ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal21k21 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK073785.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033068D19, full insert sequence Length = 801 Score = 595 bits (300), Expect = e-167 Identities = 444/492 (90%) Strand = Plus / Plus Query: 2 gggaaacccagcagcctcaagggcgtcgcccttatcagcggcggtggcgccgacagcgct 61 |||||| || || ||||||||||||||||||| ||| |||||| |||| | ||||||| Sbjct: 3 gggaaagccggcggcctcaagggcgtcgccctcatcggcggcgccggcggcaacagcgcg 62 Query: 62 gtcgccggcgccctccacttcgtccaagacccctcctccgggtataccgaggtgaggggg 121 ||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||| Sbjct: 63 gtcgccggcgccctccacttcttccaggacccctccaccgggtataccgaggtgaggggg 122 Query: 122 agggtctccggcctcgccccgggcctccacggcttccacatccacgccttcggcgacacc 181 |||||| |||||||||| ||||||||||| ||||||||||||||| |||| ||||||||| Sbjct: 123 agggtcaccggcctcgctccgggcctccatggcttccacatccactcctttggcgacacc 182 Query: 182 accaacggctgcaactccaccggaccccatttcaatcctcttaataaatcccatggagca 241 ||||||||||||||||| ||||| |||||||| ||||||| ||||| |||||||| ||| Sbjct: 183 accaacggctgcaactctaccgggccccattttaatcctcacaataagtcccatggggca 242 Query: 242 cctgttgatgatgaacgacatgtgggcgacctgggaaacatacaagccaacaaggatggc 301 || |||||||||| |||||||||||||||||||||||||| ||||||||| ||||| Sbjct: 243 ccatctgatgatgaaagacatgtgggcgacctgggaaacatagtagccaacaaagatggt 302 Query: 302 gttgcagaaatcttcataaaggacttacagatttcactaagagggcctcattccatactg 361 |||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||| || Sbjct: 303 gttgcagatatcttcataaaggacctacagatttcactaagcgggcctcattccatattg 362 Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||| Sbjct: 363 ggaagggcagttgttgttcatgctgattctgatgacctaggaaggggtggtcatgaactc 422 Query: 422 agtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattggaattcaacct 481 |||||| ||||||||||||||||||| || |||||||| |||||||||||| ||| | || Sbjct: 423 agtaaaacaacaggaaatgcaggagcaagaattggatgcggtatcattggacttcgatct 482 Query: 482 gctgtttaacaa 493 || ||||||||| Sbjct: 483 gcagtttaacaa 494
>gb|AY104697.1| Zea mays PCO073524 mRNA sequence Length = 595 Score = 299 bits (151), Expect = 6e-78 Identities = 280/323 (86%) Strand = Plus / Plus Query: 155 ttccacatccacgccttcggcgacaccaccaacggctgcaactccaccggaccccatttc 214 ||||||||||||| |||||||||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 192 ttccacatccacgtcttcggcgacactaccaatggctgcaactcaaccggtccccatttt 251 Query: 215 aatcctcttaataaatcccatggagcacctgttgatgatgaacgacatgtgggcgacctg 274 || |||| ||||||| |||||||||| || |||| || ||||||||| ||||||||||| Sbjct: 252 aaccctcataataaaccccatggagctccatttgacgacgaacgacatttgggcgacctg 311 Query: 275 ggaaacatacaagccaacaaggatggcgttgcagaaatcttcataaaggacttacagatt 334 ||||| ||| |||||| | ||||| | ||||||| | ||||||| |||||||||||| Sbjct: 312 ggaaatatagtagccaatgaagatggagatgcagaagtgttcataagagacttacagatt 371 Query: 335 tcactaagagggcctcattccatactgggaagggcagttgttgttcatgctgattctgat 394 ||| | || |||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 372 tcattgagtgggcctcattccattctgggaagggcagttgttgtacatgctgatcctgat 431 Query: 395 gacctaggaaagggtggccatgagctcagtaaatcaacaggaaatgcaggagccaggatt 454 |||||||| | |||||||||||| || ||||| |||||| |||| ||| |||| || ||| Sbjct: 432 gacctagggaggggtggccatgaactgagtaagtcaacaagaaacgcacgagctagaatt 491 Query: 455 ggatgtggtatcattggaattca 477 ||||||||||||||||||||||| Sbjct: 492 ggatgtggtatcattggaattca 514
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 159 bits (80), Expect = 1e-35 Identities = 98/104 (94%) Strand = Plus / Minus Query: 101 gggtataccgaggtgagggggagggtctccggcctcgccccgggcctccacggcttccac 160 ||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||| Sbjct: 6243387 gggtataccgaggtgagggggagggtcaccggcctcgctccgggcctccatggcttccac 6243328 Query: 161 atccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 |||||| |||| |||||||||||||||||||||||||| ||||| Sbjct: 6243327 atccactcctttggcgacaccaccaacggctgcaactctaccgg 6243284 Score = 135 bits (68), Expect = 2e-28 Identities = 77/80 (96%) Strand = Plus / Minus Query: 330 agatttcactaagagggcctcattccatactgggaagggcagttgttgttcatgctgatt 389 ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 6241972 agatttcactaagcgggcctcattccatattgggaagggcagttgttgttcatgctgatt 6241913 Query: 390 ctgatgacctaggaaagggt 409 ||||||||||||||| |||| Sbjct: 6241912 ctgatgacctaggaaggggt 6241893 Score = 97.6 bits (49), Expect = 4e-17 Identities = 88/101 (87%) Strand = Plus / Minus Query: 2 gggaaacccagcagcctcaagggcgtcgcccttatcagcggcggtggcgccgacagcgct 61 |||||| || || ||||||||||||||||||| ||| |||||| |||| | ||||||| Sbjct: 6243614 gggaaagccggcggcctcaagggcgtcgccctcatcggcggcgccggcggcaacagcgcg 6243555 Query: 62 gtcgccggcgccctccacttcgtccaagacccctcctccgg 102 ||||||||||||||||||||| |||| ||||||||| |||| Sbjct: 6243554 gtcgccggcgccctccacttcttccaggacccctccaccgg 6243514 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 206 ccccatttcaatcctcttaataaatcccatggagcacctgttgatgatgaacgacatgtg 265 |||||||| ||||||| ||||| |||||||| ||||| |||||||||| |||||||| Sbjct: 6242301 ccccattttaatcctcacaataagtcccatggggcaccatctgatgatgaaagacatgtg 6242242 Query: 266 ggcgacctgggaaacatacaagccaacaaggatgg 300 |||||||||||||||||| ||||||||| ||||| Sbjct: 6242241 ggcgacctgggaaacatagtagccaacaaagatgg 6242207 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 407 ggtggccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggta 464 ||||| ||||| ||||||||| ||||||||||||||||||| || |||||||| |||| Sbjct: 6240812 ggtggtcatgaactcagtaaaacaacaggaaatgcaggagcaagaattggatgcggta 6240755 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 302 gttgcagaaatcttcataaaggacttacag 331 |||||||| ||||||||||||||| ||||| Sbjct: 6242092 gttgcagatatcttcataaaggacctacag 6242063
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 159 bits (80), Expect = 1e-35 Identities = 98/104 (94%) Strand = Plus / Minus Query: 101 gggtataccgaggtgagggggagggtctccggcctcgccccgggcctccacggcttccac 160 ||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||| Sbjct: 6242600 gggtataccgaggtgagggggagggtcaccggcctcgctccgggcctccatggcttccac 6242541 Query: 161 atccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 |||||| |||| |||||||||||||||||||||||||| ||||| Sbjct: 6242540 atccactcctttggcgacaccaccaacggctgcaactctaccgg 6242497 Score = 135 bits (68), Expect = 2e-28 Identities = 77/80 (96%) Strand = Plus / Minus Query: 330 agatttcactaagagggcctcattccatactgggaagggcagttgttgttcatgctgatt 389 ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 6241185 agatttcactaagcgggcctcattccatattgggaagggcagttgttgttcatgctgatt 6241126 Query: 390 ctgatgacctaggaaagggt 409 ||||||||||||||| |||| Sbjct: 6241125 ctgatgacctaggaaggggt 6241106 Score = 97.6 bits (49), Expect = 4e-17 Identities = 88/101 (87%) Strand = Plus / Minus Query: 2 gggaaacccagcagcctcaagggcgtcgcccttatcagcggcggtggcgccgacagcgct 61 |||||| || || ||||||||||||||||||| ||| |||||| |||| | ||||||| Sbjct: 6242827 gggaaagccggcggcctcaagggcgtcgccctcatcggcggcgccggcggcaacagcgcg 6242768 Query: 62 gtcgccggcgccctccacttcgtccaagacccctcctccgg 102 ||||||||||||||||||||| |||| ||||||||| |||| Sbjct: 6242767 gtcgccggcgccctccacttcttccaggacccctccaccgg 6242727 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 206 ccccatttcaatcctcttaataaatcccatggagcacctgttgatgatgaacgacatgtg 265 |||||||| ||||||| ||||| |||||||| ||||| |||||||||| |||||||| Sbjct: 6241514 ccccattttaatcctcacaataagtcccatggggcaccatctgatgatgaaagacatgtg 6241455 Query: 266 ggcgacctgggaaacatacaagccaacaaggatgg 300 |||||||||||||||||| ||||||||| ||||| Sbjct: 6241454 ggcgacctgggaaacatagtagccaacaaagatgg 6241420 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 407 ggtggccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggta 464 ||||| ||||| ||||||||| ||||||||||||||||||| || |||||||| |||| Sbjct: 6240025 ggtggtcatgaactcagtaaaacaacaggaaatgcaggagcaagaattggatgcggta 6239968 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 302 gttgcagaaatcttcataaaggacttacag 331 |||||||| ||||||||||||||| ||||| Sbjct: 6241305 gttgcagatatcttcataaaggacctacag 6241276
