887.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
82	gb|DQ476867.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
83	gb|DQ476845.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
84	gb|DQ476840.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
85	gb|DQ476839.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
86	gb|DQ476809.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
87	gb|DQ476766.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
88	gb|DQ476763.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
89	gb|DQ476760.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
90	gb|DQ476722.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
91	gb|DQ476720.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
92	gb|DQ476699.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
93	gb|DQ476683.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
94	gb|DQ476678.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
95	gb|DQ476669.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
96	gb|DQ476642.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
97	gb|DQ476641.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
98	gb|DQ476634.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
99	gb|DQ476621.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
100	gb|DQ476611.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
101	gb|DQ476603.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
102	gb|DQ476594.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
103	gb|DQ476581.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
104	gb|DQ476563.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
105	gb|DQ476541.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
106	gb|DQ476533.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
107	gb|DQ476529.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
108	gb|DQ476518.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
109	gb|DQ476512.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
110	gb|DQ476496.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
111	gb|DQ476487.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
112	gb|DQ476460.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
113	gb|DQ476456.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
114	gb|DQ476452.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
115	gb|DQ476448.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
116	gb|DQ476439.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
117	gb|DQ476437.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
118	gb|DQ476416.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
119	gb|DQ476412.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
120	gb|DQ476394.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
121	gb|DQ476387.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
122	gb|DQ476376.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
123	gb|DQ476375.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
124	gb|DQ476371.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
125	gb|DQ476369.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
126	gb|DQ476350.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
127	gb|DQ476338.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
128	gb|DQ476329.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
129	gb|DQ476322.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
130	gb|DQ476314.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
131	gb|DQ476296.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
132	gb|DQ476285.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
133	gb|DQ476257.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
134	gb|DQ476247.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
135	gb|DQ476245.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
136	gb|DQ476238.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
137	gb|DQ476236.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
138	gb|DQ476196.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
139	gb|DQ476185.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
140	gb|DQ476168.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
141	gb|DQ476158.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
142	gb|DQ476138.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
143	gb|DQ476124.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
144	gb|DQ476114.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
145	gb|DQ476106.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
146	gb|DQ476101.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
147	gb|DQ476086.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
148	gb|DQ476037.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
149	gb|DQ475972.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
150	gb|DQ475959.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
151	gb|DQ475942.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
152	gb|DQ475941.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
153	gb|DQ475937.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
154	gb|DQ475922.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
155	gb|DQ475913.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
156	gb|DQ475912.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
157	gb|DQ475908.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
158	gb|DQ475904.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
159	gb|DQ475890.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
160	gb|DQ475887.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
161	gb|DQ475882.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
162	gb|DQ475847.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
163	gb|DQ475841.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
164	gb|DQ475840.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
165	gb|DQ475839.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
166	gb|DQ475834.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
167	gb|DQ475827.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
168	gb|DQ475820.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
169	gb|DQ475810.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
170	gb|DQ475800.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
171	gb|DQ475798.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
172	gb|DQ475748.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
173	gb|DQ475745.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
174	gb|DQ475731.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
175	gb|DQ475714.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
176	gb|DQ475700.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
177	gb|DQ475689.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
178	gb|DQ475687.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
179	gb|DQ475548.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
180	gb|DQ475519.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
181	gb|DQ475513.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
182	gb|DQ475507.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
183	gb|DQ475504.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
184	gb|DQ475499.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
185	gb|DQ475448.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
186	gb|DQ475436.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
187	gb|DQ475390.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
188	gb|DQ475353.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
189	gb|DQ475342.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
190	gb|DQ475208.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
191	gb|DQ475173.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
192	gb|DQ475103.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
193	gb|DQ475100.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
194	gb|DQ475060.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
195	gb|DQ475058.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
196	gb|DQ475056.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
197	gb|DQ475050.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
198	gb|DQ475049.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
199	gb|DQ474989.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
200	gb|DQ474977.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
201	gb|DQ474975.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
202	gb|DQ474939.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
203	gb|DQ474931.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
204	gb|DQ474916.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
205	gb|DQ474914.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
206	gb|DQ474910.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
207	gb|DQ474908.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
208	gb|DQ474903.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
209	gb|DQ474853.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
210	gb|DQ474804.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
211	gb|DQ474762.1| Porcine respiratory and reproductive syndrome vir...	44	0.32
212	emb|Z94160.1|HS63G5 Human DNA sequence from clone RP1-63G5 on ch...	44	0.32
213	gb|BC033693.1| Homo sapiens pleckstrin homology, Sec7 and coiled...	44	0.32
214	gb|AF537950.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
215	gb|AF537949.1| Porcine reproductive and respiratory syndrome vir...	44	0.32
216	emb|CR626739.1| full-length cDNA clone CS0DI044YH21 of Placenta ...	44	0.32
217	emb|CR610000.1| full-length cDNA clone CS0DL005YC05 of B cells (...	44	0.32
218	emb|CR604959.1| full-length cDNA clone CS0DI071YO15 of Placenta ...	44	0.32
219	emb|CR597077.1| full-length cDNA clone CS0DJ002YI06 of T cells (...	44	0.32
220	dbj|AK002145.1| Homo sapiens cDNA FLJ11283 fis, clone PLACE10095...	44	0.32
221	dbj|AB175717.1| Porcine respiratory and reproductive syndrome vi...	44	0.32
