Clone Name	baal21e24
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, compl...	1304	0.0
2	emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase	1296	0.0
3	gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, p...	1243	0.0
4	emb|Z99634.1|SCCATALAS Secale cereale mRNA for catalase (cat2 gene)	938	0.0
5	dbj|AK100019.1| Oryza sativa (japonica cultivar-group) cDNA clon...	813	0.0
6	dbj|AK069446.1| Oryza sativa (japonica cultivar-group) cDNA clon...	813	0.0
7	gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRN...	805	0.0
8	dbj|D26484.1|RICPOSCATB Oryza sativa (japonica cultivar-group) m...	805	0.0
9	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	783	0.0
10	dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic D...	783	0.0
11	dbj|D64013.1| Oryza sativa (japonica cultivar-group) CatB gene f...	775	0.0
12	gb|AY103601.1| Zea mays PCO144994 mRNA sequence	630	e-177
13	gb|U16132.1|HVU16132 Hordeum vulgare catalase mRNA, partial cds	630	e-177
14	gb|AF475100.1| Triticum aestivum catalase isozyme mRNA, partial cds	622	e-175
15	emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (E...	615	e-173
16	gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence	599	e-168
17	emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1	561	e-156
18	ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalas...	232	1e-57
19	ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); cata...	232	1e-57
20	gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090...	232	1e-57
21	gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090...	232	1e-57
22	gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.1...	232	1e-57
23	emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase	216	7e-53
24	gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, c...	212	1e-51
25	gb|AY641732.1| Camellia sinensis catalase mRNA, partial cds	210	4e-51
26	emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ...	178	2e-41
27	emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA...	178	2e-41
28	emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA...	178	2e-41
29	emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit ...	161	4e-36
30	gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, comple...	149	1e-32
31	emb|X94447.1|ATCATAL A.thaliana cat gene for catalase	147	5e-32
32	gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA...	147	5e-32
33	ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalas...	135	2e-28
34	gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, comple...	135	2e-28
35	gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence	135	2e-28
36	gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds	135	2e-28
37	gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630...	135	2e-28
38	gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds	131	3e-27
39	emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 ...	129	1e-26
40	gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, ...	127	5e-26
41	gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, com...	127	5e-26
42	emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 ...	125	2e-25
43	gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA...	125	2e-25
44	emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8	125	2e-25
45	gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, com...	123	8e-25
46	gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catala...	123	8e-25
47	gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds	121	3e-24
48	gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, comp...	121	3e-24
49	emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subun...	119	1e-23
50	gb|AF151368.1|AF151368 Hevea brasiliensis catalase (cat) mRNA, c...	117	5e-23
51	gb|AY170463.1| Morus alba catalase (CAT1) mRNA, partial cds	117	5e-23
52	gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds	113	8e-22
53	gb|AY987854.1| Euphorbia characias catalase mRNA, complete cds	113	8e-22
54	gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, co...	113	8e-22
55	emb|Z99633.1|SACATALAS Soldanella alpina mRNA for catalase (cat1...	111	3e-21
56	emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 ...	111	3e-21
57	gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds	111	3e-21
58	gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, com...	111	3e-21
59	dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds	111	3e-21
60	gb|AF243518.1|AF243518 Helianthus annuus catalase 3 (CATA3) mRNA...	109	1e-20
61	ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalas...	107	5e-20
62	ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalas...	107	5e-20
63	ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata...	107	5e-20
64	ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata...	107	5e-20
65	ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); cata...	107	5e-20
66	gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, comp...	107	5e-20
67	gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, comp...	107	5e-20
68	emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Co...	107	5e-20
69	gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana...	107	5e-20
70	gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana...	107	5e-20
71	emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 ...	105	2e-19
72	emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, par...	105	2e-19
73	gb|AF443179.1|AF443179 Nicotiana tabacum catalase mRNA, partial cds	105	2e-19
74	emb|AJ302710.1|BPE302710 Betula pendula partial mRNA for catalas...	103	7e-19
75	emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catal...	103	7e-19
76	gb|AY338958.1| Cucumis sativus catalase-like (cat) mRNA, partial...	101	3e-18
77	emb|AJ295295.1|BPE295295 Betula pendula partial mRNA for catalas...	100	1e-17
78	gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, c...	100	1e-17
79	gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, com...	100	1e-17
80	gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, com...	100	1e-17
81	gb|U43147.1|ATU43147 Arabidopsis thaliana catalase 3 (CAT3) gene...	100	1e-17
82	gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) an...	100	1e-17
83	dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds	100	1e-17
84	gb|AF295641.1| Beta vulgaris catalase (cat) mRNA, partial cds	96	2e-16
85	gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete s...	94	7e-16
86	emb|AJ538651.1|NTA538651 Nicotiana tabacum cDNA-AFLP-fragment BC...	94	7e-16
87	dbj|D63384.1|CUSCA Cucumis sativus mRNA for catalase, partial cd...	94	7e-16
88	dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete...	90	1e-14
89	emb|X60169.1|PSCATAL Pisum sativum mRNA for catalase	88	4e-14
90	gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial...	88	4e-14
91	gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRN...	88	4e-14
92	gb|DQ226689.1| Boechera divaricarpa isolate SLW-348-443-G06 mRNA...	86	2e-13
93	gb|DQ124022.1| Coffea arabica clone MN-SSH2-H06 mRNA sequence	86	2e-13
94	gb|AY162277.1| Prunus armeniaca catalase1 (CAT1) mRNA, partial cds	86	2e-13
95	gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds	82	3e-12
96	emb|Z12021.1|GMCATALG G.max gene for catalase	82	3e-12
97	gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds	82	3e-12
98	gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complet...	80	1e-11
99	emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8	78	4e-11
100	emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1...	78	4e-11
101	dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1,...	76	2e-10
102	gb|AY726007.1| Petunia x hybrida catalase gene, partial cds	74	7e-10
103	emb|AJ973128.1| Andrographis paniculata partial cat gene for put...	74	7e-10
104	emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2	74	7e-10
105	emb|AJ299450.1|PPI299450 Pinus pinea partial mRNA for catalase 1...	74	7e-10
106	emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene	74	7e-10
107	gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, ...	74	7e-10
108	gb|AY110648.1| Zea mays CL1739_1 mRNA sequence	74	7e-10
109	gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1...	74	7e-10
110	gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complet...	74	7e-10
111	gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complet...	74	7e-10
112	gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complet...	74	7e-10
113	gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1...	74	7e-10
114	gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end	74	7e-10
115	ref|XM_470174.1| Oryza sativa (japonica cultivar-group), predic...	70	1e-08
116	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	70	1e-08
117	gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase m...	70	1e-08
118	gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome...	70	1e-08
119	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	70	1e-08
120	dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	1e-08
121	dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	1e-08
122	dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds	70	1e-08
123	dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene f...	70	1e-08
124	gb|AF139539.2|AF139539 Raphanus sativus catalase 3 (Cat3) mRNA, ...	68	4e-08
125	gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C m...	66	2e-07
126	gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, comp...	66	2e-07
127	gb|AF096252.1|AF096252 Lycopersicon esculentum ethylene-responsi...	66	2e-07
128	gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA...	66	2e-07
129	dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone...	66	2e-07
130	gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, part...	64	6e-07
131	gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid bindin...	62	2e-06
132	gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase...	62	2e-06
133	gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA,...	62	2e-06
134	dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds	62	2e-06
135	emb|AJ616025.1| Homogyne alpina mRNA for catalase (cat1 gene)	60	1e-05
136	gb|DQ004737.1| Phaseolus lunatus catalase (CAT1) mRNA, partial cds	60	1e-05
137	gb|AY507670.1| Malus x domestica catalase (CAT) mRNA, partial cds	58	4e-05
138	gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, com...	58	4e-05
139	emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 ...	56	2e-04
140	gb|AF069320.1|AF069320 Mesembryanthemum crystallinum root catala...	54	6e-04
141	gb|U89384.1|PAU89384 Pseudomonas aeruginosa paraquat inducible c...	54	6e-04
142	gb|U34896.1|PAU34896 Pseudomonas aeruginosa catalase (katB) gene...	54	6e-04
143	emb|Y13220.1|CRCATALAS Chlamydomonas reinhardtii mRNA for catalase	52	0.002
144	gb|AF016902.1|AF016902 Chlamydomonas reinhardtii catalase (CAT) ...	52	0.002
145	gb|AF332973.2| Zantedeschia aethiopica catalase 2 (Cat2) mRNA, c...	50	0.009
146	gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ...	50	0.009
147	gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome	50	0.009
148	emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (par...	50	0.009
149	emb|AJ005939.1|MBA005939 Methanosarcina barkeri kat gene	50	0.009
150	emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene)	50	0.009
151	gb|AF170272.1|AF170272 Manihot esculenta catalase CAT1 mRNA, com...	50	0.009
152	gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA...	50	0.009
153	ref|XM_365841.1| Magnaporthe grisea 70-15 hypothetical protein (...	48	0.037
154	emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase	48	0.037
155	gb|BC051626.1| Danio rerio catalase, mRNA (cDNA clone MGC:56675 ...	46	0.15
156	ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.15
157	ref|XM_463869.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.15
158	ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.15
159	gb|AF170069.1| Danio rerio catalase mRNA, complete cds	46	0.15
160	gb|DQ493908.1| Anguilla anguilla catalase mRNA, partial cds	46	0.15
161	emb|AJ007505.1|DRE7505 Danio rerio mRNA for catalase	46	0.15
162	emb|Z99108.2|BSUB0005 Bacillus subtilis complete genome (section...	46	0.15
163	emb|Z82044.1|BSZ82044 Bacillus subtilis 25 kb genomic DNA segmen...	46	0.15
164	emb|Z54143.2|SSCATMR Secale cereale mRNA for catalase (cat1a gene)	46	0.15
165	emb|X97673.1|XOKATX X.oryzae katX gene	46	0.15
166	emb|X61626.1|OSCATAL O.sativa mRNA for catalase	46	0.15
167	ref|NM_130912.1| Danio rerio catalase (cat), mRNA	46	0.15
168	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	46	0.15
169	gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds	46	0.15
170	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.15
171	gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds	46	0.15
172	dbj|AB046412.1| Bacillus subtilis katA gene for catalase, comple...	46	0.15
173	gb|AE004875.1| Pseudomonas aeruginosa PAO1, section 436 of 529 o...	46	0.15
174	dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic D...	46	0.15
175	dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D...	46	0.15
176	emb|AJ234404.1|HVU234404 Hordeum vulgare partial mRNA; clone cMW...	46	0.15
177	dbj|AK099923.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.15
178	dbj|AK099231.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.15
179	emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl...	46	0.15
180	dbj|AK065094.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.15
181	gb|CP000009.1| Gluconobacter oxydans 621H, complete genome	46	0.15
182	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	46	0.15
183	gb|AF021939.1|AF021939 Hordeum vulgare catalase 2 (CAT2) gene, p...	46	0.15
184	gb|U20778.1|HVU20778 Hordeum vulgare catalase (Cat2) mRNA, compl...	46	0.15
185	gb|M80796.1|BACDNA Bacillus subtilis vegetative catalase (kat-19...	46	0.15
186	gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, compl...	46	0.15
187	dbj|D29966.1|RICCA Rice CatA gene for catalase, complete cds	46	0.15
188	emb|X05549.1|IBCATR Seet potato mRNA for catalase (EC 1.11.1.6)	44	0.58
189	gb|AY159321.1| Simian immunodeficiency virus isolate SIVdrl1FAO,...	44	0.58
190	gb|U64156.1|HIVU64156 HIV-1 isolate MM351 from Australia, revers...	44	0.58
191	gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl...	42	2.3
192	gb|AC115122.4| Mus musculus BAC clone RP24-108L20 from chromosom...	42	2.3
193	gb|AY802593.1| HIV-1 isolate CA10424 from USA reverse transcript...	42	2.3
194	gb|AY802587.1| HIV-1 isolate CA4230 from USA reverse transcripta...	42	2.3
195	gb|AE012515.1| Xanthomonas campestris pv. campestris str. ATCC 3...	42	2.3
196	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	42	2.3
197	gb|DQ024058.1| HIV-1 isolate mA142 from Martinique reverse trans...	42	2.3
198	gb|AF260737.1|AF260737 Cucurbita pepo catalase mRNA, partial cds	42	2.3
199	gb|AC148978.3| Mus musculus BAC clone RP23-359K8 from 14, comple...	42	2.3
200	gb|AY365745.1| HIV-1 isolate 106239 from Argentina pol protein (...	42	2.3
201	dbj|D55647.1|CUCCAT3 Pumpkin mRNA for catalase (cat3), complete cds	42	2.3
202	gb|DQ025189.1| HIV-1 isolate pE90394 from Puerto Rico reverse tr...	40	9.1
203	gb|DQ025104.1| HIV-1 isolate pE85105 from Puerto Rico reverse tr...	40	9.1
204	ref|NM_194840.1| Oryza sativa (japonica cultivar-group) putative...	40	9.1
205	gb|AY701391.1| HIV-1 isolate RW0550 from USA reverse transcripta...	40	9.1
206	gb|AY388831.1| HIV-1 from USA isolate P00046 nonfunctional pol p...	40	9.1
207	gb|AY388830.1| HIV-1 from USA isolate P00046 nonfunctional pol p...	40	9.1
208	gb|AY388829.1| HIV-1 from USA isolate P00046 nonfunctional pol p...	40	9.1
209	gb|AY362104.1| HIV-1 isolate 111925 from United Kingdom pol prot...	40	9.1
210	gb|AY362101.1| HIV-1 isolate 134795 from United Kingdom pol prot...	40	9.1
211	gb|AY362100.1| HIV-1 isolate 134284 from United Kingdom pol prot...	40	9.1
212	gb|AY316083.1| HIV-1 from Spain isolate 67.00 pol protein (pol) ...	40	9.1
213	gb|AY471869.1| HIV-1 isolate 206140 from USA pol protein (pol) g...	40	9.1
214	gb|AY528204.1| HIV-1 isolate A0387 from USA pol protein (pol) ge...	40	9.1
215	gb|AY528203.1| HIV-1 isolate A0386 from USA pol protein (pol) ge...	40	9.1
216	gb|AY528202.1| HIV-1 isolate A0385 from USA pol protein (pol) ge...	40	9.1
217	gb|AY527896.1| HIV-1 isolate A0079 from USA pol protein (pol) ge...	40	9.1
218	gb|AY527895.1| HIV-1 isolate A0078 from USA pol protein (pol) ge...	40	9.1
219	gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com...	40	9.1
220	gb|AY149565.1| HIV-1 isolate DK.IM.123-f.RT reverse transcriptas...	40	9.1
221	gb|AY275769.1| HIV-1 isolate 128PR_RT from Brazil pol protein (p...	40	9.1
222	gb|AY815698.1| Schistosoma japonicum SJCHGC08499 protein mRNA, c...	40	9.1
223	gb|AY334713.1| HIV-1 isolate 51581.f from Puerto Rico pol protei...	40	9.1