>gb|AC140006.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNAa0090D11, complete sequence Length = 115403 Score = 159 bits (80), Expect = 1e-35 Identities = 98/104 (94%) Strand = Plus / Minus Query: 101 gggtataccgaggtgagggggagggtctccggcctcgccccgggcctccacggcttccac 160 ||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||| Sbjct: 81998 gggtataccgaggtgagggggagggtcaccggcctcgctccgggcctccatggcttccac 81939 Query: 161 atccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 |||||| |||| |||||||||||||||||||||||||| ||||| Sbjct: 81938 atccactcctttggcgacaccaccaacggctgcaactctaccgg 81895 Score = 135 bits (68), Expect = 2e-28 Identities = 77/80 (96%) Strand = Plus / Minus Query: 330 agatttcactaagagggcctcattccatactgggaagggcagttgttgttcatgctgatt 389 ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 80583 agatttcactaagcgggcctcattccatattgggaagggcagttgttgttcatgctgatt 80524 Query: 390 ctgatgacctaggaaagggt 409 ||||||||||||||| |||| Sbjct: 80523 ctgatgacctaggaaggggt 80504 Score = 97.6 bits (49), Expect = 4e-17 Identities = 88/101 (87%) Strand = Plus / Minus Query: 2 gggaaacccagcagcctcaagggcgtcgcccttatcagcggcggtggcgccgacagcgct 61 |||||| || || ||||||||||||||||||| ||| |||||| |||| | ||||||| Sbjct: 82225 gggaaagccggcggcctcaagggcgtcgccctcatcggcggcgccggcggcaacagcgcg 82166 Query: 62 gtcgccggcgccctccacttcgtccaagacccctcctccgg 102 ||||||||||||||||||||| |||| ||||||||| |||| Sbjct: 82165 gtcgccggcgccctccacttcttccaggacccctccaccgg 82125 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 206 ccccatttcaatcctcttaataaatcccatggagcacctgttgatgatgaacgacatgtg 265 |||||||| ||||||| ||||| |||||||| ||||| |||||||||| |||||||| Sbjct: 80912 ccccattttaatcctcacaataagtcccatggggcaccatctgatgatgaaagacatgtg 80853 Query: 266 ggcgacctgggaaacatacaagccaacaaggatgg 300 |||||||||||||||||| ||||||||| ||||| Sbjct: 80852 ggcgacctgggaaacatagtagccaacaaagatgg 80818 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 407 ggtggccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggta 464 ||||| ||||| ||||||||| ||||||||||||||||||| || |||||||| |||| Sbjct: 79423 ggtggtcatgaactcagtaaaacaacaggaaatgcaggagcaagaattggatgcggta 79366 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 302 gttgcagaaatcttcataaaggacttacag 331 |||||||| ||||||||||||||| ||||| Sbjct: 80703 gttgcagatatcttcataaaggacctacag 80674
>gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0024O21, complete sequence Length = 155651 Score = 159 bits (80), Expect = 1e-35 Identities = 98/104 (94%) Strand = Plus / Minus Query: 101 gggtataccgaggtgagggggagggtctccggcctcgccccgggcctccacggcttccac 160 ||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||| Sbjct: 56595 gggtataccgaggtgagggggagggtcaccggcctcgctccgggcctccatggcttccac 56536 Query: 161 atccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 |||||| |||| |||||||||||||||||||||||||| ||||| Sbjct: 56535 atccactcctttggcgacaccaccaacggctgcaactctaccgg 56492 Score = 135 bits (68), Expect = 2e-28 Identities = 77/80 (96%) Strand = Plus / Minus Query: 330 agatttcactaagagggcctcattccatactgggaagggcagttgttgttcatgctgatt 389 ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 55180 agatttcactaagcgggcctcattccatattgggaagggcagttgttgttcatgctgatt 55121 Query: 390 ctgatgacctaggaaagggt 409 ||||||||||||||| |||| Sbjct: 55120 ctgatgacctaggaaggggt 55101 Score = 97.6 bits (49), Expect = 4e-17 Identities = 88/101 (87%) Strand = Plus / Minus Query: 2 gggaaacccagcagcctcaagggcgtcgcccttatcagcggcggtggcgccgacagcgct 61 |||||| || || ||||||||||||||||||| ||| |||||| |||| | ||||||| Sbjct: 56822 gggaaagccggcggcctcaagggcgtcgccctcatcggcggcgccggcggcaacagcgcg 56763 Query: 62 gtcgccggcgccctccacttcgtccaagacccctcctccgg 102 ||||||||||||||||||||| |||| ||||||||| |||| Sbjct: 56762 gtcgccggcgccctccacttcttccaggacccctccaccgg 56722 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 206 ccccatttcaatcctcttaataaatcccatggagcacctgttgatgatgaacgacatgtg 265 |||||||| ||||||| ||||| |||||||| ||||| |||||||||| |||||||| Sbjct: 55509 ccccattttaatcctcacaataagtcccatggggcaccatctgatgatgaaagacatgtg 55450 Query: 266 ggcgacctgggaaacatacaagccaacaaggatgg 300 |||||||||||||||||| ||||||||| ||||| Sbjct: 55449 ggcgacctgggaaacatagtagccaacaaagatgg 55415 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 407 ggtggccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggta 464 ||||| ||||| ||||||||| ||||||||||||||||||| || |||||||| |||| Sbjct: 54020 ggtggtcatgaactcagtaaaacaacaggaaatgcaggagcaagaattggatgcggta 53963 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 302 gttgcagaaatcttcataaaggacttacag 331 |||||||| ||||||||||||||| ||||| Sbjct: 55300 gttgcagatatcttcataaaggacctacag 55271
>gb|AY833718.1| Codonopsis lanceolata CuZn superoxide dismutase (SODCc) mRNA, complete cds Length = 799 Score = 85.7 bits (43), Expect = 2e-13 Identities = 94/111 (84%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| || ||||| ||||||||| ||||||| || ||||||||||||||||| ||| Sbjct: 491 ggaagggctgtagttgtccatgctgatcctgatgatcttggaaagggtggccatgaactc 550 Query: 422 agtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattgga 472 || ||| || |||||||| || | |||||||| ||||||||||||||| Sbjct: 551 agcaaaagcactggaaatgctggtggcaggattgcctgtggtatcattgga 601
>dbj|D49485.1| Solidago canadensis var. scabra mRNA for copper/zinc-superoxide dismutase, complete cds, clone: SAcSODcy Length = 700 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| || ||||| ||||||||| ||||||| || |||||||| |||||||||||| Sbjct: 361 ggaagggctgtagttgtccatgctgatcctgatgatcttggaaagggaggccatgagctc 420 Query: 422 agtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattgga 472 || ||| | || |||||||| || | || ||| |||||||||||||||| Sbjct: 421 agcaaaaccactggaaatgctggtggaagagttgcatgtggtatcattgga 471
>emb|X14040.1|LECYTSOD Tomato mRNA for cytoplasmic Cu-Zn superoxide dismutase (EC 1.15.1.1) Length = 777 Score = 75.8 bits (38), Expect = 2e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||| || |||||||||||||||||| ||||||| || |||||||| || ||||||||| Sbjct: 342 ggaagagctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctc 401 Query: 422 agtaaa 427 |||||| Sbjct: 402 agtaaa 407
>gb|AF479059.1| Sandersonia aurantiaca copper/zinc superoxide dismutase mRNA, complete cds Length = 799 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 344 gggcctcattccatactgggaagggcagttgttgttcatgctgattctgatgacctagga 403 ||||| |||||||| | |||||||| |||||||| ||||||||| |||||||||| ||| Sbjct: 338 gggccacattccattattggaagggctgttgttgtccatgctgatcctgatgaccttgga 397 Query: 404 aagggtggccatga 417 |||||||| ||||| Sbjct: 398 aagggtgggcatga 411
>gb|AF355460.1|AF355460 Solanum tuberosum Cu/Zn-superoxide dismutase mRNA, partial cds Length = 617 Score = 75.8 bits (38), Expect = 2e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||| || |||||||||||||||||| ||||||| || |||||||| || ||||||||| Sbjct: 315 ggaagagctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctc 374 Query: 422 agtaaa 427 |||||| Sbjct: 375 agtaaa 380
>gb|AF354748.1|AF354748 Solanum tuberosum copper-zinc superoxide dismutase mRNA, partial cds Length = 443 Score = 75.8 bits (38), Expect = 2e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||| || |||||||||||||||||| ||||||| || |||||||| || ||||||||| Sbjct: 325 ggaagagctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctc 384 Query: 422 agtaaa 427 |||||| Sbjct: 385 agtaaa 390
>gb|M37150.1|TOMSODA Tomato superoxide dismutase (SOD) mRNA, complete cds Length = 776 Score = 75.8 bits (38), Expect = 2e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||| || |||||||||||||||||| ||||||| || |||||||| || ||||||||| Sbjct: 342 ggaagagctgttgttgttcatgctgatcctgatgatcttggaaagggaggacatgagctc 401 Query: 422 agtaaa 427 |||||| Sbjct: 402 agtaaa 407
>dbj|AB189165.1| Pisum sativum mRNA for copper zinc superoxide dismutase, complete cds Length = 857 Score = 67.9 bits (34), Expect = 4e-08 Identities = 67/78 (85%) Strand = Plus / Plus Query: 143 ggcctccacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccacc 202 ||||||||||||||||| ||||| ||||| || |||||||| ||||| |||| || || Sbjct: 183 ggcctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaact 242 Query: 203 ggaccccatttcaatcct 220 ||||| |||||||||||| Sbjct: 243 ggaccacatttcaatcct 260
>dbj|AB087845.1| Pisum sativum SOD mRNA for superoxide dismutase, complete cds Length = 850 Score = 67.9 bits (34), Expect = 4e-08 Identities = 67/78 (85%) Strand = Plus / Plus Query: 143 ggcctccacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccacc 202 ||||||||||||||||| ||||| ||||| || |||||||| ||||| |||| || || Sbjct: 179 ggcctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaact 238 Query: 203 ggaccccatttcaatcct 220 ||||| |||||||||||| Sbjct: 239 ggaccacatttcaatcct 256
>gb|M63003.1|PEACUZNSD Pea Cu-Zn superoxide dismutase mRNA, complete cds Length = 738 Score = 67.9 bits (34), Expect = 4e-08 Identities = 67/78 (85%) Strand = Plus / Plus Query: 143 ggcctccacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccacc 202 ||||||||||||||||| ||||| ||||| || |||||||| ||||| |||| || || Sbjct: 133 ggcctccacggcttccatatccatgccttgggagacaccacaaacggttgcatttcaact 192 Query: 203 ggaccccatttcaatcct 220 ||||| |||||||||||| Sbjct: 193 ggaccacatttcaatcct 210
>gb|AF034832.1|AF034832 Mesembryanthemum crystallinum cytosolic copper/zinc superoxide dismutase (SOD2) mRNA, complete cds Length = 755 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Plus Query: 143 ggcctccacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccacc 202 |||||||| ||||| |||||||| ||| | || || |||||||| |||||||||||||| Sbjct: 185 ggcctccatggctttcacatccatgcccttggagataccaccaatggctgcaactccact 244 Query: 203 ggaccccatttcaatcc 219 || || ||||||||||| Sbjct: 245 gggcctcatttcaatcc 261
