>emb|X56803.1|TAMRNAU T.aestivum L. mRNA for ubiquitin
          Length = 436

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 68/77 (88%), Gaps = 3/77 (3%)
 Strand = Plus / Plus

                                                                       
Query: 95  taccgtactgtgatgcagtattatcgtttgtatctttgaactt---ctggtgcgcagcag 151
           |||| |||||||||||||| ||||||||||||||||  |||||   |||||| | |||||
Sbjct: 349 taccatactgtgatgcagtgttatcgtttgtatcttcaaacttctgctggtgtggagcag 408

                            
Query: 152 ctttggtgaactatgaa 168
           |||||||||||||||||
Sbjct: 409 ctttggtgaactatgaa 425



 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 22  tggaactgcttctgtctctgggttcacaag 51
           |||| |||||||||||||||||||||||||
Sbjct: 248 tggagctgcttctgtctctgggttcacaag 277

>emb|X56601.1|TAUBIQU Wheat mRNA for ubiquitin
          Length = 436

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 68/77 (88%), Gaps = 3/77 (3%)
 Strand = Plus / Plus

                                                                       
Query: 95  taccgtactgtgatgcagtattatcgtttgtatctttgaactt---ctggtgcgcagcag 151
           |||| |||||||||||||| ||||||||||||||||  |||||   |||||| | |||||
Sbjct: 349 taccatactgtgatgcagtgttatcgtttgtatcttcaaacttctgctggtgtggagcag 408

                            
Query: 152 ctttggtgaactatgaa 168
           |||||||||||||||||
Sbjct: 409 ctttggtgaactatgaa 425



 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 22  tggaactgcttctgtctctgggttcacaag 51
           |||| |||||||||||||||||||||||||
Sbjct: 248 tggagctgcttctgtctctgggttcacaag 277

>gb|DQ086482.1| Triticum aestivum ubiquitin (Ubiq) mRNA, partial cds
          Length = 400

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                       
Query: 95  taccgtactgtgatgcagtattatcgtttgtatctttgaactt---ctggtgcgcagcag 151
           |||| |||||||||||||| ||||||||||||||||  |||||   |||||| | |||||
Sbjct: 330 taccatactgtgatgcagtgttatcgtttgtatcttcaaacttctgctggtgtggagcag 389

                      
Query: 152 ctttggtgaac 162
           |||||||||||
Sbjct: 390 ctttggtgaac 400



 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 22  tggaactgcttctgtctctgggttcacaag 51
           |||| |||||||||||||||||||||||||
Sbjct: 229 tggagctgcttctgtctctgggttcacaag 258

>gb|AC124418.4| Mus musculus BAC clone RP24-318G17 from chromosome 18, complete
            sequence
          Length = 167998

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 121  tttgtatctttgaacttctgg 141
            |||||||||||||||||||||
Sbjct: 9395 tttgtatctttgaacttctgg 9415

>gb|AC102411.12| Mus musculus chromosome 18, clone RP24-374D7, complete sequence
          Length = 171918

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 121   tttgtatctttgaacttctgg 141
             |||||||||||||||||||||
Sbjct: 92359 tttgtatctttgaacttctgg 92379

>gb|AC161481.4| Mus musculus chromosome 18, clone RP23-336C20, complete sequence
          Length = 210643

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 121   tttgtatctttgaacttctgg 141
             |||||||||||||||||||||
Sbjct: 17688 tttgtatctttgaacttctgg 17668

>gb|U97497.1|HSBT2S3 Homo sapiens butyrophilin (BT2.1) gene, exon 7, and partial cds
          Length = 2123

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 18  gaggtggaactgcttctgtctctgg 42
           |||| ||||||||||||||||||||
Sbjct: 329 gaggaggaactgcttctgtctctgg 353

>gb|AC147073.2| Pan troglodytes BAC clone RP43-169D10 from 7, complete sequence
          Length = 159447

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 160    aactatgaaaaataagtgag 179
              ||||||||||||||||||||
Sbjct: 111175 aactatgaaaaataagtgag 111194

>gb|AC002381.1| Homo sapiens BAC clone CTB-20D2 from 7, complete sequence
          Length = 172533

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   aactatgaaaaataagtgag 179
             ||||||||||||||||||||
Sbjct: 55066 aactatgaaaaataagtgag 55047

>gb|AC142331.1| Pan troglodytes BAC clone RP43-28J15 from 7, complete sequence
          Length = 140363

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   aactatgaaaaataagtgag 179
             ||||||||||||||||||||
Sbjct: 52403 aactatgaaaaataagtgag 52422

>gb|AC145774.1| Pan troglodytes BAC clone RP43-160F1 from 7, complete sequence
          Length = 208178

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   aactatgaaaaataagtgag 179
             ||||||||||||||||||||
Sbjct: 55251 aactatgaaaaataagtgag 55270

>emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chromosome 1 Contains
            the 3' end of the NEGR1 gene for neuronal growth
            regulator 1 and a novel gene, complete sequence
          Length = 93633

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 76   aatggagtctgtctctgtct 95
            ||||||||||||||||||||
Sbjct: 1606 aatggagtctgtctctgtct 1587

>emb|AL512506.8| Human DNA sequence from clone RP11-5G9 on chromosome 13 Contains the
            5' end of a novel gene, parts of 2 novel genes, a
            diacylglycerol kinase pseudogene and a CpG island,
            complete sequence
          Length = 167875

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 76   aatggagtctgtctctgtct 95
            ||||||||||||||||||||
Sbjct: 3029 aatggagtctgtctctgtct 3048

>emb|AL358453.8| Human DNA sequence from clone RP11-115M14 on chromosome 1 Contains a
              cytochrome c oxidase subunit VIa polypeptide 1 (COX6A1)
              pseudogene, complete sequence
          Length = 108934

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 76     aatggagtctgtctctgtct 95
              ||||||||||||||||||||
Sbjct: 108540 aatggagtctgtctctgtct 108521

>emb|AL162713.19| Human DNA sequence from clone RP11-168P13 on chromosome 13 Contains parts
              of 2 novel genes and a CpG island, complete sequence
          Length = 157175

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 76     aatggagtctgtctctgtct 95
              ||||||||||||||||||||
Sbjct: 146144 aatggagtctgtctctgtct 146163

>gb|AC147976.3| Pan troglodytes BAC clone CH251-543E22 from chromosome 7, complete
              sequence
          Length = 231294

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 160    aactatgaaaaataagtgag 179
              ||||||||||||||||||||
Sbjct: 137671 aactatgaaaaataagtgag 137652


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,074,493
Number of Sequences: 3902068
Number of extensions: 2074493
Number of successful extensions: 217128
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 217062
Number of HSP's gapped (non-prelim): 63
length of query: 204
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 182
effective length of database: 17,147,199,772
effective search space: 3120790358504
effective search space used: 3120790358504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)