224	gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp...	40	9.1
225	gb|AY714472.1| HIV-1 isolate F56706_RT from USA reverse transcri...	40	9.1
226	gb|AY714470.1| HIV-1 from USA reverse transcriptase (Pol) gene, ...	40	9.1
227	gb|AY714434.1| HIV-1 isolate F74928_RT from USA reverse transcri...	40	9.1
228	ref|XM_742595.1| Aspergillus fumigatus Af293 catalase A (Afu6g03...	40	9.1
229	gb|AY165273.1| HIV-1 isolate 01SE-22264 from Sweden gag-pol fusi...	40	9.1
230	gb|DQ157817.1| HIV-1 isolate PE.5895 from Peru protease (pol) ge...	40	9.1
231	emb|AL606504.14| Human DNA sequence from clone RP11-358K2 on chr...	40	9.1
232	gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl...	40	9.1
233	gb|AF454535.1| HIV-1 isolate 66936VI from Czech Republic reverse...	40	9.1
234	gb|AY213503.1| HIV-1 isolate BRP2177RT from Brazil reverse trans...	40	9.1
235	gb|AY213272.1| HIV-1 isolate BRRJ917RT from Brazil reverse trans...	40	9.1
236	gb|AY260398.1| HIV-1 isolate 213 from France reverse transcripta...	40	9.1
237	gb|AY260380.1| HIV-1 isolate 195 from France reverse transcripta...	40	9.1
238	gb|AY075969.1| HIV-1 isolate 91USG191814pc2 from USA pol polypro...	40	9.1
239	gb|DQ087444.1| Cerebratulus lacteus catalase mRNA, partial cds	40	9.1
240	gb|AY877247.1| HIV-1 isolate BR02SP167 from Brazil reverse trans...	40	9.1
241	gb|AY877199.1| HIV-1 isolate BR02SP183 from Brazil reverse trans...	40	9.1
242	gb|DQ455125.1| Medicago truncatula cDNA-AFLP fragment BC21M31_53...	40	9.1
243	emb|AL596129.27| Mouse DNA sequence from clone RP23-294E23 on ch...	40	9.1
244	gb|DQ059651.1| HIV-1 isolate TV811 from Canada reverse transcrip...	40	9.1
245	emb|AJ419504.1|HIM419504 Human immunodeficiency virus type 1 par...	40	9.1
246	emb|AJ419503.1|HIM419503 Human immunodeficiency virus type 1 par...	40	9.1
247	gb|AY801196.1| HIV-1 isolate CA34461 from USA reverse transcript...	40	9.1
248	gb|AY801175.1| HIV-1 isolate CA48112 from USA reverse transcript...	40	9.1
249	gb|AY801006.1| HIV-1 isolate CA9339 from USA reverse transcripta...	40	9.1
250	gb|AY800826.1| HIV-1 isolate CA38923 from USA reverse transcript...	40	9.1
251	gb|AY800825.1| HIV-1 isolate CA23866 from USA reverse transcript...	40	9.1
252	gb|AY802331.1| HIV-1 isolate CA34658 from USA reverse transcript...	40	9.1
253	gb|AY802716.1| HIV-1 isolate CA34319 from USA reverse transcript...	40	9.1
254	gb|AY802695.1| HIV-1 isolate CA38099 from USA reverse transcript...	40	9.1
255	gb|AY802638.1| HIV-1 isolate CA9908 from USA reverse transcripta...	40	9.1
256	gb|AY802637.1| HIV-1 isolate CA9945 from USA reverse transcripta...	40	9.1
257	gb|AY802261.1| HIV-1 isolate CA42734 from USA reverse transcript...	40	9.1
258	gb|AY802088.1| HIV-1 isolate CA41281 from USA reverse transcript...	40	9.1
259	gb|AY802087.1| HIV-1 isolate CA23850 from USA reverse transcript...	40	9.1
260	gb|AY802072.1| HIV-1 isolate CA48146 from USA reverse transcript...	40	9.1
261	gb|AY802071.1| HIV-1 isolate CA37957 from USA reverse transcript...	40	9.1
262	gb|AY802070.1| HIV-1 isolate CA37955 from USA reverse transcript...	40	9.1
263	gb|AY802069.1| HIV-1 isolate CA48556 from USA reverse transcript...	40	9.1
264	gb|AY802068.1| HIV-1 isolate CA34970 from USA reverse transcript...	40	9.1
265	gb|AY802067.1| HIV-1 isolate CA23736 from USA reverse transcript...	40	9.1
266	gb|AY802028.1| HIV-1 isolate CA48162 from USA reverse transcript...	40	9.1
267	gb|AY802027.1| HIV-1 isolate CA38013 from USA reverse transcript...	40	9.1
268	gb|AY802026.1| HIV-1 isolate CA34332 from USA reverse transcript...	40	9.1
269	gb|AY802025.1| HIV-1 isolate CA21221 from USA reverse transcript...	40	9.1
270	gb|AY801890.1| HIV-1 isolate CA37850 from USA reverse transcript...	40	9.1
271	gb|AY801889.1| HIV-1 isolate CA35213 from USA reverse transcript...	40	9.1
272	gb|AY801888.1| HIV-1 isolate CA20096 from USA reverse transcript...	40	9.1
273	gb|AY801797.1| HIV-1 isolate CA19882 from USA reverse transcript...	40	9.1
274	gb|AY801674.1| HIV-1 isolate CA21206 from USA reverse transcript...	40	9.1
275	gb|AY800715.1| HIV-1 isolate CA1437 from USA reverse transcripta...	40	9.1
276	gb|AF459197.1| HIV-1 isolate patient AD-110 from USA pol protein...	40	9.1
277	gb|AF517515.1| HIV-1 from Italy patient 30, off-therapy group, p...	40	9.1
278	gb|AF517488.1| HIV-1 from Italy patient 30, off-therapy group, p...	40	9.1
279	gb|AF347403.1| HIV-1 isolate 986192 from Germany truncated pol p...	40	9.1
280	gb|AF347367.1| HIV-1 isolate 984898 from Germany pol protein (po...	40	9.1
281	gb|AF347305.1| HIV-1 isolate 974412 from Germany pol protein (po...	40	9.1
282	gb|AF347298.1| HIV-1 isolate 970850 from Germany pol protein (po...	40	9.1
283	gb|AF347279.1| HIV-1 isolate 5483 from Germany pol protein (pol)...	40	9.1
284	gb|AF347208.1| HIV-1 isolate 2570 from Germany truncated pol pro...	40	9.1
285	gb|AF347179.1| HIV-1 isolate 001936-2 from Germany pol protein (...	40	9.1
286	gb|AC135319.28| Medicago truncatula clone mth2-6g4, complete seq...	40	9.1
287	gb|AF357723.1| HIV1 isolate 680046h031998 from USA pol protein (...	40	9.1
288	gb|AF357610.1| HIV1 isolate 280745l022598 from USA pol protein (...	40	9.1
289	dbj|AB213691.1| Human immunodeficiency virus 1 genes for gag-pol...	40	9.1
290	dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple...	40	9.1
291	gb|AC106732.2| Homo sapiens chromosome 5 clone CTD-2275D24, comp...	40	9.1
292	gb|AF480744.1| HIV-1 isolate VT02rt from Brazil reverse transcri...	40	9.1
293	gb|AC074105.3| Oryza sativa chromosome 10 clone OSJNBa0030B02, c...	40	9.1
294	gb|DQ370267.1| HIV-1 isolate 308a-872 from Italy pol protein (po...	40	9.1
295	gb|DQ370204.1| HIV-1 isolate 1406A-2845 from Italy pol protein (...	40	9.1
296	gb|AF360825.1|AF360825 HIV-1 isolate LI75ARG from Argentina reve...	40	9.1
297	gb|AF349318.1|AF349318 HIV-1 isolate RDI002 from USA pol polypro...	40	9.1
298	gb|AF349317.1|AF349317 HIV-1 isolate RDI001 from USA pol polypro...	40	9.1
299	gb|AY042732.1| HIV-1 isolate 36010-32 reverse transcriptase (pol...	40	9.1
300	gb|AY042731.1| HIV-1 isolate 36010-0 reverse transcriptase (pol)...	40	9.1
301	gb|AY032506.1| HIV-1 isolate NC6600-2000 from USA pol polyprotei...	40	9.1
302	gb|AY032477.1| HIV-1 isolate NC6571-2000 from USA pol polyprotei...	40	9.1
303	gb|AY032325.1| HIV-1 isolate NC6368-2000 from USA pol polyprotei...	40	9.1
304	gb|AY031902.1| HIV-1 isolate NC5348-1999 from USA pol polyprotei...	40	9.1
305	gb|AY031885.1| HIV-1 isolate NC5331-1999 from USA pol polyprotei...	40	9.1
306	gb|AY031867.1| HIV-1 isolate NC5312-1999 from USA pol polyprotei...	40	9.1
307	gb|AY031838.1| HIV-1 isolate NC5281-1999 from USA pol polyprotei...	40	9.1
308	gb|AY031732.1| HIV-1 isolate NC5166-1999 from USA pol polyprotei...	40	9.1
309	gb|AY031483.1| HIV-1 isolate NC4824-1999 from USA pol polyprotei...	40	9.1
310	gb|AY031315.1| HIV-1 isolate NC4472-1999 from USA pol polyprotei...	40	9.1
311	gb|AY031243.1| HIV-1 isolate NC4385-1999 from USA pol polyprotei...	40	9.1
312	gb|AY031114.1| HIV-1 isolate NC4125-1999 from USA pol polyprotei...	40	9.1
313	gb|AY031017.1| HIV-1 isolate NC4022-1999 from USA pol polyprotei...	40	9.1
314	gb|AY030960.1| HIV-1 isolate NC3962-1998 from USA pol polyprotei...	40	9.1
315	gb|AY030907.1| HIV-1 isolate NC3902-1999 from USA pol polyprotei...	40	9.1
316	gb|AY030854.1| HIV-1 isolate NC2309-1999 from USA pol polyprotei...	40	9.1
317	gb|AY030776.1| HIV-1 isolate NC1872-1998 from USA pol polyprotei...	40	9.1
318	gb|AY030711.1| HIV-1 isolate NC1623-1998 from USA pol polyprotei...	40	9.1
319	gb|AY030556.1| HIV-1 isolate NC1411-1998 from USA pol polyprotei...	40	9.1
320	gb|DQ024658.1| HIV-1 isolate pC58692 from Puerto Rico reverse tr...	40	9.1
321	gb|DQ024489.1| HIV-1 isolate pC49522 from Puerto Rico reverse tr...	40	9.1
322	gb|DQ024345.1| HIV-1 isolate pB39592 from Puerto Rico reverse tr...	40	9.1
323	gb|DQ024294.1| HIV-1 isolate mf057 from Martinique reverse trans...	40	9.1
324	gb|DQ024283.1| HIV-1 isolate mf002 from Martinique reverse trans...	40	9.1
325	gb|DQ024262.1| HIV-1 isolate me267 from Martinique reverse trans...	40	9.1
326	gb|DQ024117.1| HIV-1 isolate mC141 from Martinique reverse trans...	40	9.1
327	gb|DQ023887.1| HIV-1 isolate gD026 from Guadeloupe reverse trans...	40	9.1
328	gb|DQ023807.1| HIV-1 isolate gB213 from Guadeloupe reverse trans...	40	9.1
329	gb|DQ023795.1| HIV-1 isolate gB146 from Guadeloupe reverse trans...	40	9.1
330	gb|AY756840.1| HIV-1 isolate 3086 from Malawi pol protein (pol) ...	40	9.1
331	gb|AF330773.1|AF330773 HIV-1 patient 13 reverse transcriptase (p...	40	9.1
332	emb|AJ577871.1|HIM577871 Human immunodeficiency virus 1 partial ...	40	9.1
333	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
334	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
335	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
336	gb|AF266535.1|AF266535 HIV-1 clone L092RT from Italy reverse tra...	40	9.1
337	gb|AF301318.1|AF301318 HIV-1 clone AA1295 from USA reverse trans...	40	9.1
338	gb|AF301298.1|AF301298 HIV-1 clone AA0409 from USA reverse trans...	40	9.1
339	gb|AY901796.1| HIV-1 isolate 1211 protease (pol) gene, partial cds	40	9.1
340	gb|AY995449.1| HIV-1 isolate 2209-1044A from Italy pol protein (...	40	9.1
341	gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10...	40	9.1
342	gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23...	40	9.1
343	gb|AF514256.1| HIV-1 isolate 7858-090700 from USA reverse transc...	40	9.1
344	gb|AF514159.1| HIV-1 isolate 3902-012500 from USA reverse transc...	40	9.1
345	gb|AF514150.1| HIV-1 isolate 2309-111699 from USA reverse transc...	40	9.1
346	gb|AF514009.1| HIV-1 isolate 796-011999 from USA reverse transcr...	40	9.1
347	gb|AF456533.1| HIV-1 isolate AR15800 from Argentina pol protein ...	40	9.1
348	gb|AY003331.1| HIV-1 isolate 066F04 from USA pol protein (pol) g...	40	9.1
349	gb|AY000467.1| HIV-1 isolate 038G10 from USA pol protein (pol) g...	40	9.1
350	gb|AY000466.1| HIV-1 isolate 072E07 from USA pol protein (pol) g...	40	9.1
351	gb|AY000465.1| HIV-1 isolate 088B02 from USA pol protein (pol) g...	40	9.1
352	gb|AY000464.1| HIV-1 isolate 062D07 from USA pol protein (pol) g...	40	9.1
353	gb|AY000463.1| HIV-1 isolate 062D03 from USA pol protein (pol) g...	40	9.1
354	gb|AY000462.1| HIV-1 isolate 038G05 from USA pol protein (pol) g...	40	9.1
355	gb|AY000461.1| HIV-1 isolate 062D02 from USA pol protein (pol) g...	40	9.1
356	gb|AY000459.1| HIV-1 isolate 072E04 from USA pol protein (pol) g...	40	9.1
357	gb|AY000458.1| HIV-1 isolate 088A09 from USA pol protein (pol) g...	40	9.1
358	gb|AY000456.1| HIV-1 isolate 072E02 from USA pol protein (pol) g...	40	9.1
359	gb|AY000455.1| HIV-1 isolate 079C03 from USA pol protein (pol) g...	40	9.1
360	gb|AY000448.1| HIV-1 isolate 079C01 from USA pol protein (pol) g...	40	9.1
361	gb|AY000441.1| HIV-1 isolate 088B06 from USA pol protein (pol) g...	40	9.1
362	gb|AY000439.1| HIV-1 isolate 062D04 from USA pol protein (pol) g...	40	9.1
363	gb|AY000438.1| HIV-1 isolate 088A03 from USA pol protein (pol) g...	40	9.1
364	gb|AY000435.1| HIV-1 isolate 088B09 from USA pol protein (pol) g...	40	9.1
365	gb|AY000434.1| HIV-1 isolate 088B08 from USA pol protein (pol) g...	40	9.1
366	gb|AY000433.1| HIV-1 isolate 088B05 from USA pol protein (pol) g...	40	9.1
367	gb|AY000432.1| HIV-1 isolate 062D05 from USA pol protein (pol) g...	40	9.1
368	gb|AY000429.1| HIV-1 isolate 038G12 from USA pol protein (pol) g...	40	9.1
369	gb|AY000428.1| HIV-1 isolate 038G11 from USA pol protein (pol) g...	40	9.1
370	gb|AY000427.1| HIV-1 isolate 038G08 from USA pol protein (pol) g...	40	9.1
371	gb|AY000426.1| HIV-1 isolate 038G04 from USA pol protein (pol) g...	40	9.1
372	gb|AY000425.1| HIV-1 isolate 038G03 from USA pol protein (pol) g...	40	9.1
373	gb|AY000424.1| HIV-1 isolate 072E05 from USA pol protein (pol) g...	40	9.1
374	gb|AY000423.1| HIV-1 isolate 062D08 from USA pol protein (pol) g...	40	9.1
375	gb|AY000422.1| HIV-1 isolate 062D01 from USA pol protein (pol) g...	40	9.1
376	gb|AY000421.1| HIV-1 isolate 038G06 from USA pol protein (pol) g...	40	9.1
377	gb|AY102485.1| HIV-1 isolate SU502 from Sudan pol protein (pol) ...	40	9.1
378	gb|AY153945.1| HIV-1 isolate G240 from Thailand reverse transcri...	40	9.1
379	gb|AY153921.1| HIV-1 isolate G212 from Thailand reverse transcri...	40	9.1
380	gb|AF090531.1|AF090531 HIV-1 isolate 260Pt8W8C from USA reverse ...	40	9.1
381	gb|AF090530.1|AF090530 HIV-1 isolate 260Pt8BC from USA reverse t...	40	9.1
382	gb|AF090512.1|AF090512 HIV-1 isolate 260Pt29W8P from USA reverse...	40	9.1
383	gb|AF090511.1|AF090511 HIV-1 isolate 260Pt29BC from USA reverse ...	40	9.1
384	emb|BX293550.6| Zebrafish DNA sequence from clone CH211-276D14 i...	40	9.1
385	dbj|AP003527.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
386	gb|AY441935.1| HIV-1 isolate SP36_00 from Brazil nonfunctional r...	40	9.1
387	dbj|AP005309.5| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
388	dbj|AP006451.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
389	dbj|AP005604.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
390	gb|AY670050.1| HIV-1 isolate 02cl5.24 from United Kingdom pol pr...	40	9.1
391	gb|AY670049.1| HIV-1 isolate 02cl5.23 from United Kingdom pol pr...	40	9.1
392	gb|AY670048.1| HIV-1 isolate 02cl5.22 from United Kingdom pol pr...	40	9.1
393	gb|AY670046.1| HIV-1 isolate 02cl5.20 from United Kingdom pol pr...	40	9.1
394	gb|AY669980.1| HIV-1 isolate 00cl3.9 from United Kingdom pol pro...	40	9.1
395	gb|AY669966.1| HIV-1 isolate 02cl2.57 from United Kingdom pol pr...	40	9.1
396	gb|AY669965.1| HIV-1 isolate 02cl2.56 from United Kingdom pol pr...	40	9.1
397	gb|AY669964.1| HIV-1 isolate 02cl2.55 from United Kingdom pol pr...	40	9.1
398	gb|AY669959.1| HIV-1 isolate 02cl2.50 from United Kingdom pol pr...	40	9.1
399	gb|AY669914.1| HIV-1 isolate 00cl2.5 from United Kingdom pol pro...	40	9.1
400	emb|AJ276532.1|HIM276532 Human immunodeficiency virus type 1 par...	40	9.1
401	emb|AJ425908.1|HIM425908 Human immunodeficiency virus type 1 par...	40	9.1
402	emb|X80505.1|ASEXECD A.salmonicida genes exeC and exeD	40	9.1
403	emb|AJ332571.1|HSA332571 Homo sapiens genomic sequence surroundi...	40	9.1
404	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	40	9.1
405	gb|AY906963.1| HIV-1 isolate Dj336 from Djibouti nonfunctional p...	40	9.1
406	gb|AY107763.1| Zea mays PCO104975 mRNA sequence	40	9.1
407	gb|AY771592.1| HIV-1 isolate BREPM275 from Brazil, complete genome	40	9.1
408	gb|AY771583.1| HIV-1 isolate BREPMPOL275 from Brazil pol protein...	40	9.1
409	gb|AY771531.1| HIV-1 isolate BREPMPOL207 from Brazil pol protein...	40	9.1
410	gb|AY771453.1| HIV-1 isolate BREPMPOL101 from Brazil pol protein...	40	9.1
411	gb|AY801640.1| HIV-1 isolate CA17396 from USA reverse transcript...	40	9.1
412	gb|AY802003.1| HIV-1 isolate CA21154 from USA reverse transcript...	40	9.1
413	gb|AY802195.1| HIV-1 isolate CA24527 from USA reverse transcript...	40	9.1
414	gb|AY802196.1| HIV-1 isolate CA34911 from USA reverse transcript...	40	9.1
415	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	9.1
416	emb|AL606599.3|OSJN00034 Oryza sativa genomic DNA, chromosome 4,...	40	9.1
417	emb|AL606443.3|OSJN00008 Oryza sativa genomic DNA, chromosome 4,...	40	9.1
418	gb|AY855793.1| HIV-1 isolate 1355-492A from Italy pol protein (p...	40	9.1
419	gb|AY855745.1| HIV-1 isolate 555A from Italy pol protein (pol) g...	40	9.1
420	gb|AY855624.1| HIV-1 isolate 205A from Italy pol protein (pol) g...	40	9.1
421	gb|AY855618.1| HIV-1 isolate 194A from Italy pol protein (pol) g...	40	9.1
422	gb|AC153843.6| Mus musculus 10 BAC RP23-273P15 (Roswell Park Can...	40	9.1
423	gb|U87630.1|AFU87630 Aspergillus fumigatus catalase gene, comple...	40	9.1
424	gb|AY365977.1| HIV-1 isolate 120063 from Argentina pol protein (...	40	9.1
425	gb|AY365716.1| HIV-1 isolate 105048 from Argentina pol protein (...	40	9.1
426	gb|AY365715.1| HIV-1 isolate 105044 from Argentina pol protein (...	40	9.1
427	gb|AY365536.1| HIV-1 isolate 96926 from Argentina pol protein (p...	40	9.1
428	gb|U83329.1|PFU83329 Pseudomonas fluorescens catalase (catB) gen...	40	9.1
429	gb|U64125.1|HIVU64125 HIV-1 isolate DH365 from Australia, revers...	40	9.1
430	gb|U64124.1|HIVU64124 HIV-1 isolate DH321 from Australia, revers...	40	9.1
431	gb|U64123.1|HIVU64123 HIV-1 isolate DH289 from Australia, revers...	40	9.1
432	gb|U64122.1|HIVU64122 HIV-1 isolate DH200 from Australia, revers...	40	9.1
433	gb|DQ089181.1| Capra hircus voucher YP 2860 control region, part...	40	9.1
434	gb|DQ089160.1| Capra hircus voucher YP 2790 control region, part...	40	9.1
435	gb|AF538304.1| HIV-1 clone C24 from Australia gag protein (gag) ...	40	9.1
436	dbj|AB037061.1| Human immunodeficiency virus type 1 RT gene for ...	40	9.1