>ref|NM_121815.2| Arabidopsis thaliana CSD3 (COPPER/ZINC SUPEROXIDE DISMUTASE 3); copper, zinc superoxide dismutase AT5G18100 (CSD3) mRNA, complete cds Length = 1011 Score = 63.9 bits (32), Expect = 6e-07 Identities = 104/128 (81%) Strand = Plus / Plus Query: 351 attccatactgggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtg 410 |||||||||| || ||||| |||||||| ||||| ||| |||||||||| || || || | Sbjct: 367 attccatactcgggagggcggttgttgtgcatgcggatcctgatgaccttgggaaaggag 426 Query: 411 gccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattg 470 | || |||| || |||||||| ||||| ||||| | || |||||||||||||||| | Sbjct: 427 ggcacaagcttagcaaatcaactggaaacgcaggctcgagagttggatgtggtatcatcg 486 Query: 471 gaattcaa 478 || ||||| Sbjct: 487 gacttcaa 494
>ref|XM_959198.1| Neurospora crassa OR74A SUPEROXIDE DISMUTASE [CU-ZN] (NCU02133.1) partial mRNA Length = 504 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||||||| ||||||| |||| |||||||||||||| Sbjct: 171 cggcttccacatccacaccttcggtgacaacaccaacggctgca 214
>ref|XM_329322.1| Neurospora crassa OR74A SUPEROXIDE DISMUTASE [CU-ZN] (NCU02133.1) partial mRNA Length = 504 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||||||| ||||||| |||| |||||||||||||| Sbjct: 171 cggcttccacatccacaccttcggtgacaacaccaacggctgca 214
>gb|AY195841.1| Cordyceps militaris copper-zinc superoxide dismutase mRNA, complete cds Length = 465 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||||||| |||| ||||||| |||||||||||||| Sbjct: 132 cggcttccacatccacacctttggcgacaacaccaacggctgca 175
>emb|X55974.1|NPSODM N.plumbaginifolia mRNA for superoxide dismutase Length = 837 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Plus Query: 374 gttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagtaaatcaaca 433 ||||||||||||||| ||||||| || |||||||| || || |||||||||||| | || Sbjct: 437 gttgttcatgctgatcctgatgatcttggaaagggaggacacgagctcagtaaaaccact 496 Query: 434 ggaaatgc 441 |||||||| Sbjct: 497 ggaaatgc 504
>emb|BX833707.1|CNS0A0AG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL72ZA03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 654 Score = 63.9 bits (32), Expect = 6e-07 Identities = 104/128 (81%) Strand = Plus / Plus Query: 351 attccatactgggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtg 410 |||||||||| || ||||| |||||||| ||||| ||| |||||||||| || || || | Sbjct: 352 attccatactcgggagggcggttgttgtgcatgcggatcctgatgaccttgggaaaggag 411 Query: 411 gccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattg 470 | || |||| || |||||||| ||||| ||||| | || |||||||||||||||| | Sbjct: 412 ggcacaagcttagcaaatcaactggaaacgcaggctcgagagttggatgtggtatcatcg 471 Query: 471 gaattcaa 478 || ||||| Sbjct: 472 gacttcaa 479
>gb|BT003689.1| Arabidopsis thaliana At5g18100 mRNA, complete cds Length = 495 Score = 63.9 bits (32), Expect = 6e-07 Identities = 104/128 (81%) Strand = Plus / Plus Query: 351 attccatactgggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtg 410 |||||||||| || ||||| |||||||| ||||| ||| |||||||||| || || || | Sbjct: 344 attccatactcgggagggcggttgttgtgcatgcggatcctgatgaccttgggaaaggag 403 Query: 411 gccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattg 470 | || |||| || |||||||| ||||| ||||| | || |||||||||||||||| | Sbjct: 404 ggcacaagcttagcaaatcaactggaaacgcaggctcgagagttggatgtggtatcatcg 463 Query: 471 gaattcaa 478 || ||||| Sbjct: 464 gacttcaa 471
>dbj|AK117742.1| Arabidopsis thaliana At5g18100 mRNA for putative Cu/Zn superoxide dismutase, complete cds, clone: RAFL17-42-L16 Length = 697 Score = 63.9 bits (32), Expect = 6e-07 Identities = 104/128 (81%) Strand = Plus / Plus Query: 351 attccatactgggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtg 410 |||||||||| || ||||| |||||||| ||||| ||| |||||||||| || || || | Sbjct: 367 attccatactcgggagggcggttgttgtgcatgcggatcctgatgaccttgggaaaggag 426 Query: 411 gccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattg 470 | || |||| || |||||||| ||||| ||||| | || |||||||||||||||| | Sbjct: 427 ggcacaagcttagcaaatcaactggaaacgcaggctcgagagttggatgtggtatcatcg 486 Query: 471 gaattcaa 478 || ||||| Sbjct: 487 gacttcaa 494
>gb|AF170297.1|AF170297 Manihot esculenta copper/zinc-superoxide dismutase mRNA, complete cds Length = 801 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||||||||||||||||||||| ||| ||||||| || || | ||| || ||||| ||| Sbjct: 391 ggaagggcagttgttgttcatgcagatcctgatgatcttggcaggggaggacatgaactc 450 Query: 422 agtaaatcaacaggaaatgc 441 |||||| | || |||||||| Sbjct: 451 agtaaaaccaccggaaatgc 470
>gb|AF061520.1|AF061520 Arabidopsis thaliana copper/zinc superoxide dismutase (CSD3) mRNA, partial cds Length = 674 Score = 63.9 bits (32), Expect = 6e-07 Identities = 104/128 (81%) Strand = Plus / Plus Query: 351 attccatactgggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtg 410 |||||||||| || ||||| |||||||| ||||| ||| |||||||||| || || || | Sbjct: 338 attccatactcgggagggcggttgttgtgcatgcggatcctgatgaccttgggaaaggag 397 Query: 411 gccatgagctcagtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattg 470 | || |||| || |||||||| ||||| ||||| | || |||||||||||||||| | Sbjct: 398 ggcacaagcttagcaaatcaactggaaacgcaggctcgagagttggatgtggtatcatcg 457 Query: 471 gaattcaa 478 || ||||| Sbjct: 458 gacttcaa 465
>gb|AF037359.1|AF037359 Paulownia kawakamii superoxide dismutase (SOD5) mRNA, complete cds Length = 794 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Plus Query: 350 cattccatactgggaagggcagttgttgttcatgctgattctgatgacctaggaaagggt 409 ||||||||| | ||||| || || ||||||||||||||| ||||||| || ||||||||| Sbjct: 412 cattccataattggaagagctgtagttgttcatgctgatcctgatgatcttggaaagggt 471 Query: 410 ggccatga 417 || ||||| Sbjct: 472 ggacatga 479
>gb|M58687.1|NEUSOD1 Neurospora crassa Cu/Zn-superoxide dismutase (sod1) gene, complete cds Length = 1023 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||||||| ||||||| |||| |||||||||||||| Sbjct: 514 cggcttccacatccacaccttcggtgacaacaccaacggctgca 557
>gb|AY440555.1| Armigeres subalbatus ASAP ID: 40429 superoxide dismutase mRNA sequence Length = 460 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccaccggaccc 208 ||||| ||||||||||||| ||||| |||| ||||||||| |||| |||| ||||||| Sbjct: 193 cacggattccacatccacgagttcggtgacaacaccaacggatgcacctccgccggaccg 252 Query: 209 catttcaatcc 219 || |||||||| Sbjct: 253 cacttcaatcc 263
>gb|DQ078121.2| Rheum australe copper/zinc superoxide dismutase mRNA, complete cds Length = 586 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| || ||||||||||||||| | |||||||| || |||||||| ||||| || Sbjct: 401 ggaagggcggtggttgttcatgctgatccggatgaccttggcaagggtggtcatgaactg 460 Query: 422 agtaaatcaacaggaaatgcaggagccaggattggatgtggtatcattgga 472 || | | ||||||||||| |||| || |||| ||||||||||||||| Sbjct: 461 agcacgaccacaggaaatgctggaggaagaattgcttgtggtatcattgga 511
>gb|AF054150.1|AF054150 Zantedeschia aethiopica cytosolic Cu/Zn-superoxide dismutase (sod3) mRNA, complete cds Length = 832 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| |||||||| |||||||| |||||||| || || ||||| || ||||||||| Sbjct: 481 ggaagggctgttgttgtccatgctgactctgatgatcttgggaaggggggacatgagctc 540 Query: 422 ag 423 || Sbjct: 541 ag 542
>gb|AF009734.1|AF009734 Capsicum annuum Cu/Zn superoxide dismutase (SOD) mRNA, complete cds Length = 730 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Plus Query: 374 gttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagtaaa 427 ||||||||||||||| ||||||| || |||||||| || |||||||||| |||| Sbjct: 395 gttgttcatgctgatcctgatgatcttggaaagggaggacatgagctcactaaa 448
>gb|AY646367.1| Malus xiaojinensis superoxide dismutase (Sod1) mRNA, complete cds Length = 805 Score = 58.0 bits (29), Expect = 4e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 365 agggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagt 424 ||||| |||||||| || || || |||||||||| || |||||||| |||||||| || Sbjct: 452 agggcggttgttgtccacgcagaccctgatgaccttggcaagggtggacatgagcttagc 511 Query: 425 aaatcaacaggaaatgc 441 ||||| ||||||||||| Sbjct: 512 aaatccacaggaaatgc 528
>emb|AJ250667.1|ACO250667 Ananas comosus mRNA for copper/zinc-superoxide dismutase (sod1 gene) Length = 820 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 368 gcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagct 420 ||||||||||| |||||||| ||||||| || ||||||||||| |||||||| Sbjct: 384 gcagttgttgtccatgctgaccctgatgatctcggaaagggtggacatgagct 436