222	dbj|AB175714.1| Porcine respiratory and reproductive syndrome vi...	44	0.32
223	dbj|AK024428.1| Homo sapiens mRNA for FLJ00017 protein, partial cds	44	0.32
224	gb|AF075458.1|AF075458 Homo sapiens cytohesin-4 (CYT4) mRNA, com...	44	0.32
225	gb|BC041161.1| Homo sapiens pleckstrin homology, Sec7 and coiled...	44	0.32
226	dbj|AB023782.1| Porcine reproductive and respiratory syndrome vi...	44	0.32
227	gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome	42	1.3
228	gb|DQ478130.1| Porcine respiratory and reproductive syndrome vir...	42	1.3
229	gb|DQ478036.1| Porcine respiratory and reproductive syndrome vir...	42	1.3
230	gb|DQ476979.1| Porcine respiratory and reproductive syndrome vir...	42	1.3
231	gb|DQ475323.1| Porcine respiratory and reproductive syndrome vir...	42	1.3
232	gb|AC122726.21| Medicago truncatula clone mth2-23o24, complete s...	42	1.3
233	emb|AL513366.11| Human DNA sequence from clone CTD-2522E6 on chr...	42	1.3
234	emb|AL031587.3|HS1039K5 Human DNA sequence from clone RP5-1039K5...	42	1.3
235	emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome...	42	1.3
236	emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 compl...	42	1.3
237	emb|CR860972.1| Pongo pygmaeus mRNA; cDNA DKFZp459P0527 (from cl...	42	1.3
238	gb|AF006501.4| Homo sapiens chromosome 22q13.1 Cosmid Clone c115...	42	1.3
239	emb|BX842567.2| Mouse DNA sequence from clone RP23-340H9 on chro...	42	1.3
240	dbj|AK110353.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.3
241	dbj|AP003040.2| Homo sapiens genomic DNA, chromosome 11q clone:R...	42	1.3
242	gb|DQ246451.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
243	gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, comp...	40	5.1
244	gb|AC135417.3| Oryza sativa (japonica cultivar-group) chromosome...	40	5.1
245	ref|XM_960617.1| Neurospora crassa OR74A hypothetical protein (N...	40	5.1
246	gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome ...	40	5.1
247	ref|XM_331777.1| Neurospora crassa OR74A hypothetical protein (N...	40	5.1
248	gb|DQ181609.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
249	gb|DQ181608.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
250	gb|DQ181607.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
251	gb|DQ181606.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
252	gb|DQ181603.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
253	gb|DQ181602.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
254	gb|DQ181601.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
255	gb|DQ181600.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
256	gb|DQ181599.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
257	gb|DQ181598.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
258	gb|DQ181596.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
259	gb|DQ181593.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
260	gb|DQ181591.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
261	gb|DQ494276.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
262	gb|DQ494275.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
263	gb|BT012675.1| Drosophila melanogaster RH57795 full insert cDNA	40	5.1
264	gb|DQ168640.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
265	gb|AC108909.15| Mus musculus chromosome 3, clone RP24-245I16, co...	40	5.1
266	gb|AC132402.3| Mus musculus BAC clone RP23-404I24 from chromosom...	40	5.1
267	gb|AC127563.4| Mus musculus BAC clone RP24-283E13 from chromosom...	40	5.1
268	gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, compl...	40	5.1
269	gb|DQ478386.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
270	gb|DQ478378.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
271	gb|DQ478374.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
272	gb|DQ478372.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
273	gb|DQ478367.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
274	gb|DQ478363.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
275	gb|DQ478362.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
276	gb|DQ478351.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
277	gb|DQ478344.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
278	gb|DQ478334.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
279	gb|DQ478333.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
280	gb|DQ478329.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
281	gb|DQ478314.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
282	gb|DQ478313.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
283	gb|DQ478309.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
284	gb|DQ478302.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
285	gb|DQ478300.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
286	gb|DQ478296.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
287	gb|DQ478287.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
288	gb|DQ478259.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
289	gb|DQ478256.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
290	gb|DQ478252.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
291	gb|DQ478227.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
292	gb|DQ478226.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
293	gb|DQ478223.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
294	gb|DQ478220.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
295	gb|DQ478217.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
296	gb|DQ478216.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
297	gb|DQ478214.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
298	gb|DQ478213.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
299	gb|DQ478203.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
300	gb|DQ478193.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
301	gb|DQ478175.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
302	gb|DQ478157.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
303	gb|DQ478156.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
304	gb|DQ478143.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
305	gb|DQ478121.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
306	gb|DQ478114.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
307	gb|DQ478111.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
308	gb|DQ478093.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
309	gb|DQ478092.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
310	gb|DQ478080.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
311	gb|DQ478077.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
312	gb|DQ478056.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
313	gb|DQ478047.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
314	gb|DQ478044.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
315	gb|DQ478033.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
316	gb|DQ478032.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
317	gb|DQ478024.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
318	gb|DQ478016.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
319	gb|DQ478009.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
320	gb|DQ478003.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
321	gb|DQ477989.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
322	gb|DQ477983.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
323	gb|DQ477982.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
324	gb|DQ477979.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
325	gb|DQ477978.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
326	gb|DQ477974.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
327	gb|DQ477973.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
328	gb|DQ477966.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
329	gb|DQ477957.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
330	gb|DQ477939.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
331	gb|DQ477808.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
332	gb|DQ477793.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
333	gb|DQ477787.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
334	gb|DQ477768.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
335	gb|DQ477752.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
336	gb|DQ477732.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
337	gb|DQ477716.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
338	gb|DQ477708.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
339	gb|DQ477515.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
340	gb|DQ477512.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
341	gb|DQ477395.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
342	gb|DQ477230.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
343	gb|DQ477229.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
344	gb|DQ477200.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
345	gb|DQ477190.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
346	gb|DQ477176.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
347	gb|DQ477170.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
348	gb|DQ477166.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
349	gb|DQ477151.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
350	gb|DQ477142.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
351	gb|DQ477141.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
352	gb|DQ477140.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
353	gb|DQ477127.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
354	gb|DQ477126.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
355	gb|DQ477119.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
356	gb|DQ477117.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
357	gb|DQ477114.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
358	gb|DQ477113.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
359	gb|DQ477112.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