---

>gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, complete cds
          Length = 1879

 Score = 1304 bits (658), Expect = 0.0
 Identities = 664/666 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 434  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 493

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 553

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 554  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 613

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 614  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactac 673

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 674  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 733

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 734  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 793

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 794  gctgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 853

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 854  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 913

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 973

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 974  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 1033

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1034 gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 1093

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1094 ctgctc 1099

---

>emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase
          Length = 1869

 Score = 1296 bits (654), Expect = 0.0
 Identities = 663/666 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 475  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 534

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 535  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 594

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 595  ccaagttcgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 654

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 655  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactac 714

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 715  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 774

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 775  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 834

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 835  gctgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 894

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 895  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 954

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 955  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 1014

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1015 ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 1074

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1075 gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 1134

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1135 ctgctc 1140

---

>gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, partial cds
          Length = 2130

 Score = 1243 bits (627), Expect = 0.0
 Identities = 633/635 (99%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 488  agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 547

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 548  agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 607

                                                                        
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 608  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 667

                                                                        
Query: 212  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 668  ttgacgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacacct 727

                                                                        
Query: 272  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 728  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 787

                                                                        
Query: 332  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 788  gtggtgtgaagtgcctcttggatgatgaagctgttactgttggaggcacctgccacaccc 847

                                                                        
Query: 392  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 848  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 907

                                                                        
Query: 452  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 908  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 967

                                                                        
Query: 512  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 968  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 1027

                                                                        
Query: 572  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1028 agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 1087

                                               
Query: 632  tccctggaatccactactctgatgataagctgctc 666
            |||||||||||||||||||||||||||||||||||
Sbjct: 1088 tccctggaatccactactctgatgataagctgctc 1122



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 1   cgtggttttgcagtgaagttctacaccagagagg 34
           ||||||||||||||||||||||||||||||||||
Sbjct: 76  cgtggttttgcagtgaagttctacaccagagagg 109

---

>emb|Z99634.1|SCCATALAS Secale cereale mRNA for catalase (cat2 gene)
          Length = 809

 Score =  938 bits (473), Expect = 0.0
 Identities = 563/593 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 190 cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 249

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 309

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||||||| |||||||||||||| |||||||||||| |||||||||||| ||||||||||
Sbjct: 310 ccaagtccaaagaccaacatgcaagagaactggagaatagttgacttctcttcgcaccac 369

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           ||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||| 
Sbjct: 370 ccggagagtctgcacatgttcaccttcctctttgatgatgttcgcattccactcaactac 429

                                                                       
Query: 241 aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
           ||||||||||||||||||||||||||||||||||| || |||||||| ||||| ||||||
Sbjct: 430 aggcacatggacggttttggtgtcaacacctacacgtttatcagcagcgatgggaaggct 489

                                                                       
Query: 301 cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
           ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 490 cacctggttaaattccattggaaacccacatgtggtgtgaagtgcctcttggatgatgat 549

                                                                       
Query: 361 gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 550 gctgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 609

                                                                       
Query: 421 gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
           || ||||||||||||||||  |||||| ||||||| |||||| ||||||||||||| |||
Sbjct: 610 gcggctgggaattacccagtgtggaaggttttcattcagaccgttgatgctgatcatgag 669

                                                                       
Query: 481 gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
           |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 670 gataaatttgactttgaccctcttgatgtcaccaagacctggccagaggatatcatccaa 729

                                                                
Query: 541 ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgc 593
           ||||||||||||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 730 ctgcaaccagttggacggatggtgctcaacaagaacatcgataatttcttcgc 782

---

>dbj|AK100019.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013145C05, full
            insert sequence
          Length = 1877

 Score =  813 bits (410), Expect = 0.0
 Identities = 602/666 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || ||||| ||||| ||||||||||| ||||| |||||||||||||||
Sbjct: 551  cgtggttttgctgtcaagttttacactagagagggtaattttgatcttgttgggaacaat 610

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 611  atgcctgtcttttttatccgagatgggatgaaattccctgacatggtccatgctttcaag 670

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            |||||||| |||||||| |||||||||||||||||| ||||||| |||||||| ||||||
Sbjct: 671  ccaagtccaaagaccaatatgcaggagaactggagaatagttgatttcttttcacaccac 730

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| |||||||||||| ||||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 731  ccagagagcctgcacatgttctccttcctctttgacgatgtaggcatcccactcaactac 790

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| |||||||||||||||||||||||| ||||||  | |||||||||| ||
Sbjct: 791  aggcacatggagggttttggtgtcaacacctacaccctaatcaataaggatggaaagcct 850

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||||||||||
Sbjct: 851  caccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctgttggatgatgaa 910

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||| ||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 911  gctgtgactgttggcggcacctgccacagccatgccacgaaggacttgactgattctatt 970

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||| |||||||||||||| |||||||||| ||||||||| |||||| ||||||| |||
Sbjct: 971  gcagcagggaattacccagagtggaagctttacatccagactattgatcctgatcatgag 1030

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || ||||||||||| || |||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 1031 gacagatttgacttcgatcctcttgatgtcaccaagacatggccagaggatatcatcccc 1090

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| ||||||||||||||||| |||||||| |||||||| || ||||| || ||||||
Sbjct: 1091 ctgcagccagttggacggatggtcctgaacaaaaacattgataacttctttgcagaaaat 1150

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||||||||||||||||||||  | | ||||||||||||||| |||||||||||||||
Sbjct: 1151 gaacagcttgctttctgcccagcgataattgtccctggaatccattactctgatgataag 1210

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1211 ctgctc 1216

---

>dbj|AK069446.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019H14, full
            insert sequence
          Length = 1898

 Score =  813 bits (410), Expect = 0.0
 Identities = 602/666 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || ||||| ||||| ||||||||||| ||||| |||||||||||||||
Sbjct: 463  cgtggttttgctgtcaagttttacactagagagggtaattttgatcttgttgggaacaat 522

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 523  atgcctgtcttttttatccgagatgggatgaaattccctgacatggtccatgctttcaag 582

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            |||||||| |||||||| |||||||||||||||||| ||||||| |||||||| ||||||
Sbjct: 583  ccaagtccaaagaccaatatgcaggagaactggagaatagttgatttcttttcacaccac 642

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| |||||||||||| ||||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 643  ccagagagcctgcacatgttctccttcctctttgacgatgtaggcatcccactcaactac 702

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| |||||||||||||||||||||||| ||||||  | |||||||||| ||
Sbjct: 703  aggcacatggagggttttggtgtcaacacctacaccctaatcaataaggatggaaagcct 762

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||||||||||
Sbjct: 763  caccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctgttggatgatgaa 822