>gb|AY109448.1| Zea mays CL1415_1 mRNA sequence Length = 1046 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 371 gttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctcag 423 ||||||||||| |||||| ||||||| || ||||||||||| || |||||||| Sbjct: 565 gttgttgttcacgctgatcctgatgatcttggaaagggtgggcacgagctcag 617
>gb|AY822477.1| Cordyceps militaris Cu,Zn superoxide dismutase mRNA, complete cds Length = 465 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||||||||||||| |||| ||||||| |||||||||||||| Sbjct: 132 cggcttccacatccatacctttggcgacaacaccaacggctgca 175
>ref|XM_652753.1| Aspergillus nidulans FGSC A4 superoxide dismutase (AN0241.2), mRNA Length = 537 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctgcaactcc 199 ||||||||||||||| |||||||||| |||||||||||||| |||| Sbjct: 130 ggcttccacatccaccagttcggcgacaacaccaacggctgcacctcc 177
>ref|XM_388897.1| Gibberella zeae PH-1 chromosome 2 SODC_NEUCR Superoxide dismutase (FG08721.1) partial mRNA Length = 501 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 155 ttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||| ||||||| |||| |||||||||||||| Sbjct: 154 ttccacatccacaccttcggtgacaacaccaacggctgca 193
>gb|AC156827.4| Medicago truncatula clone mth2-15c17, complete sequence Length = 110578 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 349 tcattccatactgggaagggcagttgttgttcatgctgattctgatga 396 |||||||||||| |||||||| || ||||||||||| ||| ||||||| Sbjct: 99968 tcattccatactcggaagggctgtcgttgttcatgccgatcctgatga 99921 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 176 gacaccaccaacggctgcaactccac 201 ||||||||||| |||||||||||||| Sbjct: 100885 gacaccaccaatggctgcaactccac 100860
>emb|X87372.1|LESODCC L.esculentum SodCc;Le;2 gene Length = 11053 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggt 409 ||||| || |||||||||||||||||| ||||||| || ||||||||| Sbjct: 7305 ggaagagctgttgttgttcatgctgatcctgatgatcttggaaagggt 7352
>emb|AJ278671.1|PTR278671 Populus tremula x Populus tremuloides mRNA for putative CuZn-superoxide dismutase (hipI-SOD1 gene) Length = 780 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 176 gacaccaccaacggctgcaactccaccggaccccatttcaatcc 219 ||||||||||| |||||||| ||||| ||||| ||||||||||| Sbjct: 223 gacaccaccaatggctgcaattccactggacctcatttcaatcc 266
>emb|AJ278670.1|PTR278670 Populus tremula x Populus tremuloides partial mRNA for putative CuZn-superoxide dismutase (hipI-SOD 2 gene) Length = 691 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 176 gacaccaccaacggctgcaactccaccggaccccatttcaatcc 219 ||||||||||| |||||||| ||||| ||||| ||||||||||| Sbjct: 167 gacaccaccaatggctgcaattccactggacctcatttcaatcc 210
>emb|AJ012739.1|CAR012739 Cicer arietinum mRNA for superoxide dismutase Length = 702 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| |||||||||||||||||| ||||||| || || || ||||| || ||||| Sbjct: 358 ggaagggctgttgttgttcatgctgatcctgatgatcttgggaaaggtggtcacgagctt 417 Query: 422 agtaaatcaacaggaaatgc 441 || ||| | || |||||||| Sbjct: 418 agcaaaactactggaaatgc 437 Score = 54.0 bits (27), Expect = 6e-04 Identities = 63/75 (84%) Strand = Plus / Plus Query: 146 ctccacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccaccgga 205 ||||| |||||||| || || ||||| || |||||||| || ||||||| || |||||| Sbjct: 142 ctccatggcttccatattcatgccttaggggacaccacaaatggctgcatatcaaccgga 201 Query: 206 ccccatttcaatcct 220 || |||||||||||| Sbjct: 202 ccacatttcaatcct 216
>emb|AJ012691.1|CAR012691 Cicer arietinum mRNA for superoxide dismutase Length = 809 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| |||||||||||||||||| ||||||| || || || ||||| || ||||| Sbjct: 381 ggaagggctgttgttgttcatgctgatcctgatgatcttgggaaaggtggtcacgagctt 440 Query: 422 agtaaatcaacaggaaatgc 441 || ||| | || |||||||| Sbjct: 441 agcaaaactactggaaatgc 460 Score = 54.0 bits (27), Expect = 6e-04 Identities = 63/75 (84%) Strand = Plus / Plus Query: 146 ctccacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccaccgga 205 ||||| |||||||| || || ||||| || |||||||| || ||||||| || |||||| Sbjct: 165 ctccatggcttccatattcatgccttaggggacaccacaaatggctgcatatcaaccgga 224 Query: 206 ccccatttcaatcct 220 || |||||||||||| Sbjct: 225 ccacatttcaatcct 239
>dbj|AB190501.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for CuZn-superoxide dismutase, complete cds, clone: PO3024C12 Length = 730 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatga 417 ||||||||||||||||||||||| ||| ||||||| || || ||||| || ||||| Sbjct: 414 ggaagggcagttgttgttcatgcagatcctgatgatcttggcaagggaggacatga 469
>dbj|AB190500.1| Populus alba x Populus tremula var. glandulosa CuZn-SOD mRNA for CuZn-superoxide dismutase, complete cds, clone: PO3023E02 Length = 725 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatga 417 ||||||||||||||||||||||| ||| ||||||| || || ||||| || ||||| Sbjct: 434 ggaagggcagttgttgttcatgcagatcctgatgatcttggcaagggaggacatga 489
>gb|AF281060.1|AF281060 Aspergillus nidulans Cu,Zn superoxide dismutase mRNA, partial cds Length = 462 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctgcaactcc 199 ||||||||||||||| |||||||||| |||||||||||||| |||| Sbjct: 130 ggcttccacatccaccagttcggcgacaacaccaacggctgcacctcc 177
>gb|AF305546.1|AF305546 Aspergillus nidulans Cu,Zn-superoxide dismutase (sodA) mRNA, complete cds Length = 678 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctgcaactcc 199 ||||||||||||||| |||||||||| |||||||||||||| |||| Sbjct: 185 ggcttccacatccaccagttcggcgacaacaccaacggctgcacctcc 232
>gb|AY176060.1| Paecilomyces tenuipes copper-zinc superoxide dismutase gene, complete cds Length = 969 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||| ||||||||| |||| ||||||| |||||||||||||| Sbjct: 522 cggctttcacatccacacctttggcgacaacaccaacggctgca 565
>gb|AY642137.1| Manihot esculenta copper/zinc superoxide dismutase mRNA, complete cds Length = 774 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatga 417 ||||||||||| ||||||||||| ||| ||||||| || |||||||| || ||||| Sbjct: 350 ggaagggcagtcgttgttcatgcagatcctgatgatcttggaaaggggggacatga 405
>dbj|AB062752.1| Bruguiera gymnorhiza SodC mRNA for copper/zinc superoxide dismutase, complete cds Length = 874 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatga 417 |||||||| |||||||||||||||||| ||||||| || || ||||| || ||||| Sbjct: 476 ggaagggctgttgttgttcatgctgatcctgatgatctgggcaagggagggcatga 531
>gb|AC130801.16| Medicago truncatula clone mth2-12p19, complete sequence Length = 119328 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 362 ggaagggcagttgttgttcatgctgattctgatga 396 |||||||| |||||||||||||||||| ||||||| Sbjct: 77707 ggaagggctgttgttgttcatgctgatcctgatga 77673
>gb|AF281058.1|AF281058 Aspergillus nidulans Cu,Zn superoxide dismutase gene, complete cds Length = 1777 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||||||||||||| |||||||||| |||||||||||||| Sbjct: 1053 ggcttccacatccaccagttcggcgacaacaccaacggctgca 1095
>emb|BX816203.1|CNS0AE91 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH34ZB02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 748 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 365 agggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctcag 423 ||||| |||||||||||||| || |||||||||| |||||||| || ||||| ||||| Sbjct: 435 agggctgttgttgttcatgcagaccctgatgacctcggaaagggagggcatgaactcag 493
>dbj|AB189024.1| Plutella xylostella gene for Cu/Zn superoxide dismutase, complete cds Length = 1138 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||||||| ||||| |||| |||||||||||||| Sbjct: 235 ggcttccacatccacgagttcggggacaacaccaacggctgca 277
>gb|AF076951.1|AF076951 Glomerella cingulata Cu-Zn superoxide dismutase (sod1) gene, complete cds Length = 1538 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 158 cacatccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 ||||||||| ||||||| |||| |||||||||||||| |||| |||| Sbjct: 860 cacatccacaccttcggtgacaacaccaacggctgcacctccgccgg 906
>gb|BT017337.1| Zea mays clone EL01N0321D04.c mRNA sequence Length = 756 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 371 gttgttgttcatgctgattctgatgacctaggaaagggtggccatgagct 420 ||||||||||| |||||| ||||||| || ||||||||||| || ||||| Sbjct: 408 gttgttgttcacgctgatcctgatgatcttggaaagggtgggcacgagct 457
>emb|X73139.1|IBSOD I.batatas mRNA for superoxide dismutase Length = 702 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 ||||| || ||||||||||||| |||| | ||||| || || || ||||||||||||||| Sbjct: 363 ggaagagctgttgttgttcatggtgatcccgatgatcttggtaaaggtggccatgagctc 422 Query: 422 ag 423 || Sbjct: 423 ag 424
>emb|X17564.1|ZMSOD4A Zea mays mRNA for superoxide dismutase-4A (Sod4A gene) Length = 691 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 371 gttgttgttcatgctgattctgatgacctaggaaagggtggccatgagct 420 ||||||||||| |||||| ||||||| || ||||||||||| || ||||| Sbjct: 394 gttgttgttcacgctgatcctgatgatcttggaaagggtgggcacgagct 443