360	gb|DQ477096.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
361	gb|DQ477092.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
362	gb|DQ477086.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
363	gb|DQ477085.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
364	gb|DQ477081.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
365	gb|DQ477070.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
366	gb|DQ477068.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
367	gb|DQ477056.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
368	gb|DQ477043.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
369	gb|DQ477033.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
370	gb|DQ477027.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
371	gb|DQ477021.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
372	gb|DQ477013.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
373	gb|DQ477012.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
374	gb|DQ477000.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
375	gb|DQ476990.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
376	gb|DQ476983.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
377	gb|DQ476981.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
378	gb|DQ476967.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
379	gb|DQ476964.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
380	gb|DQ476952.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
381	gb|DQ476949.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
382	gb|DQ476947.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
383	gb|DQ476940.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
384	gb|DQ476918.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
385	gb|DQ476917.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
386	gb|DQ476914.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
387	gb|DQ476910.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
388	gb|DQ476896.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
389	gb|DQ476895.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
390	gb|DQ476884.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
391	gb|DQ476881.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
392	gb|DQ476870.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
393	gb|DQ476861.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
394	gb|DQ476853.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
395	gb|DQ476851.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
396	gb|DQ476850.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
397	gb|DQ476843.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
398	gb|DQ476841.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
399	gb|DQ476836.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
400	gb|DQ476813.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
401	gb|DQ476808.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
402	gb|DQ476785.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
403	gb|DQ476749.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
404	gb|DQ476737.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
405	gb|DQ476733.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
406	gb|DQ476705.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
407	gb|DQ476702.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
408	gb|DQ476696.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
409	gb|DQ476684.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
410	gb|DQ476677.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
411	gb|DQ476672.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
412	gb|DQ476661.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
413	gb|DQ476660.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
414	gb|DQ476640.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
415	gb|DQ476633.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
416	gb|DQ476616.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
417	gb|DQ476583.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
418	gb|DQ476582.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
419	gb|DQ476560.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
420	gb|DQ476550.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
421	gb|DQ476545.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
422	gb|DQ476543.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
423	gb|DQ476521.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
424	gb|DQ476486.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
425	gb|DQ476477.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
426	gb|DQ476471.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
427	gb|DQ476470.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
428	gb|DQ476468.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
429	gb|DQ476458.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
430	gb|DQ476457.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
431	gb|DQ476450.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
432	gb|DQ476449.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
433	gb|DQ476440.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
434	gb|DQ476431.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
435	gb|DQ476428.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
436	gb|DQ476419.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
437	gb|DQ476418.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
438	gb|DQ476381.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
439	gb|DQ476374.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
440	gb|DQ476363.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
441	gb|DQ476319.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
442	gb|DQ476313.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
443	gb|DQ476274.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
444	gb|DQ476234.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
445	gb|DQ476233.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
446	gb|DQ476226.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
447	gb|DQ476217.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
448	gb|DQ476210.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
449	gb|DQ476204.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
450	gb|DQ476195.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
451	gb|DQ476190.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
452	gb|DQ476162.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
453	gb|DQ476146.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
454	gb|DQ476140.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
455	gb|DQ476125.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
456	gb|DQ476119.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
457	gb|DQ476116.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
458	gb|DQ476107.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
459	gb|DQ476100.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
460	gb|DQ476069.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
461	gb|DQ476011.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
462	gb|DQ476008.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
463	gb|DQ476003.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
464	gb|DQ476000.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
465	gb|DQ475993.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
466	gb|DQ475963.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
467	gb|DQ475936.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
468	gb|DQ475917.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
469	gb|DQ475916.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
470	gb|DQ475903.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
471	gb|DQ475878.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
472	gb|DQ475876.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
473	gb|DQ475842.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
474	gb|DQ475828.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
475	gb|DQ475822.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
476	gb|DQ475816.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
477	gb|DQ475811.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
478	gb|DQ475805.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
479	gb|DQ475804.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
480	gb|DQ475785.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
481	gb|DQ475783.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
482	gb|DQ475780.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
483	gb|DQ475779.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
484	gb|DQ475770.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
485	gb|DQ475755.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
486	gb|DQ475746.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
487	gb|DQ475733.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
488	gb|DQ475719.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
489	gb|DQ475699.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
490	gb|DQ475643.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
491	gb|DQ475605.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
492	gb|DQ475604.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
493	gb|DQ475581.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
494	gb|DQ475578.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
495	gb|DQ475575.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
496	gb|DQ475552.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
497	gb|DQ475547.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
498	gb|DQ475539.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
499	gb|DQ475532.1| Porcine respiratory and reproductive syndrome vir...	40	5.1
500	gb|DQ475524.1| Porcine respiratory and reproductive syndrome vir...	40	5.1