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||| ||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 823  gctgtgactgttggcggcacctgccacagccatgccacgaaggacttgactgattctatt 882

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||| |||||||||||||| |||||||||| ||||||||| |||||| ||||||| |||
Sbjct: 883  gcagcagggaattacccagagtggaagctttacatccagactattgatcctgatcatgag 942

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || ||||||||||| || |||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 943  gacagatttgacttcgatcctcttgatgtcaccaagacatggccagaggatatcatcccc 1002

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| ||||||||||||||||| |||||||| |||||||| || ||||| || ||||||
Sbjct: 1003 ctgcagccagttggacggatggtcctgaacaaaaacattgataacttctttgcagaaaat 1062

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||||||||||||||||||||  | | ||||||||||||||| |||||||||||||||
Sbjct: 1063 gaacagcttgctttctgcccagcgataattgtccctggaatccattactctgatgataag 1122

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1123 ctgctc 1128

---

>gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRNA, complete cds
          Length = 1479

 Score =  805 bits (406), Expect = 0.0
 Identities = 601/666 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || ||||| ||||| ||||||||||| ||||| |||||||||||||||
Sbjct: 358  cgtggttttgctgtcaagttttacactagagagggtaattttgatcttgttgggaacaat 417

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 418  atgcctgtcttttttatccgagatgggatgaaattccctgacatggtccatgctttcaag 477

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            |||||||| |||||||| |||||||||||||||||| ||||||| |||||||| ||||||
Sbjct: 478  ccaagtccaaagaccaatatgcaggagaactggagaatagttgatttcttttcacaccac 537

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| |||||||||||| ||||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 538  ccagagagcctgcacatgttctccttcctctttgacgatgtaggcatcccactcaactac 597

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| |||||||||||||||||||||||| ||||||  | |||||||||| ||
Sbjct: 598  aggcacatggagggttttggtgtcaacacctacaccctaatcaataaggatggaaagcct 657

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||||||||||
Sbjct: 658  caccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctgttggatgatgaa 717

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||| ||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 718  gctgtgactgttggcggcacctgccacagccatgccacgaaggacttgactgattctatt 777

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            |||||  ||||||||||||| |||||||||| ||||||||| |||||| ||||||| |||
Sbjct: 778  gcagcaaggaattacccagagtggaagctttacatccagactattgatcctgatcatgag 837

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || ||||||||||| || |||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 838  gacagatttgacttcgatcctcttgatgtcaccaagacatggccagaggatatcatcccc 897

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| ||||||||||||||||| |||||||| |||||||| || ||||| || ||||||
Sbjct: 898  ctgcagccagttggacggatggtcctgaacaaaaacattgataacttctttgcagaaaat 957

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||||||||||||||||||||  | | ||||||||||||||| |||||||||||||||
Sbjct: 958  gaacagcttgctttctgcccagcgataattgtccctggaatccattactctgatgataag 1017

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1018 ctgctc 1023

---

>dbj|D26484.1|RICPOSCATB Oryza sativa (japonica cultivar-group) mRNA for catalase, complete
            cds
          Length = 1832

 Score =  805 bits (406), Expect = 0.0
 Identities = 601/666 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || ||||| ||||| ||||||||||| ||||| |||||||||||||||
Sbjct: 488  cgtggttttgctgtcaagttttacactagagagggtaattttgatcttgttgggaacaat 547

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||  ||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 548  atgcctggcttttttatccgagatgggatgaaattccctgacatggtccatgctttcaag 607

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            |||||||| |||||||| |||||||||||||||||| ||||||| |||||||| ||||||
Sbjct: 608  ccaagtccaaagaccaatatgcaggagaactggagaatagttgatttcttttcacaccac 667

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| |||||||||||| ||||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 668  ccagagagcctgcacatgttctccttcctctttgacgatgtaggcatcccactcaactac 727

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| |||||||||||||||||||||||| ||||||  | |||||||||| ||
Sbjct: 728  aggcacatggagggttttggtgtcaacacctacaccctaatcaataaggatggaaagcct 787

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||| ||||| ||||| |||||||| || ||||| ||||||||||||
Sbjct: 788  caccttgtcaaattccactggaagcctacctgtggtgtcaaatgcctgttggatgatgaa 847

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||| ||||||||||||| ||||||||| |||||||||||||||||||||
Sbjct: 848  gctgtgactgttggcggcacctgccacagccatgccacgaaggacttgactgattctatt 907

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||| |||||||||||||| |||||||||| ||||||||| |||||| ||||||| |||
Sbjct: 908  gcagcagggaattacccagagtggaagctttacatccagactattgatcctgatcatgag 967

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || ||||||||||| || |||||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 968  gacagatttgacttcgatcctcttgatgtcaccaagacatggccagaggatatcatcccc 1027

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| ||||||||||||||||| |||||||| |||||||| || ||||| || ||||||
Sbjct: 1028 ctgcagccagttggacggatggtcctgaacaaaaacattgataacttctttgcagaaaat 1087

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||||||||||||||||||||  | | ||||||||||||||| |||||||||||||||
Sbjct: 1088 gaacagcttgctttctgcccagcgataattgtccctggaatccattactctgatgataag 1147

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1148 ctgctc 1153

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  783 bits (395), Expect = 0.0
 Identities = 575/635 (90%)
 Strand = Plus / Plus

                                                                            
Query: 32       agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
                ||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 30430254 agggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatga 30430313

                                                                            
Query: 92       agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
                | ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 30430314 aattccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaact 30430373

                                                                            
Query: 152      ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
                ||||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |
Sbjct: 30430374 ggagaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctct 30430433

                                                                            
Query: 212      ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
                |||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 30430434 ttgacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacct 30430493

                                                                            
Query: 272      acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
                ||||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |
Sbjct: 30430494 acaccctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacct 30430553

                                                                            
Query: 332      gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
                ||||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||
Sbjct: 30430554 gtggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagcc 30430613

                                                                            
Query: 392      atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
                ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 30430614 atgccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagcttt 30430673

                                                                            
Query: 452      tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
                 ||||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||
Sbjct: 30430674 acatccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtca 30430733

                                                                            
Query: 512      ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
                ||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 30430734 ccaagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaaca 30430793

                                                                            
Query: 572      agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
                | |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||
Sbjct: 30430794 aaaacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattg 30430853

                                                   
Query: 632      tccctggaatccactactctgatgataagctgctc 666
                ||||||||||||| |||||||||||||||||||||
Sbjct: 30430854 tccctggaatccattactctgatgataagctgctc 30430888



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 218      atgttggcattccactcaac 237
                ||||||||||||||||||||
Sbjct: 17591242 atgttggcattccactcaac 17591261

---

>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0017G10
          Length = 166700

 Score =  783 bits (395), Expect = 0.0
 Identities = 575/635 (90%)
 Strand = Plus / Plus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             ||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 67615 agggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatga 67674

                                                                         
Query: 92    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
             | ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 67675 aattccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaact 67734

                                                                         
Query: 152   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
             ||||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |
Sbjct: 67735 ggagaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctct 67794

                                                                         
Query: 212   ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
             |||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 67795 ttgacgatgtaggcatcccactcaactacaggcacatggagggttttggtgtcaacacct 67854

                                                                         
Query: 272   acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
             ||||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |
Sbjct: 67855 acaccctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacct 67914

                                                                         
Query: 332   gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
             ||||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||
Sbjct: 67915 gtggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagcc 67974

                                                                         
Query: 392   atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
             ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 67975 atgccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagcttt 68034

                                                                         
Query: 452   tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
              ||||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||
Sbjct: 68035 acatccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtca 68094

                                                                         
Query: 512   ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
             ||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 68095 ccaagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaaca 68154

                                                                         
Query: 572   agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
             | |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||
Sbjct: 68155 aaaacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattg 68214

                                                
Query: 632   tccctggaatccactactctgatgataagctgctc 666
             ||||||||||||| |||||||||||||||||||||
Sbjct: 68215 tccctggaatccattactctgatgataagctgctc 68249

---

>dbj|D64013.1| Oryza sativa (japonica cultivar-group) CatB gene for catalase,
            complete cds
          Length = 4985

 Score =  775 bits (391), Expect = 0.0
 Identities = 574/635 (90%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            ||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 2968 agggtaattttgatcttgttgggaacaatatgcctgtcttttttatccgagatgggatga 3027

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            | ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 3028 aattccctgacatggtccatgctttcaagccaagtccaaagaccaatatgcaggagaact 3087

                                                                        
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
            ||||| ||||||| |||||||| |||||||| ||||| |||||||||||| ||||||| |
Sbjct: 3088 ggagaatagttgatttcttttcacaccacccagagagcctgcacatgttctccttcctct 3147

                                                                        
Query: 212  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
            |||||||||| ||||| ||||||||| | ||||||||||| |||||||||||||||||||
Sbjct: 3148 ttgacgatgtaggcatcccactcaaccacaggcacatggagggttttggtgtcaacacct 3207

                                                                        
Query: 272  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
            ||||| ||||||  | |||||||||| ||||||| || || ||||| ||||| ||||| |
Sbjct: 3208 acaccctaatcaataaggatggaaagcctcaccttgtcaaattccactggaagcctacct 3267

                                                                        
Query: 332  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
            ||||||| || ||||| |||||||||||||| || |||||||| ||||||||||||| ||
Sbjct: 3268 gtggtgtcaaatgcctgttggatgatgaagctgtgactgttggcggcacctgccacagcc 3327

                                                                        
Query: 392  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
            ||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 3328 atgccacgaaggacttgactgattctattgcagcagggaattacccagagtggaagcttt 3387

                                                                        
Query: 452  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
             ||||||||| |||||| ||||||| ||||| ||||||||||| || |||||||||||||
Sbjct: 3388 acatccagactattgatcctgatcatgaggacagatttgacttcgatcctcttgatgtca 3447

                                                                        
Query: 512  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
            ||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 3448 ccaagacatggccagaggatatcatccccctgcagccagttggacggatggtcctgaaca 3507

                                                                        
Query: 572  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
            | |||||||| || ||||| || |||||||||||||||||||||||||||||  | | ||
Sbjct: 3508 aaaacattgataacttctttgcagaaaatgaacagcttgctttctgcccagcgataattg 3567

                                               
Query: 632  tccctggaatccactactctgatgataagctgctc 666
            ||||||||||||| |||||||||||||||||||||
Sbjct: 3568 tccctggaatccattactctgatgataagctgctc 3602

---

>gb|AY103601.1| Zea mays PCO144994 mRNA sequence
          Length = 2149

 Score =  630 bits (318), Expect = e-177
 Identities = 579/666 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || |||||||||||||||||||||||||||||||| || || ||||| 
Sbjct: 596  cgtggttttgctgtcaagttctacaccagagagggtaactttgacctcgtgggtaacaac 655

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||||||||| || |||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 656  atgcctgtgtttttcatacgagatgggatgaaattccctgacatggtccacgctttcaag 715

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || | ||| ||||||||  ||||||||||||||||| |||| || ||||| || ||||||
Sbjct: 716  ccgaatccaaagaccaatttgcaggagaactggagaatagtagatttcttctctcaccac 775

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 776  ccagagagcctacacatgttcaccttcctctttgacgatgttggcatcccactcaactac 835

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| || ||||||||||| ||||||||||| |||| ||||||||||||| ||
Sbjct: 836  aggcacatggagggctttggtgtcaatacctacaccttgatcaacagggatggaaagcct 895

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||||||||| ||||| ||||||||||| ||| |  | || ||||||
Sbjct: 896  caccttgtgaaattccattggaagcctacttgtggtgtgaaatgcttgctcgacgatgaa 955

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||||||||||||||||| |||||| || |||||  |   |||||| || 
Sbjct: 956  gctgtgactgttggaggcacctgccacagccatgcgacgaaggatctatatgattccatc 1015

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||||||||||||||| ||||||||||| | ||||||||| ||||||  ||| || |||
Sbjct: 1016 gcagctgggaattaccctgaatggaagctctacatccagactattgatcttgaccatgag 1075

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            ||||  |||||||||||||| || |||||||||||||||||||| ||||| |||||||| 
Sbjct: 1076 gataagtttgactttgacccgctcgatgtcaccaagacctggcctgaggatatcatcccg 1135

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| || |||||||||||||| |||||||||||| | ||||| ||||| || || |||
Sbjct: 1136 ctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttctttgcagagaat 1195

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||| ||||||||||||||||  | | ||| |||||||| ||||| ||||||||||||
Sbjct: 1196 gaacagattgctttctgcccagcgattattgttcctggaattcactattctgatgataag 1255

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1256 ctgctc 1261

---

>gb|U16132.1|HVU16132 Hordeum vulgare catalase mRNA, partial cds
          Length = 326

 Score =  630 bits (318), Expect = e-177
 Identities = 324/326 (99%)
 Strand = Plus / Plus

                                                                       
Query: 213 tgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacaccta 272
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1   tgacgatgttggcattccactcaactacaggcacatggacggttttggtgtcaacaccta 60

                                                                       
Query: 273 caccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatg 332
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  caccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacatg 120

                                                                       
Query: 333 tggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccca 392
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 121 tggtgtgaagtgcctcttggatgatgaagctgttactgttggaggcacctgccacaccca 180

                                                                       
Query: 393 tgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagctttt 452
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagctttt 240

                                                                       
Query: 453 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 512
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 300

                                     
Query: 513 caagacctggccagaggacatcatcc 538
           ||||||||||||||||||||||||||
Sbjct: 301 caagacctggccagaggacatcatcc 326

---

>gb|AF475100.1| Triticum aestivum catalase isozyme mRNA, partial cds
          Length = 807

 Score =  622 bits (314), Expect = e-175
 Identities = 381/405 (94%), Gaps = 1/405 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 459

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 atgcctgtgtttttcatccgagatgggatgaagttccctgacatggtccatgctttcaag 519

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||
Sbjct: 520 ccaagtccaaagaccaacatgcaggagaactggagaatagttgacttcttctcgcaccac 579

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| 
Sbjct: 580 ccggagagtctgcacatgttcaccttcctctttgatgatgttggcattccactcaactac 639

                                                                       
Query: 241 aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| 
Sbjct: 640 aggcacatggacggttttggtgtcaacacctacaccttaatnagcanggatggaaaggcg 699

                                                                       
Query: 301 cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
           ||||| ||||||||||||||||| ||||| || || ||||||||||||||  ||||||||
Sbjct: 700 caccttgttaagttccattggaagcctacntgnggggtgaagtgcctcttanatgatgaa 759

                                                        
Query: 361 gccgttactgttggaggcacctgccacacccatgccacaaaggac 405
            || ||||||| ||||||||||||| || ||||||| |||| |||
Sbjct: 760 accnttactgtaggaggcacctgccnca-ccatgccncaaangac 803