>emb|AJ002604.1|PSAJ2604 Pinus sylvestris mRNA for novel high pI CuZn-superoxide dismutase Length = 1038 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 344 gggcctcattccatactgggaagggcagttgttgttcatgctgattctgatgacctagga 403 ||||| ||||| ||| | || |||||||||||||| || || ||| ||||||||| || Sbjct: 313 gggccacattcaatagttgggagggcagttgttgtgcacgcggatcgtgatgaccttggc 372 Query: 404 aagggtggccatgagctcagtaaatcaacaggaaatgc 441 | ||||| |||||||| || ||| ||||||||||||| Sbjct: 373 agaggtggacatgagctaagcaaaacaacaggaaatgc 410
>emb|AJ307586.1|PSY307586 Pinus sylvestris mRNA for superoxide dismutase (sod gene) Length = 1072 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 344 gggcctcattccatactgggaagggcagttgttgttcatgctgattctgatgacctagga 403 ||||| ||||| ||| | || |||||||||||||| || || ||| ||||||||| || Sbjct: 347 gggccacattcaatagttgggagggcagttgttgtgcacgcggatcgtgatgaccttggc 406 Query: 404 aagggtggccatgagctcagtaaatcaacaggaaatgc 441 | ||||| |||||||| || ||| ||||||||||||| Sbjct: 407 agaggtggacatgagctaagcaaaacaacaggaaatgc 444
>gb|AF054151.1|AF054151 Zantedeschia aethiopica Cu/Zn-superoxide dismutase precursor (sod4) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1246 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 129 ccggcctcgccccgggcctccacggcttccacatccacgccttcggcgacaccaccaacg 188 |||||||| | || |||||||||||||||||| | |||| | ||| ||||||||||| | Sbjct: 293 ccggcctcactcccggcctccacggcttccacctgcacgagtacggggacaccaccaatg 352 Query: 189 gctgca 194 |||||| Sbjct: 353 gctgca 358
>gb|AF034630.1|AF034630 Panax ginseng Cu/Zn superoxide dismutase (SOD) mRNA, complete cds Length = 624 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| || ||||| |||||||| |||||||| | ||||||||||| ||||| ||| Sbjct: 355 ggaagggccgtagttgtccatgctgaccctgatgacttgggaaagggtggtcatgaactc 414 Query: 422 ag 423 || Sbjct: 415 ag 416
>ref|NM_128379.2| Arabidopsis thaliana CSD2 (COPPER/ZINC SUPEROXIDE DISMUTASE 2); copper, zinc superoxide dismutase AT2G28190 (CSD2) mRNA, complete cds Length = 937 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 602 gatgacctcggaaagggtggccatgagct 630
>gb|DQ493760.1| Chaetomium thermophilum strain CT2 copper-zinc superoxide dismutase (CZ1) mRNA, complete cds Length = 712 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 158 cacatccacgccttcggcgacaccaccaacggctgca 194 |||| |||| |||||||||||| |||||||||||||| Sbjct: 139 cacacccacaccttcggcgacaacaccaacggctgca 175
>gb|BT012694.1| Lycopersicon esculentum clone 113564F, mRNA sequence Length = 1048 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagctcagt 424 |||||||| ||||||||||||||||| |||||| Sbjct: 606 gatgacctcggaaagggtggccatgaactcagt 638
>gb|AF527880.1| Lycopersicon esculentum superoxidase dismutase mRNA, complete cds Length = 963 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagctcagt 424 |||||||| ||||||||||||||||| |||||| Sbjct: 583 gatgacctcggaaagggtggccatgaactcagt 615
>emb|Y13610.1|CPCZSD Carica papaya mRNA for copper/zinc-superoxide dismutase Length = 768 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| |||||||| || |||||| ||||||| || || || || || ||||||||| Sbjct: 391 ggaagggctgttgttgtccacgctgatcctgatgatcttggcaaaggggggcatgagctc 450 Query: 422 agtaa 426 ||||| Sbjct: 451 agtaa 455
>gb|AY133756.1| Arabidopsis thaliana clone U18350 putative copper/zinc superoxide dismutase (At2g28190) mRNA, complete cds Length = 682 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 556 gatgacctcggaaagggtggccatgagct 584
>gb|AY064050.1| Arabidopsis thaliana putative copper/zinc superoxide dismutase (At2g28190) mRNA, complete cds Length = 939 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 602 gatgacctcggaaagggtggccatgagct 630
>emb|X17565.1|ZMSOD4 Zea mays mRNA for superoxide dismutase-4AP (Sod4AP gene) Length = 722 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Plus Query: 371 gttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctcag 423 ||||||||||| |||||| | ||||| || ||||||||||| || |||||||| Sbjct: 437 gttgttgttcacgctgatcccgatgatcttggaaagggtggacacgagctcag 489
>emb|X14041.1|LECHSOD Tomato mRNA for chloroplast Cu-Zn superoxide dismutase (SOD) Length = 1033 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagctcagt 424 |||||||| ||||||||||||||||| |||||| Sbjct: 590 gatgacctcggaaagggtggccatgaactcagt 622
>gb|DQ431473.1| Malus xiaojinensis Sod2 (Sod2) mRNA, complete cds Length = 805 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Plus Query: 365 agggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagt 424 |||||||||||||| |||| || | |||||||| || |||||||| |||||||| || Sbjct: 472 agggcagttgttgtccatggcgacccagatgacctgggcaagggtggacatgagcttagc 531 Query: 425 aaatcaacaggaaatgc 441 ||||| || |||||||| Sbjct: 532 aaatccactggaaatgc 548
>dbj|D49486.1| Solidago canadensis var. scabra mRNA for copper/zinc-superoxide dismutase precursor, complete cds, clone: SAcSODpl Length = 820 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Plus Query: 390 ctgatgacctaggaaagggtggccatgagctcagtaaatcaacaggaaatgcaggag 446 |||||||||| ||||||||||| |||||||| || ||||| ||||||||||||| Sbjct: 581 ctgatgacctcggaaagggtggtcatgagcttagcctctcaactggaaatgcaggag 637
>emb|BX821430.1|CNS0AA96 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL41ZA11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 629 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 323 gatgacctcggaaagggtggccatgagct 351
>emb|BX819296.1|CNS0AA8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZF01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 898 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 591 gatgacctcggaaagggtggccatgagct 619
>emb|BX821096.1|CNS0AA4R Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL14ZF12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 809 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 565 gatgacctcggaaagggtggccatgagct 593
>gb|AY087944.1| Arabidopsis thaliana clone 39796 mRNA, complete sequence Length = 939 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| |||||||||||||||||||| Sbjct: 604 gatgacctcggaaagggtggccatgagct 632
>dbj|AB066500.1| Barbula unguiculata mRNA for chloroplastic copper/zinc superoxide dismutase, complete cds Length = 946 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Plus Query: 395 gacctaggaaagggtggccatgagctcag 423 ||||| ||||||||||||||||||||||| Sbjct: 648 gaccttggaaagggtggccatgagctcag 676
>gb|M37151.1|TOMSODB Tomato superoxide dismutase (SOD) mRNA, complete cds Length = 1034 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagctcagt 424 |||||||| ||||||||||||||||| |||||| Sbjct: 590 gatgacctcggaaagggtggccatgaactcagt 622
>gb|DQ088818.1| Gossypium hirsutum cytoplasmic Cu/ZnSOD mRNA, complete cds Length = 459 Score = 48.1 bits (24), Expect = 0.036 Identities = 57/68 (83%) Strand = Plus / Plus Query: 374 gttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagtaaatcaaca 433 ||||| ||||| ||| | |||||||| || ||||| |||||||||||||| ||| ||| Sbjct: 349 gttgtccatgcagatcccgatgaccttggcaagggcggccatgagctcagcaaaagcaca 408 Query: 434 ggaaatgc 441 |||||||| Sbjct: 409 ggaaatgc 416
>emb|AJ344050.1|CPU344050 Claviceps purpurea sod1 gene for Cu/Zn-superoxide dismutase Length = 2620 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Plus Query: 155 ttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||| |||||| |||| ||||||| |||||||||||||| Sbjct: 1761 ttccatatccacacctttggcgacaacaccaacggctgca 1800
>emb|AJ278669.1|PTR278669 Populus tremula x Populus tremuloides mRNA for putative cytosolic CuZn-superoxide dismutase (cyt-SOD1 gene) Length = 851 Score = 48.1 bits (24), Expect = 0.036 Identities = 48/56 (85%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatga 417 |||||||| |||||||||||||| ||| ||||||| || || ||||| || ||||| Sbjct: 415 ggaagggctgttgttgttcatgcagatcctgatgatcttggcaagggaggacatga 470
>gb|AY176061.1| Cordyceps militaris copper-zinc superoxide dismutase gene, complete cds Length = 925 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 151 cggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||||||| || |||| ||||||| |||||||||||||| Sbjct: 467 cggcttccacattcatacctttggcgacaacaccaacggctgca 510
>gb|AY804513.1| Drosophila yakuba strain Tai18 sod (sod) gene, partial cds Length = 663 Score = 46.1 bits (23), Expect = 0.14 Identities = 59/71 (83%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccaccggaccc 208 ||||| |||||| | |||| |||||||||| |||||||||||||| || ||||||| Sbjct: 361 cacggattccacgtgcacgagttcggcgacaacaccaacggctgcatgtcgtccggaccg 420 Query: 209 catttcaatcc 219 || |||||||| Sbjct: 421 cacttcaatcc 431