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                           
Query: 169     ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 228
               |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 5868450 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 5868509

                                                                           
Query: 229     gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 288
               ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 5868510 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 5868569

                                   
Query: 289     gtcaacgccaacctctcccg 308
               ||||||||| ||||||||||
Sbjct: 5868570 gtcaacgcccacctctcccg 5868589



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                           
Query: 313     tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 372
               |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 5868714 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 5868773

                   
Query: 373     agcg 376
               ||||
Sbjct: 5868774 agcg 5868777

---

>gb|AC146619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNAa0021B21, from chromosome 3, complete sequence
          Length = 139208

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                         
Query: 169   ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 228
             |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 97280 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 97339

                                                                         
Query: 229   gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 288
             ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 97340 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 97399

                                 
Query: 289   gtcaacgccaacctctcccg 308
             ||||||||| ||||||||||
Sbjct: 97400 gtcaacgcccacctctcccg 97419



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 313   tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 372
             |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 97544 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 97603

                 
Query: 373   agcg 376
             ||||
Sbjct: 97604 agcg 97607

---

>gb|AC134241.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0085F02, complete sequence
          Length = 128535

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                         
Query: 169   ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 228
             |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 18072 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 18131

                                                                         
Query: 229   gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 288
             ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 18132 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 18191

                                 
Query: 289   gtcaacgccaacctctcccg 308
             ||||||||| ||||||||||
Sbjct: 18192 gtcaacgcccacctctcccg 18211



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 313   tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 372
             |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 18336 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 18395

                 
Query: 373   agcg 376
             ||||
Sbjct: 18396 agcg 18399

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  143 bits (72), Expect = 5e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                           
Query: 169     ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 228
               |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 5867663 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 5867722

                                                                           
Query: 229     gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 288
               ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 5867723 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 5867782

                                   
Query: 289     gtcaacgccaacctctcccg 308
               ||||||||| ||||||||||
Sbjct: 5867783 gtcaacgcccacctctcccg 5867802