---

>emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (EC 1.11.1.6)
          Length = 2079

 Score =  615 bits (310), Expect = e-173
 Identities = 577/666 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || |||||||||||||||||||||||||||||||| || || ||||| 
Sbjct: 526  cgtggttttgctgtcaagttctacaccagagagggtaactttgacctcgtgggtaacaac 585

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||||||||| || |||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 586  atgcctgtgtttttcatacgagatgggatgaaattccctgacatggtccacgctttcaag 645

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || | ||| ||||||||  ||||||||||||||||| |||| || ||||| || ||||||
Sbjct: 646  ccgaatccaaagaccaatttgcaggagaactggagaatagtagatttcttctctcaccac 705

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 706  ccagagagcctacacatgttcaccttcctctttgacgatgttggcatcccactcaactac 765

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| || ||||||||||| |||||| |||| |||| ||||||||||||| ||
Sbjct: 766  aggcacatggagggctttggtgtcaatacctactccttgatcaacagggatggaaagcct 825

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||||||||| ||||| ||||||||||| ||| |  | ||  |||||
Sbjct: 826  caccttgtgaaattccattggaagcctacttgtggtgtgaaatgcttgctcgacaatgaa 885

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||||||||||||||||| |||||| || |||||  |   |||||| || 
Sbjct: 886  gctgtgactgttggaggcacctgccacagccatgcgacgaaggatctatatgattccatc 945

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||||||||||||||| ||||||||||| | ||||||||| ||||||  ||| || |||
Sbjct: 946  gcagctgggaattaccctgaatggaagctctacatccagactattgatcttgaccatgag 1005

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            ||||  |||||||||||||| || |||||||||||||||||||| ||||| |||||||| 
Sbjct: 1006 gataagtttgactttgacccgctcgatgtcaccaagacctggcctgaggatatcatcccg 1065

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| || |||||||||||||| |||||||||||| | ||||| ||||| || || |||
Sbjct: 1066 ctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttctttgcagagaat 1125

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||| ||||||||||||||||  | | ||| |||||||| ||||| ||||||||||||
Sbjct: 1126 gaacagattgctttctgcccagcgattagtgttcctggaattcactattctgatgataag 1185

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1186 ctgctc 1191

---

>gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence
          Length = 1928

 Score =  599 bits (302), Expect = e-168
 Identities = 575/666 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            ||||||||||| || |||||||||||||||||||||||||||||||| || || ||||| 
Sbjct: 433  cgtggttttgctgtcaagttctacaccagagagggtaactttgacctcgtgggtaacaac 492

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            |||||||||||||| || |||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 493  atgcctgtgtttttcatacgagatgggatgaaattccctgacatggtccacgctttcaag 552

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || | ||| ||||||||  ||||||||||||||||| |||| || ||||| || ||||||
Sbjct: 553  ccgaatccaaagaccaatttgcaggagaactggagaatagtagatttcttctctcaccac 612

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || ||||| || ||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 613  ccagagagcctacacatgttcaccttcctctttgacgatgttggcatcccactcaactac 672

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| || ||||||||||| ||||||||||| |||| ||||||||||||| ||
Sbjct: 673  aggcacatggagggctttggtgtcaatacctacaccttgatcaacagggatggaaagcct 732

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            ||||| || || ||||||||||| |||||   | ||||||| ||| |  | ||  |||||
Sbjct: 733  caccttgtgaaattccattggaagcctactccttgtgtgaaatgcttgctcgacaatgaa 792

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            || || |||||||||||||||||||||| |||||| || |||||  |   |||||| || 
Sbjct: 793  gctgtgactgttggaggcacctgccacagccatgcgacgaaggatctatatgattccatc 852

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            ||||||||||||||||| ||||||||||| | ||||||||| ||||||  ||| || |||
Sbjct: 853  gcagctgggaattaccctgaatggaagctctacatccagactattgatcttgaccatgag 912

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            ||||  |||||||||||||| || |||||||||||||||||||| ||||| |||||||| 
Sbjct: 913  gataagtttgactttgacccgctcgatgtcaccaagacctggcctgaggatatcatcccg 972

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| || |||||||||||||| |||||||||||| | ||||| ||||| || || |||
Sbjct: 973  ctgcagcccgttggacggatggtcctgaacaagaacgtcgacaacttctttgcagagaat 1032

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            |||||| ||||||||||||||||  | | ||| |||||||| ||||| ||||||||||||
Sbjct: 1033 gaacagattgctttctgcccagcgattattgttcctggaattcactattctgatgataag 1092

                  
Query: 661  ctgctc 666
            ||||||
Sbjct: 1093 ctgctc 1098

---

>emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1
          Length = 6933

 Score =  561 bits (283), Expect = e-156
 Identities = 547/635 (86%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            |||||||||||||||| || || ||||| |||||||||||||| || |||||||||||||
Sbjct: 4648 agggtaactttgacctcgtgggtaacaacatgcctgtgtttttcatacgagatgggatga 4707

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            | ||||||||||||||||| |  |||||||| | ||| ||||||||  ||||||||||||
Sbjct: 4708 aattccctgacatggtccacgtcttcaagccgaatccaaagaccaatttgcaggagaact 4767

                                                                        
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
            ||||| |||| || ||||| || |||||||| ||||| || ||||||||||||||||| |
Sbjct: 4768 ggagaatagtagatttcttctctcaccacccagagagcctacacatgttcaccttcctct 4827

                                                                        
Query: 212  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
            |||||||||||||||| ||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 4828 ttgacgatgttggcatcccactcaactacaggcacatggagggctttggtgtcaatacct 4887

                                                                        
Query: 272  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
            ||||||| |||| ||||||||||||| ||||||| || || ||||||||||| ||||| |
Sbjct: 4888 acaccttgatcaacagggatggaaagcctcaccttgtgaaattccattggaagcctactt 4947

                                                                        
Query: 332  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
            |||||||||| ||| |  | ||  ||||||| || |||||||||||||||||||||| ||
Sbjct: 4948 gtggtgtgaaatgcttgctcgacaatgaagctgtgactgttggaggcacctgccacagcc 5007

                                                                        
Query: 392  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
            |||| || |||||  |   |||||| || ||||||||||||||||| ||||||||||| |
Sbjct: 5008 atgcgacgaaggatctatatgattccatcgcagctgggaattaccctgaatggaagctct 5067

                                                                        
Query: 452  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
             ||||||||| ||||||  ||| || |||||||  |||||||||||||| || |||||||
Sbjct: 5068 acatccagactattgatcttgaccatgaggataagtttgactttgacccgctcgatgtca 5127

                                                                        
Query: 512  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
            ||||||||||||| ||||| |||||||| ||||| || |||||||||||||| |||||||
Sbjct: 5128 ccaagacctggcctgaggatatcatcccgctgcagcccgttggacggatggtcctgaaca 5187

                                                                        
Query: 572  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
            ||||| | ||||| ||||| || || ||||||||| ||||||||||||||||  | | ||
Sbjct: 5188 agaacgtcgacaacttctttgcagagaatgaacagattgctttctgcccagcgattattg 5247

                                               
Query: 632  tccctggaatccactactctgatgataagctgctc 666
            | |||||||| ||||| ||||||||||||||||||
Sbjct: 5248 ttcctggaattcactattctgatgataagctgctc 5282



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            ||||||||||| || |||||||||||||||||||
Sbjct: 3938 cgtggttttgctgtcaagttctacaccagagagg 3971

---

>ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2)
            transcript variant AT4G35090.1 mRNA, complete cds
          Length = 1856

 Score =  232 bits (117), Expect = 1e-57
 Identities = 528/665 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 430  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 489

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 490  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 549

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 550  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 609

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 610  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 669

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 670  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 729

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 730  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 789

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 790  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 849

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 850  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 909

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 910  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 969

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 970  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1029

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1030 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1089

                 
Query: 661  ctgct 665
            |||||
Sbjct: 1090 ctgct 1094

---

>ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2)
            transcript variant AT4G35090.2 mRNA, complete cds
          Length = 2259

 Score =  232 bits (117), Expect = 1e-57
 Identities = 528/665 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 429  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 488

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 489  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 548

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 549  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 608

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 609  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 668

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 669  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 728

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 729  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 788

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 789  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 848

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 849  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 908

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 909  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 968

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 969  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1028

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1029 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1088

                 
Query: 661  ctgct 665
            |||||
Sbjct: 1089 ctgct 1093

---

>gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds
          Length = 1510

 Score =  232 bits (117), Expect = 1e-57
 Identities = 528/665 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 358  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 417

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 418  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 477

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 478  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 537

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 538  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 597

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 598  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 657

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 658  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 717

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 718  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 777

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 778  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 837

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 838  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 897

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 898  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 957

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 958  gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1017

                 
Query: 661  ctgct 665
            |||||
Sbjct: 1018 ctgct 1022

---

>gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds
          Length = 1775

 Score =  232 bits (117), Expect = 1e-57
 Identities = 528/665 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 430  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 489

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 490  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 549

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 550  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 609

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 610  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 669

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 670  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 729

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 730  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 789

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 790  gcaattcgtgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 849

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 850  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 909

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 910  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 969

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 970  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1029

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1030 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1089

                 
Query: 661  ctgct 665
            |||||
Sbjct: 1090 ctgct 1094

---

>gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.140) mRNA, complete
            cds
          Length = 1759

 Score =  232 bits (117), Expect = 1e-57
 Identities = 528/665 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 430  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 489

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
             | ||||| || || ||||| ||||||||||||||||||||||||||||| ||| | |||
Sbjct: 490  tttcctgttttcttcatccgcgatgggatgaagttccctgacatggtccacgctcttaag 549

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 550  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 609

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 610  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 669

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 670  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 729

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 730  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 789

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            ||  ||  ||||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 790  gcaattcttgttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 849

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 850  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 909

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 910  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 969

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 970  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1029

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1030 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1089

                 
Query: 661  ctgct 665
            |||||
Sbjct: 1090 ctgct 1094

---

>emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase
          Length = 1803

 Score =  216 bits (109), Expect = 7e-53
 Identities = 526/665 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
            |||||||||||||| |||||||||||||||||||| |||||||| |||||||| ||||| 
Sbjct: 412  cgtggttttgcagtcaagttctacaccagagaggggaactttgatcttgttggaaacaac 471

                                                                        
Query: 61   atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
             | ||||| || || ||||| ||||||||||||||||||||||| ||||| ||| | |||
Sbjct: 472  tttcctgttttcttcatccgcgatgggatgaagttccctgacattgtccacgctcttaag 531

                                                                        
Query: 121  ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
            || |  || ||  |  |||| || |||||||||||| |  |||||||||| || ||||||
Sbjct: 532  ccgaacccaaaatctcacatccaagagaactggagaatccttgacttcttctcccaccac 591

                                                                        
Query: 181  ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
            || || ||| || |||||||||| ||||| || || ||| | || || ||||   | || 
Sbjct: 592  cctgaaagtttgaacatgttcactttcctcttcgatgatatcggtatcccacaagattac 651

                                                                        
Query: 241  aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
            ||||||||||| ||||  |||||||| || ||||  || |||| ||  | ||| || |||
Sbjct: 652  aggcacatggatggttcaggtgtcaatacatacatgttgatcaacaaagctggcaaagct 711

                                                                        
Query: 301  cacctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaa 360
            |||   || ||||||||||||||||| || ||||| || ||||  || ||||| || || 
Sbjct: 712  cactacgtgaagttccattggaaaccaacttgtggagtcaagtctcttttggaagaagat 771

                                                                        
Query: 361  gccgttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctatt 420
            ||  ||  | ||||||| |||  |||||  ||||| ||  | ||||||  ||| ||||| 
Sbjct: 772  gcaattcgtcttggaggaaccaaccacagtcatgcgactcaagacttgtatgactctata 831

                                                                        
Query: 421  gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
            || ||||| || ||||| ||||||||||| || ||||| | ||||||| ||| | | || 
Sbjct: 832  gctgctggaaactaccctgaatggaagctctttatccaaatcattgatcctgctgatgaa 891

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            || |  || ||||||||||| || ||||| |||||||||||||| ||||| ||| | || 
Sbjct: 892  gacaagttcgactttgacccgctcgatgtgaccaagacctggcctgaggatatcttgcct 951

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            || ||||| |||||||| |||||  ||||||||||||||||||| ||||| || || |||
Sbjct: 952  cttcaacctgttggacgtatggtgttgaacaagaacattgacaacttctttgcagagaat 1011

                                                                        
Query: 601  gaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgatgataag 660
            || || ||||||||||| || ||| | | |||||| || || || ||||| |||||||||
Sbjct: 1012 gagcaacttgctttctgtcctgcaattattgtcccagggatacattactcagatgataag 1071

                 
Query: 661  ctgct 665
            |||||
Sbjct: 1072 ctgct 1076

---

>gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, complete cds
          Length = 1917

 Score =  212 bits (107), Expect = 1e-51
 Identities = 506/639 (79%)
 Strand = Plus / Plus

                                                                        
Query: 4    ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
            |||||||| |||||||||||||| ||||||||||||||||| ||||| ||||| ||| | 
Sbjct: 429  ggttttgctgtgaagttctacactagagagggtaactttgatcttgtggggaataatttc 488

                                                                        
Query: 64   cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
            || |||||||||||||| ||||| || || ||||||||||||||||| || || ||||||
Sbjct: 489  ccagtgttttttatccgtgatggcattaaattccctgacatggtccacgcattgaagcca 548

                                                                        
Query: 124  agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
            |  ||||| ||  |||| || |||||||||||  |  ||||||| || || |||||||| 
Sbjct: 549  aacccgaaaacacacatccaagagaactggaggatccttgactttttctctcaccaccca 608

                                                                        
Query: 184  gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 243
            ||||||||||| ||||| || || || ||||| ||  |||| |||||     ||||||||
Sbjct: 609  gagagtctgcatatgtttacatttctctttgatgacattggtattcctacagactatagg 668

                                                                        
Query: 244  cacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggctcac 303
            || ||||| ||||  |||||  ||||||||||  |  |||||| ||| || || || || 
Sbjct: 669  catatggatggttcaggtgtgcacacctacacacttgtcagcaaggaagggaaagcccat 728

                                                                        
Query: 304  ctggttaagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagcc 363
               ||||||||||| |||||||| |||||||| ||||| |  || ||||||||||| || 
Sbjct: 729  tatgttaagttccactggaaacccacatgtggagtgaaatctctgttggatgatgaggct 788