>gb|DQ497636.1| Thermoascus aurantiacus var. levisporus Cu,Zn-superoxide dismutase (CZSOD-1) mRNA, complete cds Length = 705 Score = 46.1 bits (23), Expect = 0.14 Identities = 44/51 (86%) Strand = Plus / Plus Query: 154 cttccacatccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 ||||||||||||| ||||| |||| |||||||||||||| |||| |||| Sbjct: 135 cttccacatccaccagttcggtgacaacaccaacggctgcacctccgccgg 185
>emb|X61687.1|CASOD C.amoena sod gene for Cu,Zn superoxidase dismutase Length = 1920 Score = 46.1 bits (23), Expect = 0.14 Identities = 80/99 (80%) Strand = Plus / Plus Query: 377 gttcatgctgattctgatgacctaggaaagggtggccatgagctcagtaaatcaacagga 436 |||||||| ||| ||||||| | || |||||||| |||||| | || || ||||||||| Sbjct: 1282 gttcatgccgatcctgatgatttgggcaagggtggacatgagttgagcaagtcaacagga 1341 Query: 437 aatgcaggagccaggattggatgtggtatcattggaatt 475 ||||| || ||| | ||||| || ||| | ||||||||| Sbjct: 1342 aatgctggtgcccgtattggttgcggtgtaattggaatt 1380
>emb|AJ305146.1|PAN305146 Podospora anserina sod1 gene for copper/zinc superoxide dismutase, exons 1-4 Length = 1586 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Plus Query: 158 cacatccacgccttcggcgacaccaccaacggctgcaactccaccgg 204 ||||||||| |||| || |||| |||||||||||||| |||| |||| Sbjct: 591 cacatccacacctttggtgacaacaccaacggctgcacctccgccgg 637
>gb|AF127159.1| Drosophila yakuba Cu-Zn superoxide dismutase (Sod) gene, exons 1 and 2 and complete cds Length = 1563 Score = 46.1 bits (23), Expect = 0.14 Identities = 59/71 (83%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctgcaactccaccggaccc 208 ||||| |||||| | |||| |||||||||| |||||||||||||| || ||||||| Sbjct: 1211 cacggattccacgtgcacgagttcggcgacaacaccaacggctgcatgtcgtccggaccg 1270 Query: 209 catttcaatcc 219 || |||||||| Sbjct: 1271 cacttcaatcc 1281
>gb|AF061519.1|AF061519 Arabidopsis thaliana copper/zinc superoxide dismutase (CSD2) mRNA, nuclear gene encoding plastid protein, complete cds Length = 850 Score = 46.1 bits (23), Expect = 0.14 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| ||||||||||||||||| || Sbjct: 602 gatgacctcggaaagggtggccatgarct 630
>gb|U34727.1|ZMU34727 Zea mays superoxide dismutase 4A (sod4A) gene, complete cds Length = 4326 Score = 46.1 bits (23), Expect = 0.14 Identities = 35/39 (89%) Strand = Plus / Plus Query: 371 gttgttgttcatgctgattctgatgacctaggaaagggt 409 ||||||||||| |||||| ||||||| || ||||||||| Sbjct: 3134 gttgttgttcacgctgatcctgatgatcttggaaagggt 3172
>gb|U80069.1|MCU80069 Mesembryanthemum crystallinum cytosolic copper/zinc superoxide dismutase (SOD) mRNA, complete cds Length = 816 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Plus Query: 365 agggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctcag 423 ||||| || ||||| ||||||||| ||||||| || |||| ||| || ||||||||||| Sbjct: 470 agggctgtcgttgtccatgctgatcctgatgatcttggaagggggggacatgagctcag 528
>gb|AY823553.1| Pennisetum glaucum superoxide dismutase mRNA, partial cds Length = 439 Score = 44.1 bits (22), Expect = 0.56 Identities = 43/50 (86%) Strand = Plus / Plus Query: 371 gttgttgttcatgctgattctgatgacctaggaaagggtggccatgagct 420 ||||||||||| |||||| ||||||| || |||| |||||| || ||||| Sbjct: 100 gttgttgttcacgctgatcctgatgatcttggaaggggtgggcacgagct 149
>gb|DQ481231.1| Populus suaveolens cytoplasmic Cu/Zn-superoxide dismutase (SODcyt1) mRNA, complete cds Length = 487 Score = 44.1 bits (22), Expect = 0.56 Identities = 52/62 (83%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggtggccatgagctc 421 |||||||| ||||||||||||| ||| ||||||| || || ||||| || ||||| ||| Sbjct: 356 ggaagggctgttgttgttcatggagatcctgatgatcttggcaagggaggacatgaactc 415 Query: 422 ag 423 || Sbjct: 416 ag 417
>gb|AC091543.2| Felis catus clone RP86-588L5, complete sequence Length = 166752 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 353 tccatactgggaagggcagttg 374 |||||||||||||||||||||| Sbjct: 48272 tccatactgggaagggcagttg 48293
>emb|AL354668.13| Human DNA sequence from clone RP11-506P24 on chromosome 13 Contains the SPRY2 gene for sprouty homolog 2 (Drosophila) and a CpG island, complete sequence Length = 191652 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 566 gataataacattttgatgtgatatta 591 |||||||||||||||||||| ||||| Sbjct: 190997 gataataacattttgatgtgttatta 190972
>emb|AL162371.13| Human DNA sequence from clone RP11-16M10 on chromosome 13, complete sequence Length = 64028 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 566 gataataacattttgatgtgatatta 591 |||||||||||||||||||| ||||| Sbjct: 62684 gataataacattttgatgtgttatta 62709
>gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, complete sequence Length = 178351 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 571 taacattttgatgtgatattaa 592 |||||||||||||||||||||| Sbjct: 115397 taacattttgatgtgatattaa 115376
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 44.1 bits (22), Expect = 0.56 Identities = 40/46 (86%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||||||||||||||||| || |||||| ||||||||||||| Sbjct: 105245 cacggcttccacatccacgagtttggcgacgtgaccaacggctgca 105290
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome Length = 4202352 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 226 taaatcccatggagcacctgtt 247 |||||||||||||||||||||| Sbjct: 1171192 taaatcccatggagcacctgtt 1171213
>gb|AF512031.3| Choristoneura fumiferana MNPV polyhedrin, complete genome Length = 129593 Score = 44.1 bits (22), Expect = 0.56 Identities = 40/46 (86%) Strand = Plus / Minus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||||| ||| | |||| ||||||||||||| ||||||||||| Sbjct: 21272 cacggctttcacgttcacgagttcggcgacaccagcaacggctgca 21227
>ref|NM_211408.1| Eremothecium gossypii AGL321Wp (AGL321W), mRNA Length = 522 Score = 44.1 bits (22), Expect = 0.56 Identities = 40/46 (86%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||||||||||||||||| || |||||| ||||||||||||| Sbjct: 187 cacggcttccacatccacgagtttggcgacgtgaccaacggctgca 232
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 169 cttcggcgacaccaccaacggc 190 |||||||||||||||||||||| Sbjct: 3710641 cttcggcgacaccaccaacggc 3710662
>gb|AY103754.1| Zea mays PCO107770 mRNA sequence Length = 910 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 ggcgacaccaccaacggctgca 194 |||||||||||||||||||||| Sbjct: 343 ggcgacaccaccaacggctgca 364
>gb|AF021822.1|AF021822 Scaptodrosophila lebanonensis superoxide dismutase (Sod) mRNA, partial cds Length = 439 Score = 44.1 bits (22), Expect = 0.56 Identities = 61/74 (82%) Strand = Plus / Plus Query: 374 gttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagtaaatcaaca 433 ||||||||||||||| | ||||| | || || |||||||||||||| || || || || Sbjct: 326 gttgttcatgctgatcccgatgatttgggcaaaggtggccatgagctgagcaagtcgact 385 Query: 434 ggaaatgcaggagc 447 |||||||| ||||| Sbjct: 386 ggaaatgctggagc 399
>gb|M15175.1|MZESOD2A Maize superoxide dismutase 2 (SOD2) mRNA, complete cds Length = 694 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 ggcgacaccaccaacggctgca 194 |||||||||||||||||||||| Sbjct: 181 ggcgacaccaccaacggctgca 202
>gb|M54936.1|MZESOD2 Maize superoxide dismutase-2 (Sod-2) mRNA, complete cds Length = 694 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 ggcgacaccaccaacggctgca 194 |||||||||||||||||||||| Sbjct: 181 ggcgacaccaccaacggctgca 202
>ref|XM_420966.1| PREDICTED: Gallus gallus similar to hypothetical protein LOC233733 (LOC423034), mRNA Length = 2360 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 546 gaaacactgatatcgttcaagataa 570 ||||||||||||| ||||||||||| Sbjct: 892 gaaacactgatattgttcaagataa 868
>gb|DQ226932.1| Boechera divaricarpa isolate SLW-E-A10 mRNA sequence Length = 519 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagct 420 |||||||| ||||||||||| |||||||| Sbjct: 406 gatgacctcggaaagggtggacatgagct 434
>gb|AY736282.1| Salmo salar Cu/Zn superoxide dismutase (SOD1) mRNA, complete cds Length = 697 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctg 192 ||||||||| |||| ||||| || |||| |||||||||||| Sbjct: 133 ggcttccacgtccatgcctttggagacaacaccaacggctg 173
>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome Length = 1842899 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 226 taaatcccatggagcacctgt 246 ||||||||||||||||||||| Sbjct: 342001 taaatcccatggagcacctgt 342021
>emb|X58578.1|PSCUZNPS3 P.sylvestris mRNA for CuZn superoxide dismutase, clone PS3 Length = 821 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Plus Query: 374 gttgttcatgctgattctgatgacctaggaaagggtggccatgagctcagtaa 426 ||||| ||||||||| ||||||| || || || ||||||||||| || ||||| Sbjct: 467 gttgtccatgctgatcctgatgatcttggcaaaggtggccatgaactgagtaa 519
>emb|AJ844839.1| Drosophila malerkotliana malerkotliana partial Sod gene, exons 1-2, strain Raichuri Length = 1000 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Plus Query: 142 gggcctccacggcttccacatccacgccttcggcgacaccaccaacggctgca 194 |||||| ||||||||||| | |||| || ||||||| |||||||||||||| Sbjct: 711 gggcctgcacggcttccatgtgcacgaatttggcgacaacaccaacggctgca 763