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                           
Query: 313     tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 372
               |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 5867927 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 5867986

                   
Query: 373     agcg 376
               ||||
Sbjct: 5867987 agcg 5867990

---

>gb|BT024025.1| Zea mays clone EL01N0417D02 mRNA sequence
          Length = 1565

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 283 gcgctcgtcaacgccaacctctcccgtggttacatgccagggatggatttgggagtgctc 342
           ||||||||||||| | |||||||| |  |  |||||||   |||||||||||| ||||||
Sbjct: 561 gcgctcgtcaacgtccacctctcctgcaggaacatgccgacgatggatttgggggtgctc 620

                                  
Query: 343 aaggacatgcccaggatccgcga 365
           ||||| |||||  ||||||||||
Sbjct: 621 aaggatatgccggggatccgcga 643

---

>gb|AC137529.3| Carollia perspicillata clone 6M17, complete sequence
          Length = 118381

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 134   cctcctccccatccccaaccccg 156
             |||||||||||||||||||||||
Sbjct: 71013 cctcctccccatccccaaccccg 71035

---

>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold
          Length = 1501503

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 134    cctcctccccatccccaaccccg 156
              |||||||||||||||||||||||
Sbjct: 518665 cctcctccccatccccaaccccg 518687

---

>gb|AY656992.1| Porcine reproductive and respiratory syndrome virus isolate MN-184
           glycoprotein 5 (ORF5) gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY656991.1| Porcine reproductive and respiratory syndrome virus strain Ingelvac
           ATP glycoprotein 5 (ORF5) gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AF396844.1| Porcine reproductive and respiratory syndrome virus isolate JA-142
            (252p) GP2 glycoprotein, GP3 glycoprotein, GP4
            glycoprotein, GP5 glycosylated envelope protein, membrane
            protein, and nucleocapsid protein mRNAs, complete cds
          Length = 3188

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 279  tgctgcgctcgtcaacgccaac 300
            ||||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811

---

>gb|AF396843.1| Porcine reproductive and respiratory syndrome virus isolate JA-142
            (251) GP2 glycoprotein, GP3 glycoprotein, GP4
            glycoprotein, GP5 glycosylated envelope protein, membrane
            protein, and nucleocapsid protein mRNAs, complete cds
          Length = 3188

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 279  tgctgcgctcgtcaacgccaac 300
            ||||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811

---

>gb|AF396842.1| Porcine reproductive and respiratory syndrome virus isolate JA-142
            (E) GP2 glycoprotein, GP3 glycoprotein, GP4 glycoprotein,
            GP5 glycosylated envelope protein, membrane protein, and
            nucleocapsid protein mRNAs, complete cds
          Length = 3188

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 279  tgctgcgctcgtcaacgccaac 300
            ||||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811

---

>gb|AY545985.1| Porcine reproductive and respiratory syndrome virus strain NVSL
             97-7895, complete genome
          Length = 15414

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 279   tgctgcgctcgtcaacgccaac 300
             ||||||||||||||||||||||
Sbjct: 13864 tgctgcgctcgtcaacgccaac 13885

---

>ref|NM_013385.2| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4
            (PSCD4), mRNA
          Length = 3221

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 2361 tttctggctcagccactgcctc 2340

---

>gb|DQ494267.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004571 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY424271.1| Porcine reproductive and respiratory syndrome virus strain JA142,
             complete genome
          Length = 15413

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 279   tgctgcgctcgtcaacgccaac 300
             ||||||||||||||||||||||
Sbjct: 13864 tgctgcgctcgtcaacgccaac 13885