                                                                        
Query: 364  gttactgttggaggcacctgccacacccatgccacaaaggacttgactgattctattgca 423
            |||   ||||||||  ||   || |  |||||||| |||||  | |||||| | ||||| 
Sbjct: 789  gttgtggttggaggtgccaatcatagtcatgccaccaaggatcttactgatgccattgct 848

                                                                        
Query: 424  gctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgaggat 483
            ||||| || ||||| || |||||||| |  || ||||  || ||| | ||||| ||||| 
Sbjct: 849  gctggtaactaccctgagtggaagctctatattcagataatggatccggatcatgaggac 908

                                                                        
Query: 484  agatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactg 543
            || || || |||||||| ||||||||||||||||| ||||| || || ||| | || || 
Sbjct: 909  aggttcgattttgacccacttgatgtcaccaagacatggcctgaagatatcttgcctctc 968

                                                                        
Query: 544  caaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaa 603
            || ||||||||||| |||||  |||||||||| || || || ||||| || || ||||||
Sbjct: 969  cagccagttggacgcatggtcttgaacaagaatatcgataacttctttgcagagaatgaa 1028

                                                   
Query: 604  cagcttgctttctgcccagcagtcactgtccctggaatc 642
            ||||| ||||| ||||||||| ||| ||| |||||||||
Sbjct: 1029 cagctagctttttgcccagcaatcattgtgcctggaatc 1067

---

>gb|AY641732.1| Camellia sinensis catalase mRNA, partial cds
          Length = 782

 Score =  210 bits (106), Expect = 4e-51
 Identities = 508/642 (79%)
 Strand = Plus / Plus

                                                                       
Query: 24  caccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgaga 83
           |||||||||||| |||||||| || || || |||||| | || || |||||  |||| ||
Sbjct: 1   caccagagaggggaactttgatctggtgggaaacaatttccccgtttttttcgtccgtga 60

                                                                       
Query: 84  tgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgca 143
           ||| ||||||||||| ||||||||||| ||| | || || |  || ||  |  |||| ||
Sbjct: 61  tggaatgaagttcccagacatggtccacgctcttaaacccaaccccaaatctcacatcca 120

                                                                       
Query: 144 ggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcac 203
           |||||| |||||| |  ||||||||||||| ||||| || |||||| |||| ||||||||
Sbjct: 121 ggagaattggagaatccttgacttcttttctcaccatccagagagtttgcatatgttcac 180

                                                                       
Query: 204 cttcctatttgacgatgttggcattccactcaactataggcacatggacggttttggtgt 263
           |||||| ||||| ||||  ||  |||| |   |||| ||||||||||| || | ||||||
Sbjct: 181 cttcctctttgatgatgcgggtgttccgcaagactacaggcacatggaaggctctggtgt 240

                                                                       
Query: 264 caacacctacaccttaatcagcagggatggaaaggctcacctggttaagttccattggaa 323
            ||||||||||| ||||||| ||  | ||| |||||||||   || ||||| ||||||||
Sbjct: 241 taacacctacactttaatcaacaaagctgggaaggctcactatgtcaagtttcattggaa 300

                                                                       
Query: 324 acctacatgtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctg 383
           |||||| ||||| ||||||||  | ||||| || || ||| |||  ||||| ||  |   
Sbjct: 301 acctacctgtggagtgaagtgtttgttggaggaagaggccattaaggttgggggagctaa 360

                                                                       
Query: 384 ccacacccatgccacaaaggacttgactgattctattgcagctgggaattacccagaatg 443
            |||| ||||||||| |||||  ||  ||| || || ||||||||||| ||||| |||||
Sbjct: 361 tcacagccatgccaccaaggatctgtatgactcaatagcagctgggaactaccctgaatg 420

                                                                       
Query: 444 gaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccctct 503
           ||| |||||||||||||  || ||| ||||||| || || |||||||| ||||| || ||
Sbjct: 421 gaaacttttcatccagataatcgatcctgatcatgaagacagatttgattttgatccact 480

                                                                       
Query: 504 tgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatggt 563
           |||||| |||||||||||||| ||||||||||| || ||||| || || || ||  ||||
Sbjct: 481 tgatgtaaccaagacctggcctgaggacatcatacctctgcagccggtgggccgcttggt 540

                                                                       
Query: 564 actgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagc 623
             |||| |||||||| || || ||||| || || ||||| |||||||| || ||||| ||
Sbjct: 541 cttgaataagaacatggataacttctttgcagagaatgagcagcttgcattttgccctgc 600

                                                     
Query: 624 agtcactgtccctggaatccactactctgatgataagctgct 665
             ||| ||| |||||  || |||| || ||||||||||||||
Sbjct: 601 tatcattgtacctggtgtctactattcagatgataagctgct 642

---

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score =  178 bits (90), Expect = 2e-41
 Identities = 498/634 (78%)
 Strand = Plus / Minus

                                                                          
Query: 32     agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
              |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 157193 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 157134

                                                                          
Query: 92     agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
              ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 157133 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 157074

                                                                          
Query: 152    ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
              ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 157073 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 157014

                                                                          
Query: 212    ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
              | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 157013 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 156954

                                                                          
Query: 272    acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
              |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 156953 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 156894

                                                                          
Query: 332    gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
              |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 156893 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 156834

                                                                          
Query: 392    atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
              |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 156833 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 156774

                                                                          
Query: 452    tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
              | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 156773 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtga 156714

                                                                          
Query: 512    ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
              ||||||||||||| ||||| ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 156713 ccaagacctggcctgaggatatcttgcctcttcaacctgttggacgtatggtgttgaaca 156654

                                                                          
Query: 572    agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
              ||||||||||||| ||||| || || ||||| || ||||||||||| || ||| | | ||
Sbjct: 156653 agaacattgacaacttctttgcagagaatgagcaacttgctttctgtcctgcaattattg 156594

                                                
Query: 632    tccctggaatccactactctgatgataagctgct 665
              |||| || || || ||||| ||||||||||||||
Sbjct: 156593 tcccagggatacattactcagatgataagctgct 156560



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                
Query: 1      cgtggttttgcagtgaagttctacaccagagagg 34
              |||||||||||||| |||||||||||||||||||
Sbjct: 157302 cgtggttttgcagtcaagttctacaccagagagg 157269

---

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score =  178 bits (90), Expect = 2e-41
 Identities = 498/634 (78%)
 Strand = Plus / Minus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 27271 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 27212

                                                                         
Query: 92    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
             ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 27211 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 27152

                                                                         
Query: 152   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
             ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 27151 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 27092

                                                                         
Query: 212   ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
             | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 27091 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 27032

                                                                         
Query: 272   acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
             |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 27031 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 26972

                                                                         
Query: 332   gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
             |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 26971 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 26912

                                                                         
Query: 392   atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
             |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 26911 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 26852

                                                                         
Query: 452   tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
             | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 26851 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtga 26792

                                                                         
Query: 512   ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
             ||||||||||||| ||||| ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 26791 ccaagacctggcctgaggatatcttgcctcttcaacctgttggacgtatggtgttgaaca 26732

                                                                         
Query: 572   agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
             ||||||||||||| ||||| || || ||||| || ||||||||||| || ||| | | ||
Sbjct: 26731 agaacattgacaacttctttgcagagaatgagcaacttgctttctgtcctgcaattattg 26672

                                               
Query: 632   tccctggaatccactactctgatgataagctgct 665
             |||| || || || ||||| ||||||||||||||
Sbjct: 26671 tcccagggatacattactcagatgataagctgct 26638



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             |||||||||||||| |||||||||||||||||||
Sbjct: 27380 cgtggttttgcagtcaagttctacaccagagagg 27347

---

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score =  178 bits (90), Expect = 2e-41
 Identities = 498/634 (78%)
 Strand = Plus / Minus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 58226 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 58167

                                                                         
Query: 92    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
             ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 58166 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 58107

                                                                         
Query: 152   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
             ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 58106 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 58047

                                                                         
Query: 212   ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
             | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 58046 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 57987

                                                                         
Query: 272   acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
             |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 57986 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 57927

                                                                         
Query: 332   gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
             |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 57926 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 57867

                                                                         
Query: 392   atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
             |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 57866 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 57807

                                                                         
Query: 452   tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
             | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 57806 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtga 57747

                                                                         
Query: 512   ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
             ||||||||||||| ||||| ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 57746 ccaagacctggcctgaggatatcttgcctcttcaacctgttggacgtatggtgttgaaca 57687

                                                                         
Query: 572   agaacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactg 631
             ||||||||||||| ||||| || || ||||| || ||||||||||| || ||| | | ||
Sbjct: 57686 agaacattgacaacttctttgcagagaatgagcaacttgctttctgtcctgcaattattg 57627

                                               
Query: 632   tccctggaatccactactctgatgataagctgct 665
             |||| || || || ||||| ||||||||||||||
Sbjct: 57626 tcccagggatacattactcagatgataagctgct 57593



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             |||||||||||||| |||||||||||||||||||
Sbjct: 58335 cgtggttttgcagtcaagttctacaccagagagg 58302

---

>emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit 1 (EC 1.11.1.6)
          Length = 1666

 Score =  161 bits (81), Expect = 4e-36
 Identities = 189/225 (84%)
 Strand = Plus / Plus

                                                                        
Query: 442  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
            |||||||| ||||||||||| |||||| |||| || || |||| ||||||||||||||||
Sbjct: 847  tggaagctcttcatccagacaattgatcctgaccatgaagataaatttgactttgaccct 906

                                                                        
Query: 502  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
            |||||||| || ||||||||||| ||||||||| | || ||||| || ||||| ||  ||
Sbjct: 907  cttgatgtgactaagacctggcctgaggacatcttgcccctgcagcctgttggccgcttg 966

                                                                        
Query: 562  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccca 621
            ||  |||| |||||||||||||| |||||||| ||||||||||||||||| || ||||| 
Sbjct: 967  gttttgaataagaacattgacaacttcttcgccgaaaatgaacagcttgcattttgccct 1026

                                                         
Query: 622  gcagtcactgtccctggaatccactactctgatgataagctgctc 666
            ||  |    || ||||||||| ||||||| ||||||||| |||||
Sbjct: 1027 gccattgtggttcctggaatctactactcagatgataagttgctc 1071



 Score =  107 bits (54), Expect = 5e-20
 Identities = 99/114 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||||||||||||||||||| |||||||||| ||||| ||||| || ||||||
Sbjct: 406 cgtggttttgcagtgaagttctacacccgagagggtaattttgatcttgtgggaaacaat 465

                                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgct 114
            | || || || ||||| || ||||| ||||| |||||||| ||||||||||||
Sbjct: 466 ttcccagtcttctttattcgtgatggaatgaaattccctgatatggtccatgct 519

---

>gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, complete cds
          Length = 1800

 Score =  149 bits (75), Expect = 1e-32
 Identities = 171/203 (84%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            ||||| ||||| || || || ||||||||||| ||||||||||| |||||| ||||||| 
Sbjct: 857  attgctgctggtaactatccggaatggaagctcttcatccagacgattgatcctgatcat 916

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||| ||||||||||||||||||||||| |||||||| ||||| || |||||  | 
Sbjct: 917  gaggataggtttgactttgaccctcttgatgtgaccaagacatggccggaagacattttg 976

                                                                        
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 597
            || || || || ||||| ||  |||| |||||||||||||| ||||| ||||| || || 
Sbjct: 977  cctcttcagcctgttggccgcttggtcctgaacaagaacatcgacaacttctttgctgag 1036

                                   
Query: 598  aatgaacagcttgctttctgccc 620
            ||||| |||||||| ||||||||
Sbjct: 1037 aatgagcagcttgcattctgccc 1059



 Score =  125 bits (63), Expect = 2e-25
 Identities = 204/251 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || |||||||| ||| |||||||||||||||| ||||| |||||||| 
Sbjct: 440 cgtggttttgctgtcaagttctatacccgagagggtaactttgatcttgtggggaacaac 499

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | |||||||| || || || ||||| |||||||||||||||||||| |||||  | |||
Sbjct: 500 ttccctgtgttcttcattcgtgatggaatgaagttccctgacatggtgcatgccctgaag 559

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || |  || ||| || |||| |||||| | |||||  |  |||| ||||| || ||||| 
Sbjct: 560 cccaaccccaagtcccacattcaggaggattggaggatccttgatttcttctctcaccat 619

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || ||| ||||||||||| ||||||| ||||| ||| |||||||||| |   |||| 
Sbjct: 620 cctgaaagtttgcacatgttctccttcctctttgatgatattggcattcctcaagactac 679

                      
Query: 241 aggcacatgga 251
           |||||||||||
Sbjct: 680 aggcacatgga 690



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 310 aagttccattggaaacctacatgtggtgtgaag 342
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 749 aagttccactggaagcctacttgtggtgtgaag 781

---

>emb|X94447.1|ATCATAL A.thaliana cat gene for catalase
          Length = 3677

 Score =  147 bits (74), Expect = 5e-32
 Identities = 458/586 (78%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            |||| |||||||| |||||||| |||||  | ||||| || || ||||| ||||||||||
Sbjct: 2190 aggggaactttgatcttgttggaaacaactttcctgttttcttcatccgcgatgggatga 2249

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            ||||||||||||||||||| ||| | ||||| |  || ||  |  |||| || |||||||
Sbjct: 2250 agttccctgacatggtccacgctcttaagccgaacccaaaatctcacatccaagagaact 2309

                                                                        
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
            ||||| |  |||||||||| || |||||||| || ||| || |||||||||| ||||| |
Sbjct: 2310 ggagaatccttgacttcttctcccaccaccctgaaagtttgaacatgttcactttcctct 2369

                                                                        
Query: 212  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
            | || ||| | || || ||||   | || ||||||||||| ||||  |||||||| || |
Sbjct: 2370 tcgatgatatcggtatcccacaagattacaggcacatggatggttcaggtgtcaatacat 2429

                                                                        
Query: 272  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
            |||  || |||| ||  | ||| || ||||||   || ||||||||||||||||| || |
Sbjct: 2430 acatgttgatcaacaaagctggcaaagctcactacgtgaagttccattggaaaccaactt 2489

                                                                        
Query: 332  gtggtgtgaagtgcctcttggatgatgaagccgttactgttggaggcacctgccacaccc 391
            |||| || ||||  || ||||| || || ||  ||  ||||||||| |||  |||||  |
Sbjct: 2490 gtggagtcaagtctcttttggaagaagatgcaattcgtgttggaggaaccaaccacagtc 2549

                                                                        
Query: 392  atgccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttt 451
            |||| ||  | ||||||  ||| ||||| || ||||| || ||||| ||||||||||| |
Sbjct: 2550 atgcgactcaagacttgtatgactctatagctgctggaaactaccctgaatggaagctct 2609