>emb|BX323842.8| Zebrafish DNA sequence from clone CH211-1M7, complete sequence Length = 162929 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 570 ataacattttgatgtgatatt 590 ||||||||||||||||||||| Sbjct: 46571 ataacattttgatgtgatatt 46591
>gb|DQ417491.1| Chlamydomonas reinhardtii DP1 mRNA, complete cds Length = 1707 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 36 tcagcggcggtggcgccgacagcgc 60 |||||||||||||||||| |||||| Sbjct: 1645 tcagcggcggtggcgccgccagcgc 1621
>gb|DQ417198.1| Spodoptera exigua MNPV isolate SeMNPV-bj superoxide dismutase (SOD) gene, partial cds Length = 456 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 170 ttcggcgacaccaccaacggctgca 194 ||||||||||||| ||||||||||| Sbjct: 318 ttcggcgacaccagcaacggctgca 294
>gb|AF426829.1|AF426829 Olea europaea Cu/Zn-superoxide dismutase mRNA, partial cds Length = 312 Score = 42.1 bits (21), Expect = 2.2 Identities = 57/69 (82%) Strand = Plus / Plus Query: 152 ggcttccacatccacgccttcggcgacaccaccaacggctgcaactccaccggaccccat 211 |||||||| |||||||| | || ||||||||||| ||||| | || || ||||| ||| Sbjct: 13 ggcttccatgtccacgcccttggtgacaccaccaatggctgtatgtcaactggacctcat 72 Query: 212 ttcaatcct 220 ||||||||| Sbjct: 73 ttcaatcct 81
>gb|AF083061.1|AF083061 Pseudomonas fluorescens protease PrtA (prtA), protease inhibitor Inh (inh), ABC transporter TliD (tliD), ABC transporter TliE (tliE), ABC transporter TliF (tliF), and thermostable lipase TliA (tliA) genes, complete cds Length = 8580 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 172 cggcgacaccaccaacggctgcaactcca 200 ||||||||||||| |||||| |||||||| Sbjct: 1086 cggcgacaccacctacggcttcaactcca 1114
>dbj|AB004870.1| Marchantia paleacea var. diptera mRNA for CuZn-superoxide dismutase, complete cds Length = 824 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 392 gatgacctaggaaagggtggccatgagctcagt 424 |||||||| ||||||||||| || ||||||||| Sbjct: 490 gatgaccttggaaagggtgggcacgagctcagt 522
>gb|U75930.2|OPU75930 Orgyia pseudotsugata multicapsid nucleopolyhedrovirus, complete genome Length = 131995 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 170 ttcggcgacaccaccaacggctgca 194 ||||||||||||| ||||||||||| Sbjct: 23921 ttcggcgacaccagcaacggctgca 23897
>dbj|AK173469.1| Ciona intestinalis cDNA, clone:cieg045a23, full insert sequence Length = 1928 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 493 aacaaatataagagccattgg 513 ||||||||||||||||||||| Sbjct: 1351 aacaaatataagagccattgg 1371
>gb|AF021829.1|AF021829 Drosophila paulistorum superoxide dismutase (Sod) mRNA, partial cds Length = 439 Score = 42.1 bits (21), Expect = 2.2 Identities = 42/49 (85%) Strand = Plus / Plus Query: 173 ggcgacaccaccaacggctgcaactccaccggaccccatttcaatcctc 221 ||||||| ||||||||| |||| ||| | || |||||||||||||||| Sbjct: 125 ggcgacaacaccaacggatgcatgtcctctggcccccatttcaatcctc 173
>gb|AC145973.3| Gallus gallus BAC clone CH261-2E2 from chromosome unknown, complete sequence Length = 190804 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 600 agttatgtaaatgtatacaag 620 ||||||||||||||||||||| Sbjct: 32571 agttatgtaaatgtatacaag 32551
>dbj|AB015053.1| Pseudomonas fluorescens genes for ABC exporter operon, complete cds Length = 14988 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 172 cggcgacaccaccaacggctgcaactcca 200 ||||||||||||| |||||| |||||||| Sbjct: 1066 cggcgacaccacctacggcttcaactcca 1094
>ref|XM_632054.1| Dictyostelium discoideum hypothetical protein (DDB0187566), partial mRNA Length = 2037 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 574 cattttgatgtgatattaat 593 |||||||||||||||||||| Sbjct: 211 cattttgatgtgatattaat 192
>ref|NM_001016252.2| Xenopus tropicalis hypothetical protein LOC549006 (LOC549006), mRNA Length = 744 Score = 40.1 bits (20), Expect = 8.7 Identities = 38/44 (86%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctg 192 ||||||||||| ||||| | || ||||||| |||||||||||| Sbjct: 140 cacggcttccatatccatgagtttggcgacaacaccaacggctg 183
>gb|AY389727.1| Hyacinthus orientalis unknown mRNA Length = 855 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 283 acaagccaacaaggatggcg 302 |||||||||||||||||||| Sbjct: 233 acaagccaacaaggatggcg 252
>gb|AY596922.1| Ctenopharyngodon idella aryl hydrocarbon receptor nuclear translocator 2c (arnt2c) mRNA, complete cds Length = 2297 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 ggtgagggggagggtctccggcct 135 |||||||| ||||||||||||||| Sbjct: 2169 ggtgagggtgagggtctccggcct 2146
>gb|AY596921.1| Ctenopharyngodon idella aryl hydrocarbon receptor nuclear translocator 2b (arnt2b) mRNA, complete cds Length = 2342 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 ggtgagggggagggtctccggcct 135 |||||||| ||||||||||||||| Sbjct: 2214 ggtgagggtgagggtctccggcct 2191
>ref|XM_958710.1| Neurospora crassa OR74A hypothetical protein (NCU00803.1) partial mRNA Length = 1479 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 agggcagttgttgttcatgc 384 |||||||||||||||||||| Sbjct: 955 agggcagttgttgttcatgc 974
>ref|XM_324982.1| Neurospora crassa OR74A hypothetical protein (NCU00803.1) partial mRNA Length = 1479 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 agggcagttgttgttcatgc 384 |||||||||||||||||||| Sbjct: 955 agggcagttgttgttcatgc 974
>gb|DQ440061.1| Aedes aegypti clone AE-321 Cu2+/Zn2+ superoxide dismutase mRNA, complete cds Length = 462 Score = 40.1 bits (20), Expect = 8.7 Identities = 35/40 (87%) Strand = Plus / Plus Query: 155 ttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||||||||||| ||||| |||| ||||||||| |||| Sbjct: 130 ttccacatccacgagttcggtgacaacaccaacggatgca 169
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 agcggcggtggcgccgacag 57 |||||||||||||||||||| Sbjct: 29087 agcggcggtggcgccgacag 29106
>emb|AJ971950.1| Pinus pinea partial mRNA for chloroplast CuZn superoxide dismutase (cuZnsodchl gene) Length = 233 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 116 gatgatgtacgccatgcgggtgacctgggaaacata 151
>ref|XM_816448.1| Trypanosoma cruzi strain CL Brener AMP deaminase (Tc00.1047053506885.390) partial mRNA Length = 4290 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 427 atcaacaggaaatgcaggag 446 |||||||||||||||||||| Sbjct: 4037 atcaacaggaaatgcaggag 4056
>ref|XM_813770.1| Trypanosoma cruzi strain CL Brener AMP deaminase (Tc00.1047053510729.10) partial mRNA Length = 2939 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 427 atcaacaggaaatgcaggag 446 |||||||||||||||||||| Sbjct: 2686 atcaacaggaaatgcaggag 2705
>gb|AC110157.7| Mus musculus chromosome 14, clone RP23-151K23, complete sequence Length = 243114 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccatttcaatcctcttaata 227 |||||||||||||||||||| Sbjct: 122341 ccatttcaatcctcttaata 122322
>emb|AL732605.6| Human DNA sequence from clone RP11-84C12 on chromosome 1 Contains part of a novel gene, complete sequence Length = 23640 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 487 ttaacaaacaaatataagag 506 |||||||||||||||||||| Sbjct: 16542 ttaacaaacaaatataagag 16523
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 tggcgccgacagcgctgtcg 65 |||||||||||||||||||| Sbjct: 1437583 tggcgccgacagcgctgtcg 1437602
>emb|X58579.1|PSCUZNPST P.sylvestris mRNA for CuZn superoxide dismutase, clone PST13 Length = 676 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 188 gatgatgtacgccatgcgggtgacctgggaaacata 223
>emb|X14352.1|PHSOD Petunia mRNA for chloroplast superoxide dismutase (SOD) (EC 1.15.1.1) Length = 937 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 197 tccaccggaccccatttcaatcct 220 ||||| |||||||||||||||||| Sbjct: 433 tccacaggaccccatttcaatcct 456
>emb|BX538353.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 4/4 Length = 277703 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 236 ggagcacctgttgatgatgaacgacatg 263 |||||||| |||||||||||| |||||| Sbjct: 120782 ggagcaccagttgatgatgaaggacatg 120755
>gb|AY867726.1| Pinus taeda isolate FBRC32 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 347 gatgatgtacgccatgcgggtgacctgggaaacata 382
>gb|AY867725.1| Pinus taeda isolate FBRC31 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 347 gatgatgtacgccatgcgggtgacctgggaaacata 382
>gb|AY867724.1| Pinus taeda isolate FBRC30 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867723.1| Pinus taeda isolate FBRC29 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867722.1| Pinus taeda isolate FBRC28 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867721.1| Pinus taeda isolate FBRC27 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 347 gatgatgtacgccatgcgggtgacctgggaaacata 382