---

>gb|AY318772.1| Porcine reproductive and respiratory syndrome virus A7 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY318771.1| Porcine reproductive and respiratory syndrome virus A6 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY318770.1| Porcine reproductive and respiratory syndrome virus A5 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY318769.1| Porcine reproductive and respiratory syndrome virus A4 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY318768.1| Porcine reproductive and respiratory syndrome virus A3 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY318767.1| Porcine reproductive and respiratory syndrome virus A2 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|AY318766.1| Porcine reproductive and respiratory syndrome virus A1 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478397.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004550 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478390.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004541 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478349.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004488 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478330.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004464 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478297.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004424 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478288.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004415 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478285.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004411 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478255.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004380 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478241.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004358 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478199.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004312 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478173.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004277 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478153.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004253 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478152.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004252 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478145.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004245 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478133.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004229 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478123.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004219 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478098.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004182 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478097.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004181 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478074.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004154 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478037.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004108 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ478018.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004077 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477997.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004047 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477977.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004022 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477961.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003994 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477952.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003983 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477950.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003981 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477948.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003978 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477940.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003970 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477937.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003966 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477930.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003954 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477922.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003940 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477898.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003905 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477806.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003793 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477796.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003782 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477625.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003583 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477613.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003568 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477442.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003357 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477317.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003193 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477272.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003143 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477246.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003112 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477239.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003105 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477197.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003055 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477189.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003043 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477184.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003032 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477165.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003007 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477157.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002995 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477146.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002983 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477132.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002961 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477128.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002957 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477121.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002950 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477109.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002938 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477091.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002919 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477082.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002910 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477067.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002893 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477024.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002839 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ477018.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002831 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476905.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002686 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476887.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002665 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476867.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002644 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476845.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002620 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476840.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002614 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476839.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002613 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476809.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002580 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476766.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002525 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476763.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002521 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476760.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002516 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476722.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002464 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476720.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002462 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476699.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002436 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476683.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002413 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476678.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002408 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476669.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002398 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476642.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002367 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476641.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002366 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476634.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002359 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476621.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002344 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476611.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002332 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476603.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002320 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476594.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002309 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476581.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002295 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476563.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002273 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476541.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002244 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476533.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002236 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476529.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002232 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476518.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002218 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476512.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002212 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476496.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002196 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476487.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002186 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476460.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002153 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476456.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002149 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476452.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002145 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476448.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002141 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476439.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002132 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476437.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002129 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476416.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002103 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476412.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002099 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476394.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002081 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476387.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002074 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476376.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002062 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476375.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002061 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476371.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002057 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476369.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002055 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476350.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002029 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476338.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002014 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476329.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001997 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476322.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001987 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476314.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001976 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476296.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001951 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476285.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001929 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476257.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001869 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476247.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001857 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476245.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001855 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476238.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001848 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476236.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001846 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476196.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001798 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476185.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001783 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476168.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001759 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476158.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001743 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476138.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001717 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476124.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001702 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476114.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001686 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476106.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001676 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476101.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001670 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476086.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001652 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ476037.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001594 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475972.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001517 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475959.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001499 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475942.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001476 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475941.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001475 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475937.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001468 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475922.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001451 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475913.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001440 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475912.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001439 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475908.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001435 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475904.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001431 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475890.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001413 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475887.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001410 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475882.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001405 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475847.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001359 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475841.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001352 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475840.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001350 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475839.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001348 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475834.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001342 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475827.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001334 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475820.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001325 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475810.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001314 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475800.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001299 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475798.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001297 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475748.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001229 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475745.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001226 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475731.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001210 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475714.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001192 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475700.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001176 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475689.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001164 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475687.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001161 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475548.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001001 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475519.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000965 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475513.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000958 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475507.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000949 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475504.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000945 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475499.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000940 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475448.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000872 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475436.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000853 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475390.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000800 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475353.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000750 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475342.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000735 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475208.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000575 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475173.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000528 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475103.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000441 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475100.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000434 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475060.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000380 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475058.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000378 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475056.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000376 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475050.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000366 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ475049.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000364 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474989.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000286 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474977.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000274 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474975.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000272 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474939.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000224 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474931.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000213 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474916.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000186 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474914.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000184 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474910.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000179 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474908.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000176 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474903.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000170 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474853.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000116 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474804.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000047 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>gb|DQ474762.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000002 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>emb|Z94160.1|HS63G5 Human DNA sequence from clone RP1-63G5 on chromosome 22q12.3-13.1,
             complete sequence
          Length = 97585

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 20    tttctggctcagccactgcctc 41
             ||||||||||||||||||||||
Sbjct: 34091 tttctggctcagccactgcctc 34070

---

>gb|BC033693.1| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4,
            mRNA (cDNA clone IMAGE:5213325), with apparent retained
            intron
          Length = 3695

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 2824 tttctggctcagccactgcctc 2803

---

>gb|AF537950.1| Porcine reproductive and respiratory syndrome virus isolate ATP
           envelope glycoprotein gene, partial cds
          Length = 556

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 54  tgctgcgctcgtcaacgccaac 75

---

>gb|AF537949.1| Porcine reproductive and respiratory syndrome virus isolate JA142
           envelope glycoprotein gene, partial cds
          Length = 556

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 54  tgctgcgctcgtcaacgccaac 75

---

>emb|CR626739.1| full-length cDNA clone CS0DI044YH21 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 3011

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 2200 tttctggctcagccactgcctc 2179

---

>emb|CR610000.1| full-length cDNA clone CS0DL005YC05 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 3052

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 2245 tttctggctcagccactgcctc 2224