                                                                        
Query: 452  tcatccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtca 511
            | ||||| | ||||||| ||| | | || || |  || ||||||||||| || ||||| |
Sbjct: 2610 ttatccaaatcattgatcctgctgatgaagacaagttcgactttgacccgctcgatgtaa 2669

                                                                        
Query: 512  ccaagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaaca 571
            ||||||||||||| || || ||| | || || ||||| |||||||| |||||  ||||||
Sbjct: 2670 ccaagacctggcctgaagatatcttgcctctccaacctgttggacgtatggtgttgaaca 2729

                                                          
Query: 572  agaacattgacaatttcttcgcggaaaatgaacagcttgctttctg 617
            ||||||||||||| ||||| || || ||||| || ||||| |||||
Sbjct: 2730 agaacattgacaacttctttgcagagaatgagcaacttgccttctg 2775



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            |||||||||||||| |||||||||||||||||||
Sbjct: 2081 cgtggttttgcagtcaagttctacaccagagagg 2114

---

>gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA, complete cds
          Length = 1736

 Score =  147 bits (74), Expect = 5e-32
 Identities = 209/254 (82%)
 Strand = Plus / Plus

                                                                        
Query: 412  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 471
            ||||||||||| | ||||||||| || ||||||||||||||||| ||||| || ||| | 
Sbjct: 820  gattctattgcggatgggaattatccggaatggaagcttttcattcagactatggatccg 879

                                                                        
Query: 472  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 531
            ||||| |||||||| |||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 880  gatcatgaggataggtttgactttgacccgcttgatgtgaccaagacctggcccgaggat 939

                                                                        
Query: 532  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            ||| | ||  |||| || || || || |||||  |||||||||||||||| || ||||| 
Sbjct: 940  atcttgcctttgcagcctgtgggtcgtatggttttgaacaagaacattgataacttcttt 999

                                                                        
Query: 592  gcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactct 651
            ||||| |||||||| || || || ||||| ||  ||| ||| ||||| ||  | || || 
Sbjct: 1000 gcggagaatgaacaactggcgttttgccctgcgatcattgtgcctgggatttattattcg 1059

                          
Query: 652  gatgataagctgct 665
            ||||||||||||||
Sbjct: 1060 gatgataagctgct 1073



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 244 cacatggacggttttggtgtcaacacctacac 275
           ||||||||||||| ||||||||||||||||||
Sbjct: 652 cacatggacggttctggtgtcaacacctacac 683



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcac 203
           ||||| || |||||||| || |||||||| |||||||||||
Sbjct: 571 gactttttctcgcaccatcccgagagtctacacatgttcac 611

---

>ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalase AT1G20630 (CAT1)
           mRNA, complete cds
          Length = 1929

 Score =  135 bits (68), Expect = 2e-28
 Identities = 167/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 440 cgtggttttgctgttaagttttacaccagagaggggaactttgatcttgttgggaacaac 499

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || ||  |||| ||||| ||||| |||||||||||||||||||| || || 
Sbjct: 500 ttccctgtattcttcgtccgtgatggaatgaaattccctgacatggtccatgcattgaaa 559

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || | ||| ||| |  |||| ||||||||||||||  || | |||||||| || ||||||
Sbjct: 560 ccgaatcccaagtctcacattcaggagaactggaggatactggacttcttctcccaccac 619

                               
Query: 181 ccggagagtctgcacatgtt 200
           || |||||| ||||||||||
Sbjct: 620 ccagagagtttgcacatgtt 639

---

>gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, complete cds
          Length = 1928

 Score =  135 bits (68), Expect = 2e-28
 Identities = 167/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 439 cgtggttttgctgttaagttttacaccagagaggggaactttgatcttgttgggaacaac 498

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || ||  |||| ||||| ||||| |||||||||||||||||||| || || 
Sbjct: 499 ttccctgtattcttcgtccgtgatggaatgaaattccctgacatggtccatgcattgaaa 558

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || | ||| ||| |  |||| ||||||||||||||  || | |||||||| || ||||||
Sbjct: 559 ccgaatcccaagtctcacattcaggagaactggaggatactggacttcttctcccaccac 618

                               
Query: 181 ccggagagtctgcacatgtt 200
           || |||||| ||||||||||
Sbjct: 619 ccagagagtttgcacatgtt 638

---

>gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence
          Length = 1794

 Score =  135 bits (68), Expect = 2e-28
 Identities = 239/296 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| || || |||||||| 
Sbjct: 450 cgtggttttgctgtcaagttttacaccagagagggaaactttgatctggtagggaacaac 509

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| ||||||||||||||||||||||||||| | |||
Sbjct: 510 ttccccgtcttcttcatccgtgatggaatgaagttccctgacatggtccatgctctgaag 569

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||| || | || |||||||| ||||| ||  |||| || || || || || 
Sbjct: 570 ccaaatcctaagtcccatatccaggagaattggagggtccttgattttttctctcatcat 629

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || || |||||||||||||| ||||| || |||||| |||| |||||||   | || 
Sbjct: 630 cccgaaagcctgcacatgttcactttcctcttcgacgatattggtattccacaagattac 689

                                                                   
Query: 241 aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaa 296
           ||||| |||||||| | ||||||| |||| | ||| || |||| ||||| ||||||
Sbjct: 690 aggcatatggacgggtctggtgtccacacattcacattgatcaacagggctggaaa 745



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                        
Query: 415  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
            |||||||||||||| ||||| || ||||||||||| ||||| ||||  || ||| | || 
Sbjct: 864  tctattgcagctggaaattatcctgaatggaagctcttcattcagattatggatccagaa 923

                                                                        
Query: 475  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 534
            || || || | |||||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 924  catgaagacaaatttgactttgatccacttgatgtgacaaaaacttggccagaggacatc 983

                                                                        
Query: 535  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 594
             | ||  |||| || || ||| |  | || ||||||||||||||||| || |||||    
Sbjct: 984  ttgcctttgcagccggtgggaagattagttctgaacaagaacattgataacttctttaat 1043

                                      
Query: 595  gaaaatgaacagcttgctttctgccc 620
            || ||||| ||||| |||||||||||
Sbjct: 1044 gagaatgagcagctagctttctgccc 1069

---

>gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds
          Length = 1479

 Score =  135 bits (68), Expect = 2e-28
 Identities = 167/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 358 cgtggttttgctgttaagttttacaccagagaggggaactttgatcttgttgggaacaac 417

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || ||  |||| ||||| ||||| |||||||||||||||||||| || || 
Sbjct: 418 ttccctgtattcttcgtccgtgatggaatgaaattccctgacatggtccatgcattgaaa 477

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || | ||| ||| |  |||| ||||||||||||||  || | |||||||| || ||||||
Sbjct: 478 ccgaatcccaagtctcacattcaggagaactggaggatactggacttcttctcccaccac 537

                               
Query: 181 ccggagagtctgcacatgtt 200
           || |||||| ||||||||||
Sbjct: 538 ccagagagtttgcacatgtt 557

---

>gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630) mRNA, complete
           cds
          Length = 1746

 Score =  135 bits (68), Expect = 2e-28
 Identities = 167/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 440 cgtggttttgctgttaagttttacaccagagaggggaactttgatcttgttgggaacaac 499

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || ||  |||| ||||| ||||| |||||||||||||||||||| || || 
Sbjct: 500 ttccctgtattcttcgtccgtgatggaatgaaattccctgacatggtccatgcattgaaa 559

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || | ||| ||| |  |||| ||||||||||||||  || | |||||||| || ||||||
Sbjct: 560 ccgaatcccaagtctcacattcaggagaactggaggatactggacttcttctcccaccac 619

                               
Query: 181 ccggagagtctgcacatgtt 200
           || |||||| ||||||||||
Sbjct: 620 ccagagagtttgcacatgtt 639

---

>gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds
          Length = 1735

 Score =  131 bits (66), Expect = 3e-27
 Identities = 207/254 (81%)
 Strand = Plus / Plus

                                                                        
Query: 412  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 471
            ||||| ||||| ||||| || ||||| || ||||||||||| ||||||||||||||| | 
Sbjct: 785  gattcgattgctgctggaaactaccccgagtggaagctttttatccagaccattgatccg 844

                                                                        
Query: 472  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 531
            |||||||||||| |  | ||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 845  gatcacgaggatcggctcgactttgacccgcttgatgttaccaagacctggcctgaggat 904

                                                                        
Query: 532  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            ||| | ||  |||| || || || ||  ||||  |||||||||| |||||||| ||||| 
Sbjct: 905  atctttccgttgcagcctgtgggtcgtctggttttgaacaagaatattgacaacttcttt 964

                                                                        
Query: 592  gcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactct 651
            || || ||||||||||| || || || || ||  ||| ||| ||||||||| | || |||
Sbjct: 965  gctgagaatgaacagctggcattttgtcctgctatcattgttcctggaatctattattct 1024

                          
Query: 652  gatgataagctgct 665
            ||||||||| ||||
Sbjct: 1025 gatgataagttgct 1038



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           ||||| |||||||||||||||||| ||||||||||||||||  | || || |||||| | 
Sbjct: 377 ggtttcgcagtgaagttctacacccgagagggtaactttgatttggtgggaaacaatttc 436

                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggt 107
           || ||||| ||||| || ||||| ||||| || || ||||||||
Sbjct: 437 ccggtgttctttattcgtgatggaatgaaatttcccgacatggt 480



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 244 cacatggacggttttggtgtcaacacctacac 275
           ||||||||||| |  |||||||||||||||||
Sbjct: 617 cacatggacggatccggtgtcaacacctacac 648

---

>emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 gene)
          Length = 1693

 Score =  129 bits (65), Expect = 1e-26
 Identities = 218/269 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || |||||||||||||||||||| |||||||| || || |||||||| 
Sbjct: 338 cgtggttttgctgtcaagttctacaccagagagggaaactttgatctggtagggaacaac 397

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||||| ||||| ||||||||||||||||||||||| ||  | |||
Sbjct: 398 ttccctgtcttcttcatccgtgatggaatgaagttccctgacatggtccacgcgctgaag 457

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||| || | || |||||||| ||||||||  |||| || || || ||    
Sbjct: 458 ccaaatcctaagtcccatatccaggagaattggagagtccttgattttttctctcatgtt 517

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || ||||||||||||||||| ||||| || |||||| |||| |||||||   | || 
Sbjct: 518 cctgaaagtctgcacatgttcactttcctcttcgacgatattggtattccacaagattac 577

                                        
Query: 241 aggcacatggacggttttggtgtcaacac 269
           ||||| ||||| |||| ||||||| ||||
Sbjct: 578 aggcatatggatggttctggtgtccacac 606



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 752 tctattgctgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 811

                                                                   
Query: 475 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           || || || |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 812 catgaagacagatttgattttgatccacttgatgtgacaaaaacttggccagagga 867

---

>gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, complete cds
          Length = 1725

 Score =  127 bits (64), Expect = 5e-26
 Identities = 238/296 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| || || |||||||| 
Sbjct: 380 cgtggttttgctgtcaagttttacaccagagagggaaactttgatctggtagggaacaac 439

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| ||||||||||||||||||||||||||| | |||
Sbjct: 440 ttccccgtcttcttcatccgtgatggaatgaagttccctgacatggtccatgctctgaag 499

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||| || | || |||||||| ||||| ||  |||| || || || || || 
Sbjct: 500 ccaaatcctaagtcccatatccaggagaattggagggtccttgattttttctctcatcat 559

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || || |||||||||||||| ||||| || |||||| |||| ||||| |   | || 
Sbjct: 560 cccgaaagcctgcacatgttcactttcctcttcgacgatattggtattccccaagattac 619

                                                                   
Query: 241 aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaa 296
           ||||| |||||||| | ||||||| |||| | ||| || |||| ||||| ||||||
Sbjct: 620 aggcatatggacgggtctggtgtccacacattcacattgatcaacagggctggaaa 675



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 486 atttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 534
           |||||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 865 atttgactttgatccacttgatgtgacaaaaacttggccagaggacatc 913



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 415 tctattgcagctgggaattacccagaatggaa 446
           |||||||||||||| ||||| || ||||||||
Sbjct: 794 tctattgcagctggaaattatcctgaatggaa 825

---

>gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, complete cds
          Length = 1792

 Score =  127 bits (64), Expect = 5e-26
 Identities = 148/176 (84%)
 Strand = Plus / Plus

                                                                        
Query: 490  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
            |||||||||||||| |||||||||||||||||||| ||||| ||| | || || || || 
Sbjct: 920  gactttgaccctctcgatgtcaccaagacctggcctgaggatatcttgcctctccagccc 979

                                                                        
Query: 550  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 609
            ||||| || |||||  |||||||||||||||| || ||||| ||||| || || ||||||
Sbjct: 980  gttgggcgtatggtgttgaacaagaacattgataacttctttgcggagaacgagcagctt 1039

                                                                    
Query: 610  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgct 665
            ||||||||||| ||  ||| ||| || || || ||||||||||| |||||||||||
Sbjct: 1040 gctttctgccctgcgatcattgttccggggatacactactctgacgataagctgct 1095



 Score =  121 bits (61), Expect = 3e-24
 Identities = 172/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||| |||||||| |||||||||||||||||||| |||||||| ||||| || ||||| 
Sbjct: 431 cgtggctttgcagtcaagttctacaccagagaggggaactttgatcttgtcggaaacaac 490

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||||| || || ||||||||||||||||||||||| ||| |||| 
Sbjct: 491 ttccctgtcttcttcatccgcgacggtatgaagttccctgacatggtccacgctctcaaa 550

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           ||||  || ||  |  |||| || ||||||||||||||  |||||||||| || ||||||
Sbjct: 551 ccaaacccaaaatcacacatccaagagaactggagagtccttgacttcttctcccaccac 610

                                        
Query: 181 ccggagagtctgcacatgttcaccttcct 209
           || |||||  |  |||||||||| |||||
Sbjct: 611 cctgagagcttaaacatgttcactttcct 639

---

>emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 gene)
          Length = 1813

 Score =  125 bits (63), Expect = 2e-25
 Identities = 105/119 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 366 cgtggttttgcagtgaagttttacaccagagagggtaattttgacctggttggaaacaat 425

                                                                      
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaa 119
            | ||||| |||||| | || ||||| ||||| ||||| ||||||||||||||| ||||
Sbjct: 426 ttccctgtcttttttgttcgtgatggaatgaaattcccggacatggtccatgctctcaa 484



 Score =  115 bits (58), Expect = 2e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 411 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
           |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| |||||| |
Sbjct: 776 tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaattgatcc 835

                                                                       
Query: 471 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           |||||| ||||| ||||||||||||||||| |||||||| || ||||||||||| || ||
Sbjct: 836 tgatcatgaggacagatttgactttgacccacttgatgtaactaagacctggcctgaaga 895