>gb|AY867720.1| Pinus taeda isolate FBRC26 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 691 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867719.1| Pinus taeda isolate FBRC25 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867718.1| Pinus taeda isolate FBRC24 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 691 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867717.1| Pinus taeda isolate FBRC23 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867716.1| Pinus taeda isolate FBRC22 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867715.1| Pinus taeda isolate FBRC21 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 691 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867714.1| Pinus taeda isolate FBRC20 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867713.1| Pinus taeda isolate FBRC19 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867712.1| Pinus taeda isolate FBRC18 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867711.1| Pinus taeda isolate FBRC17 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 687 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867710.1| Pinus taeda isolate FBRC16 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867709.1| Pinus taeda isolate FBRC15 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 687 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867708.1| Pinus taeda isolate FBRC14 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867707.1| Pinus taeda isolate FBRC13 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867706.1| Pinus taeda isolate FBRC12 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867705.1| Pinus taeda isolate FBRC11 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867704.1| Pinus taeda isolate FBRC10 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867703.1| Pinus taeda isolate FBRC9 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867702.1| Pinus taeda isolate FBRC8 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867701.1| Pinus taeda isolate FBRC7 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 691 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AY867700.1| Pinus taeda isolate FBRC6 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867699.1| Pinus taeda isolate FBRC5 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 347 gatgatgtacgccatgcgggtgacctgggaaacata 382
>gb|AY867698.1| Pinus taeda isolate FBRC4 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 347 gatgatgtacgccatgcgggtgacctgggaaacata 382
>gb|AY867697.1| Pinus taeda isolate FBRC3 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 688 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 346 gatgatgtacgccatgcgggtgacctgggaaacata 381
>gb|AY867696.1| Pinus taeda isolate FBRC2 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 690 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 347 gatgatgtacgccatgcgggtgacctgggaaacata 382
>gb|AY867695.1| Pinus taeda isolate FBRC1 chloroplast Cu/Zn superoxide dismutase (sod-chl) gene, partial cds; nuclear gene for chloroplast product Length = 691 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 348 gatgatgtacgccatgcgggtgacctgggaaacata 383
>gb|AF324976.1|AF324976 Drosophila polychaeta dopa decarboxylase (Ddc) gene, exon 4 and partial cds Length = 1134 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 gcagcctcaagggcgtcgcc 31 |||||||||||||||||||| Sbjct: 473 gcagcctcaagggcgtcgcc 454
>gb|AF434186.1|AF434186 Pinus pinaster Cu-Zn-superoxide dismutase precursor, mRNA, complete cds; nuclear gene for chloroplast product Length = 961 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Plus Query: 248 gatgatgaacgacatgtgggcgacctgggaaacata 283 ||||||| ||| |||| ||| ||||||||||||||| Sbjct: 409 gatgatgtacgccatgcgggtgacctgggaaacata 444
>ref|XM_627811.1| Cryptosporidium parvum Iowa II serine protease (cgd6_4840), partial mRNA Length = 3594 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 236 ggagcacctgttgatgatgaacgacatg 263 |||||||| |||||||||||| |||||| Sbjct: 1072 ggagcaccagttgatgatgaaggacatg 1099
>emb|AL844563.15| Zebrafish DNA sequence from clone DKEY-5O10 in linkage group 7, complete sequence Length = 227750 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 589 ttaatgtgatcagttatgta 608 |||||||||||||||||||| Sbjct: 187292 ttaatgtgatcagttatgta 187311
>gb|AC156800.2| Mus musculus BAC clone RP23-366B23 from chromosome 9, complete sequence Length = 190619 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 318 taaaggacttacagatttca 337 |||||||||||||||||||| Sbjct: 188720 taaaggacttacagatttca 188701
>gb|AF127157.1| Drosophila sechellia Cu-Zn superoxide dismutase (Sod) gene, exons 1 and 2 and complete cds Length = 1532 Score = 40.1 bits (20), Expect = 8.7 Identities = 38/44 (86%) Strand = Plus / Plus Query: 176 gacaccaccaacggctgcaactccaccggaccccatttcaatcc 219 |||| |||||||||||||| || |||||||||| |||||||| Sbjct: 1207 gacaacaccaacggctgcatgtcatccggaccccacttcaatcc 1250
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 166 cgccttcggcgacaccacca 185 |||||||||||||||||||| Sbjct: 2685636 cgccttcggcgacaccacca 2685617
>gb|AY257198.1| Lotus corniculatus var. japonicus cytosolic CuZn-superoxide dismutase (sodCc) gene, complete cds Length = 3172 Score = 40.1 bits (20), Expect = 8.7 Identities = 41/48 (85%) Strand = Plus / Plus Query: 146 ctccacggcttccacatccacgccttcggcgacaccaccaacggctgc 193 ||||| |||||||| |||| ||||| || ||||||||||| |||||| Sbjct: 593 ctccatggcttccatgtccatgccttgggtgacaccaccaatggctgc 640
>dbj|AB091055.1| Barbula unguiculata mRNA for cytosolic copper/zinc superoxide dismutase, partial cds Length = 276 Score = 40.1 bits (20), Expect = 8.7 Identities = 44/52 (84%) Strand = Plus / Plus Query: 143 ggcctccacggcttccacatccacgccttcggcgacaccaccaacggctgca 194 ||||||||||| |||||| | |||||| | || ||||| ||||| ||||||| Sbjct: 1 ggcctccacggattccacgttcacgccctgggtgacacaaccaatggctgca 52
>gb|AF016893.1|AF016893 Populus tremuloides copper/zinc-superoxide dismutase (SodCc1) gene, complete cds Length = 4390 Score = 40.1 bits (20), Expect = 8.7 Identities = 41/48 (85%) Strand = Plus / Plus Query: 362 ggaagggcagttgttgttcatgctgattctgatgacctaggaaagggt 409 |||||||| ||||||||||||| ||| ||||||| || || |||||| Sbjct: 3203 ggaagggctgttgttgttcatggagatcctgatgatcttggcaagggt 3250
>gb|AC007372.4|AC007372 Homo sapiens chromosome 14 BAC containing gene for type 2 iodothyronine deiodinase (DIO2) gene, complete CDS, complete sequence Length = 154796 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 567 ataataacattttgatgtgatatt 590 |||| ||||||||||||||||||| Sbjct: 15205 ataaaaacattttgatgtgatatt 15182
>emb|CR761750.2| Xenopus tropicalis finished cDNA, clone TGas107m24 Length = 744 Score = 40.1 bits (20), Expect = 8.7 Identities = 38/44 (86%) Strand = Plus / Plus Query: 149 cacggcttccacatccacgccttcggcgacaccaccaacggctg 192 ||||||||||| ||||| | || ||||||| |||||||||||| Sbjct: 140 cacggcttccatatccatgagtttggcgacaacaccaacggctg 183
>emb|AL049837.4|CNS0000F Human chromosome 14 DNA sequence BAC R-959A22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 168677 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 567 ataataacattttgatgtgatatt 590 |||| ||||||||||||||||||| Sbjct: 159947 ataaaaacattttgatgtgatatt 159970
>emb|AL928899.10| Mouse DNA sequence from clone RP23-347C2 on chromosome 2, complete sequence Length = 192677 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 613 tatacaagtaccttgatatcttct 636 ||||||||||||||||||| |||| Sbjct: 85937 tatacaagtaccttgatatattct 85960
>emb|CT009651.1| Medicago truncatula chromosome 5 clone mte1-70c15, COMPLETE SEQUENCE Length = 110880 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 604 atgtaaatgtatacaagtac 623 |||||||||||||||||||| Sbjct: 25214 atgtaaatgtatacaagtac 25233
>gb|AC165257.2| Mus musculus BAC clone RP23-162D3 from chromosome 9, complete sequence Length = 181162 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 318 taaaggacttacagatttca 337 |||||||||||||||||||| Sbjct: 69091 taaaggacttacagatttca 69072 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,903,286 Number of Sequences: 3902068 Number of extensions: 5903286 Number of successful extensions: 127406 Number of sequences better than 10.0: 191 Number of HSP's better than 10.0 without gapping: 185 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 126732 Number of HSP's gapped (non-prelim): 677 length of query: 638 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 615 effective length of database: 17,143,297,704 effective search space: 10543128087960 effective search space used: 10543128087960 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