---

>emb|CR604959.1| full-length cDNA clone CS0DI071YO15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1339

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 20  tttctggctcagccactgcctc 41
           ||||||||||||||||||||||
Sbjct: 528 tttctggctcagccactgcctc 507

---

>emb|CR597077.1| full-length cDNA clone CS0DJ002YI06 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 2043

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 1221 tttctggctcagccactgcctc 1200

---

>dbj|AK002145.1| Homo sapiens cDNA FLJ11283 fis, clone PLACE1009524, moderately
            similar to ARF NUCLEOTIDE-BINDING SITE OPENER
          Length = 2516

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 1677 tttctggctcagccactgcctc 1656

---

>dbj|AB175717.1| Porcine respiratory and reproductive syndrome virus gene for
           envelope glycoprotein GP5, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>dbj|AB175714.1| Porcine respiratory and reproductive syndrome virus gene for
           envelope glycoprotein GP5, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 279 tgctgcgctcgtcaacgccaac 300
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

---

>dbj|AK024428.1| Homo sapiens mRNA for FLJ00017 protein, partial cds
          Length = 4459

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 3620 tttctggctcagccactgcctc 3599

---

>gb|AF075458.1|AF075458 Homo sapiens cytohesin-4 (CYT4) mRNA, complete cds
          Length = 3150

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 2290 tttctggctcagccactgcctc 2269

---

>gb|BC041161.1| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4,
            mRNA (cDNA clone MGC:48780 IMAGE:5745783), complete cds
          Length = 3164

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 20   tttctggctcagccactgcctc 41
            ||||||||||||||||||||||
Sbjct: 2219 tttctggctcagccactgcctc 2198

---

>dbj|AB023782.1| Porcine reproductive and respiratory syndrome virus ORF 2 to 7 genes,
            partial and complete cds, strain:Kitasato 93-1
          Length = 3065

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 279  tgctgcgctcgtcaacgccaac 300
            ||||||||||||||||||||||
Sbjct: 1502 tgctgcgctcgtcaacgccaac 1523

---

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 240    ccggtggctggccgccaccgc 260
              |||||||||||||||||||||
Sbjct: 964124 ccggtggctggccgccaccgc 964104

---

>gb|DQ478130.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004226 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 279 tgctgcgctcgtcaacgccaa 299
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

---

>gb|DQ478036.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004107 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 279 tgctgcgctcgtcaacgccaa 299
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

---

>gb|DQ476979.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002781 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 279 tgctgcgctcgtcaacgccaa 299
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

---

>gb|DQ475323.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000714 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 279 tgctgcgctcgtcaacgccaa 299
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

---

>gb|AC122726.21| Medicago truncatula clone mth2-23o24, complete sequence
          Length = 130999

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 1      tggcccactctattatttgtttctggctcagccactg 37
              ||||||||||||  |||| |||||||||| |||||||
Sbjct: 117386 tggcccactctaacatttttttctggctccgccactg 117350

---

>emb|AL513366.11| Human DNA sequence from clone CTD-2522E6 on chromosome X Contains the
             RGN gene for regucalcin (senescence marker protein-30)
             (RC, SMP30), the gene for neuronal protein 17.3 (P17.3),
             the RBM10 gene for RNA binding motif protein 10 (MGC997,
             MGC1132, DXS8237E, KIAA0122), an inositol
             1,3,4-triphosphate 5/6 kinase (ITPK1) pseudogene, the UBE1
             gene for ubiquitin-activating enzyme E1 (A1S9T and BN75
             temperature sensitivity complementing) (A1S9, A1ST, GXP1,
             A1S9T, UBE1X, MGC4781), the 5' UTR of the PCTK1 gene for
             PCTAIRE protein kinase 1 and five CpG islands, complete
             sequence
          Length = 145456

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 134   cctcctccccatccccaaccc 154
             |||||||||||||||||||||
Sbjct: 24033 cctcctccccatccccaaccc 24053

---

>emb|AL031587.3|HS1039K5 Human DNA sequence from clone RP5-1039K5 on chromosome 22q12.3-13.2,
             complete sequence
          Length = 142723

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 132   cccctcctccccatccccaaccccgtctccctt 164
             ||||||||||||| ||| |||||| ||||||||
Sbjct: 26424 cccctcctccccagcccaaaccccatctccctt 26392

---

>emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome; segment 3/13
          Length = 349564

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 240    ccggtggctggccgccaccgc 260
              |||||||||||||||||||||
Sbjct: 279847 ccggtggctggccgccaccgc 279827

---

>emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 3/14
          Length = 320050

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 240    ccggtggctggccgccaccgc 260
              |||||||||||||||||||||
Sbjct: 297820 ccggtggctggccgccaccgc 297800

---

>emb|CR860972.1| Pongo pygmaeus mRNA; cDNA DKFZp459P0527 (from clone DKFZp459P0527)
          Length = 2099

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 132  cccctcctccccatccccaaccccgtctccctt 164
            ||||||||||||| ||| |||||| ||||||||
Sbjct: 1914 cccctcctccccagcccaaaccccatctccctt 1882

---

>gb|AF006501.4| Homo sapiens chromosome 22q13.1 Cosmid Clone c1155, complete sequence
          Length = 40129

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 132   cccctcctccccatccccaaccccgtctccctt 164
             ||||||||||||| ||| |||||| ||||||||
Sbjct: 22477 cccctcctccccagcccaaaccccatctccctt 22445

---

>emb|BX842567.2| Mouse DNA sequence from clone RP23-340H9 on chromosome 4, complete
             sequence
          Length = 18979

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 130   gacccctcctccccatcccca 150
             |||||||||||||||||||||
Sbjct: 12735 gacccctcctccccatcccca 12715

---

>dbj|AK110353.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-H09, full
           insert sequence
          Length = 3907

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 23  ctggctcagccactgcctcag 43
           |||||||||||||||||||||
Sbjct: 164 ctggctcagccactgcctcag 144

---

>dbj|AP003040.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-335F8, complete
             sequence
          Length = 80198

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 133   ccctcctccccatccccaacc 153
             |||||||||||||||||||||
Sbjct: 72429 ccctcctccccatccccaacc 72449

---

>gb|DQ246451.1| Porcine respiratory and reproductive syndrome virus strain FJ04A GP2
            glycoprotein, GP3 glycoprotein, GP4 glycoprotein, GP5
            glycosylated envelope protein, membrane protein M, and
            nucleocapsid protein N genes, complete cds
          Length = 3188

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 279  tgctgcgctcgtcaacgcca 298
            ||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgcca 1809

---

>gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, complete sequence
          Length = 168142

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   tcctccccatccccaacccc 155
             ||||||||||||||||||||
Sbjct: 84574 tcctccccatccccaacccc 84593

---

>gb|AC135417.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1314_A05,
             complete sequence
          Length = 109853

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 232   gccaagacccggtggctggccgcc 255
             |||||||||||||||| |||||||
Sbjct: 23248 gccaagacccggtggccggccgcc 23271

---

>ref|XM_960617.1| Neurospora crassa OR74A hypothetical protein (NCU02579.1) partial
           mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 189 agcgcagcgcaacctgcgca 208
           ||||||||||||||||||||
Sbjct: 462 agcgcagcgcaacctgcgca 481

---

>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete sequence
          Length = 221043

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 344    aggacatgcccaggatccgc 363
              ||||||||||||||||||||
Sbjct: 158629 aggacatgcccaggatccgc 158610

---

>ref|XM_331777.1| Neurospora crassa OR74A hypothetical protein (NCU02579.1) partial
           mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 189 agcgcagcgcaacctgcgca 208
           ||||||||||||||||||||
Sbjct: 462 agcgcagcgcaacctgcgca 481

---

>gb|DQ181609.1| Porcine respiratory and reproductive syndrome virus isolate Col 928
           Ant-00 envelope protein gene, partial cds
          Length = 537

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 279 tgctgcgctcgtcaacgcca 298
           ||||||||||||||||||||
Sbjct: 59  tgctgcgctcgtcaacgcca 78

---

>gb|DQ181608.1| Porcine respiratory and reproductive syndrome virus isolate Col
           189-4 Ant-98 envelope protein gene, partial cds
          Length = 537

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 279 tgctgcgctcgtcaacgcca 298
           ||||||||||||||||||||
Sbjct: 59  tgctgcgctcgtcaacgcca 78

---

>gb|DQ181607.1| Porcine respiratory and reproductive syndrome virus isolate Col 596
           Cal-99 envelope protein gene, partial cds
          Length = 537

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 279 tgctgcgctcgtcaacgcca 298
           ||||||||||||||||||||
Sbjct: 59  tgctgcgctcgtcaacgcca 78


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,222,898
Number of Sequences: 3902068
Number of extensions: 3222898
Number of successful extensions: 68898
Number of sequences better than 10.0: 589
Number of HSP's better than 10.0 without gapping: 589
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68060
Number of HSP's gapped (non-prelim): 837
length of query: 379
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 357
effective length of database: 17,147,199,772
effective search space: 6121550318604
effective search space used: 6121550318604
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---