                                                                       
Query: 531 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
            ||  | || ||||| |||||||| ||  |||| ||||| || |||||||| || |||||
Sbjct: 896 tattcttcctctgcagccagttggccgtctggttctgaataaaaacattgataacttctt 955

                                         
Query: 591 cgcggaaaatgaacagcttgctttctgccc 620
            || || |||||||| ||||| || |||||
Sbjct: 956 tgcagagaatgaacaacttgcattttgccc 985



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 161 ttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatg 220
           |||||||||| || |||||||| || || |||||||||||||||||||||||||| ||| 
Sbjct: 526 ttgacttcttctcccaccacccagaaagcctgcacatgttcaccttcctatttgatgatc 585

                                                               
Query: 221 ttggcattccactcaactataggcacatggacggttttggtgtcaacaccta 272
           | ||  ||||||   | || ||||||||||| || | |||||| ||||||||
Sbjct: 586 tgggagttccacaagattacaggcacatggaaggctctggtgttaacaccta 637

---

>gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA, complete cds
          Length = 1791

 Score =  125 bits (63), Expect = 2e-25
 Identities = 96/107 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| |||||||||||||||||||||||||||||||| || || |||||||||
Sbjct: 413 cgtggttttgctgtgaagttctacaccagagagggtaactttgatctggtggggaacaat 472

                                                          
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggt 107
            | ||||| ||||||||||| ||||| ||||| |||||||| |||||
Sbjct: 473 ttccctgtcttttttatccgtgatggtatgaaattccctgatatggt 519



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 335/434 (77%)
 Strand = Plus / Plus

                                                                        
Query: 166  ttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgttggc 225
            ||||| || ||||| || |||||| ||||||||||||| || || ||||| ||| | || 
Sbjct: 578  ttcttctcccaccatcctgagagtttgcacatgttcacttttctctttgatgatatcgga 637

                                                                        
Query: 226  attccactcaactataggcacatggacggttttggtgtcaacacctacaccttaatcagc 285
            |||||    ||||| ||||||||||| |||| |||||| ||||| ||||| ||||| | |
Sbjct: 638  attcctgcaaactacaggcacatggaaggttctggtgttaacacatacactttaattaac 697

                                                                        
Query: 286  agggatggaaaggctcacctggttaagttccattggaaacctacatgtggtgtgaagtgc 345
            | || ||||||  |  ||   || |||||||| |||||||| |||||||| |||||| ||
Sbjct: 698  aaggctggaaaaacatactacgtgaagttccactggaaaccaacatgtggggtgaagagc 757

                                                                        
Query: 346  ctcttggatgatgaagccgttactgttggaggcacctgccacacccatgccacaaaggac 405
            || ||||| ||||| ||| |||  ||||||||  |   ||||| |||||| ||  |||||
Sbjct: 758  ctgttggaggatgaggccattaaagttggaggagctaaccacagccatgctacgcaggac 817

                                                                        
Query: 406  ttgactgattctattgcagctgggaattacccagaatggaagcttttcatccagaccatt 465
             |   ||| || ||||||  |||||| || || || |||||||||||||||||||| || 
Sbjct: 818  ctctatgactcaattgcaagtgggaactatcctgagtggaagcttttcatccagacaata 877

                                                                        
Query: 466  gatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggcca 525
            ||  | | | | || |||| ||||||||||||||| || ||||| || || || ||||| 
Sbjct: 878  gacccagctgatgaagataaatttgactttgaccccctagatgttacaaaaacatggcct 937

                                                                        
Query: 526  gaggacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaat 585
            ||||| ||  | || || || ||||| || ||  | ||  ||||||||||||||||||| 
Sbjct: 938  gaggatattttgcccctacagccagtgggtcgtttagtgttgaacaagaacattgacaac 997

                          
Query: 586  ttcttcgcggaaaa 599
            ||||| || |||||
Sbjct: 998  ttctttgcagaaaa 1011

---

>emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8
          Length = 3947

 Score =  125 bits (63), Expect = 2e-25
 Identities = 168/203 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            ||||||||||| |  || || || ||||| |||||||||||||| |||||| |||| || 
Sbjct: 2420 attgcagctggcacctatcctgagtggaaacttttcatccagacaattgatcctgaccat 2479

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            || |  || ||||| |||||||| |||||||| |||||||||||||| ||||| ||| | 
Sbjct: 2480 gaagccaggtttgattttgacccacttgatgtaaccaagacctggcctgaggatatcttg 2539

                                                                        
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 597
            || ||||| |||||||| ||  ||||  |||| |||||||| ||||| ||||| || |||
Sbjct: 2540 cccctgcagccagttggtcgcttggtcttgaataagaacatcgacaacttctttgctgaa 2599

                                   
Query: 598  aatgaacagcttgctttctgccc 620
            ||||| |||||||||||||||||
Sbjct: 2600 aatgagcagcttgctttctgccc 2622



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 242/310 (78%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            ||||||||||||| || || || |||||| | ||||| || || ||||| ||||| ||||
Sbjct: 2034 agggtaactttgatctcgtgggaaacaatttccctgtcttcttcatccgtgatggaatga 2093

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            | ||||| |||||||| |||||  | ||||| |  || ||| |  | || ||||||||||
Sbjct: 2094 aattcccagacatggtgcatgccctgaagcccaaccctaagtctcatattcaggagaact 2153

                                                                        
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
            ||||  |  |||||||||| || ||||| || || ||| ||||||||||| |||||||||
Sbjct: 2154 ggaggattcttgacttcttctcccaccatcctgaaagtttgcacatgttctccttcctat 2213

                                                                        
Query: 212  ttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacct 271
            |||| ||| | ||  ||||||   | ||||| || ||||| || | |||||| |||||||
Sbjct: 2214 ttgatgatttgggtgttccacaagattatagacatatggaaggctctggtgttaacacct 2273

                                                                        
Query: 272  acaccttaatcagcagggatggaaaggctcacctggttaagttccattggaaacctacat 331
            |||  || |||| || || |||||| || ||    || || || |||||||||||||| |
Sbjct: 2274 acatgttgatcaacaaggctggaaaagcccattatgtgaaatttcattggaaacctactt 2333

                      
Query: 332  gtggtgtgaa 341
            ||||||||||
Sbjct: 2334 gtggtgtgaa 2343



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            ||||| |||||||||||||| |||||||||||||
Sbjct: 1522 cgtggatttgcagtgaagttttacaccagagagg 1555

---

>gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, complete cds
          Length = 1778

 Score =  123 bits (62), Expect = 8e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||| || ||||| |||||||||||||||||||| |||||||| ||||| || ||||| 
Sbjct: 421 cgtggcttcgcagtcaagttctacaccagagagggaaactttgatcttgtcggaaacaac 480

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||||| || |||||||||||||||||||||||||| ||| |||| 
Sbjct: 481 ttccctgtcttcttcatccgcgacgggatgaagttccctgacatggtccacgctctcaaa 540

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           ||||  || ||  |  |||| || ||||||||||||||  |||||||||| || ||||||
Sbjct: 541 ccaaaccccaaatctcacatccaagagaactggagagtccttgacttcttctcccaccac 600

                                                 
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacga 218
           || || || ||  |||||||||| ||||| || |||||
Sbjct: 601 cctgaaagcctcaacatgttcactttcctcttcgacga 638



 Score =  103 bits (52), Expect = 7e-19
 Identities = 145/176 (82%)
 Strand = Plus / Plus

                                                                        
Query: 490  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
            |||||||||||||| |||||||||||||| ||||| || || ||| | || || || || 
Sbjct: 910  gactttgaccctctcgatgtcaccaagacttggcctgaagatatcttgcctctccagccc 969

                                                                        
Query: 550  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 609
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 970  gttgggcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 1029

                                                                    
Query: 610  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgct 665
            || ||||| || ||  ||| ||| || || || ||||||||||| |||||||||||
Sbjct: 1030 gccttctgtcctgctatcattgttccggggatacactactctgacgataagctgct 1085

---

>gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catalase mRNA, complete cds
          Length = 1845

 Score =  123 bits (62), Expect = 8e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| ||||||||||||||||||||||||||||||||  | || || |||||| | 
Sbjct: 448 ggttttgctgtgaagttctacaccagagagggtaactttgatatggtaggaaacaatttc 507

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           |||||||| || ||||| ||||| ||||||||||| || ||||| |||||| |||| || 
Sbjct: 508 cctgtgttcttcatccgtgatggtatgaagttccccgatatggtgcatgctctcaaaccc 567

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           |  || ||  || |||| || ||||| ||||||||  | || ||||| || ||||| || 
Sbjct: 568 aaccccaaatcccacatccaagagaattggagagtcctcgatttcttctcccaccatccc 627

                                                 
Query: 184 gagagtctgcacatgttcaccttcctatttgacgatgt 221
           |||||| ||||||||||||| ||||| ||||| |||||
Sbjct: 628 gagagtttgcacatgttcactttcctctttgatgatgt 665



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                        
Query: 481  gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
            |||| ||||||||||||||| || ||||| |||||||| ||||| ||||||||  | || 
Sbjct: 925  gataaatttgactttgacccactagatgttaccaagacttggcctgaggacattttgccg 984

                                                                        
Query: 541  ctgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaat 600
            ||||| ||||| || ||  ||||  ||||||| ||||||||||| ||||| || ||||||
Sbjct: 985  ctgcagccagtgggtcgtttggttttgaacaaaaacattgacaacttctttgcagaaaat 1044

                    
Query: 601  gaacagct 608
            || |||||
Sbjct: 1045 gagcagct 1052

---

>gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds
          Length = 1648

 Score =  121 bits (61), Expect = 3e-24
 Identities = 217/269 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || |||||||||||||||||||| || ||||| || || |||||||| 
Sbjct: 307 cgtggttttgctgtcaagttctacaccagagagggaaattttgatctggtagggaacaac 366

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| ||||||||||||||||||||||||||| | |||
Sbjct: 367 tttcccgtcttcttcatccgtgatggaatgaagttccctgacatggtccatgctctgaag 426

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||| || | || |||||||| |||||  |  |||| || || || || || 
Sbjct: 427 ccaaatcctaagtcccatatccaggagaattggaggatccttgattttttctctcatcat 486

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || || |||||||||||||| ||||| || |||||| |||| |||||||   | || 
Sbjct: 487 cccgaaagcctgcacatgttcactttcctcttcgacgatattggtattccacaagattac 546

                                        
Query: 241 aggcacatggacggttttggtgtcaacac 269
           ||||| |||||||| | ||||||| ||||
Sbjct: 547 aggcatatggacgggtctggtgtccacac 575



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 135/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           |||||||||||||| ||||| || ||||||||||| ||||| ||||  || ||| | |||
Sbjct: 721 tctattgcagctggaaattatcctgaatggaagctcttcattcagattatggatccagat 780

                                                                       
Query: 475 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 534
           || || || | |||||||||||| || |||||||| || || || ||||||||||| |||
Sbjct: 781 catgaagacaaatttgactttgatccacttgatgtgacaaaaacttggccagaggatatc 840

                                                          
Query: 535 atcccactgcaaccagttggacggatggtactgaacaagaacattga 581
            | ||  |||| || || ||| |  |||| |||||||||||||||||
Sbjct: 841 ttgcctttgcagccggtgggaagattggttctgaacaagaacattga 887

---

>gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, complete cds
          Length = 1744

 Score =  121 bits (61), Expect = 3e-24
 Identities = 217/269 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || |||||||||||||||||||| |||||||| || || |||||||| 
Sbjct: 398 cgtggttttgctgtcaagttctacaccagagagggaaactttgatctggtagggaacaac 457

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| ||||||||||||||||||||||||||| | |||
Sbjct: 458 ttccccgtattcttcatccgtgatggaatgaagttccctgacatggtccatgctctgaag 517

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||| || | || |||||||| ||||| ||  |||| || || || ||    
Sbjct: 518 ccaaatcctaagtcccatatccaggagaattggagggtccttgattttttctctcatgtt 577

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || || |||||||||||||| ||||| || |||||| |||| |||||||   | || 
Sbjct: 578 cctgaaagcctgcacatgttcactttcctcttcgacgatattggtattccacaagattac 637

                                        
Query: 241 aggcacatggacggttttggtgtcaacac 269
           ||||| |||||||| | ||||||| ||||
Sbjct: 638 aggcatatggacggatctggtgtccacac 666



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 163/206 (79%)
 Strand = Plus / Plus

                                                                        
Query: 415  tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
            |||||||||||||| ||||| || ||||||||||| ||||| ||||| || ||| |   |
Sbjct: 812  tctattgcagctggaaattatcctgaatggaagctcttcattcagactatggatccaagt 871

                                                                        
Query: 475  cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 534
            || || || |||||||| || || || |||||||| || || || ||||||||||| |||
Sbjct: 872  catgaagacagatttgatttcgatccgcttgatgtgactaaaacttggccagaggatatc 931

                                                                        
Query: 535  atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 594
             | ||  |||| || || ||| |  | || ||||||||||||||||| || |||||    
Sbjct: 932  ttgcctttgcagccggtgggaagattagttctgaacaagaacattgataacttctttaat 991

                                      
Query: 595  gaaaatgaacagcttgctttctgccc 620
            |||||||| ||||| |||||||||||
Sbjct: 992  gaaaatgagcagctagctttctgccc 1017

---

>emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subunit 2
          Length = 1763

 Score =  119 bits (60), Expect = 1e-23
 Identities = 174/212 (82%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           ||||| || ||||| || |||||  ||||||| || ||||| || || ||||||||| | 
Sbjct: 398 ggtttcgctgtgaaattttacactcgagagggaaattttgatctcgtggggaacaatttc 457

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           ||||||||||| ||||| || || |||||||||||||| |||||||||||| | || |||
Sbjct: 458 cctgtgtttttcatccgtgacggaatgaagttccctgatatggtccatgctcttaaacca 517

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           |  |||||| || |||| ||||| ||||||||  |  | ||||||||||||||||| || 
Sbjct: 518 aacccgaagtcccacattcaggaaaactggaggattctggacttcttttcgcaccatccc 577

                                           
Query: 184 gagagtctgcacatgttcaccttcctatttga 215
           || ||  ||||||||||||||||||| |||||
Sbjct: 578 gaaagcttgcacatgttcaccttcctgtttga 609



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 478 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
           |||||||| ||||| |||||||| |||||||| |||||||| ||||||||||||||| ||
Sbjct: 872 gaggataggtttgattttgacccacttgatgtaaccaagacatggccagaggacatcttc 931

                                                    
Query: 538 ccactgcaaccagttggacggatggtactgaacaagaacat 578
           ||| |||| ||| | || || |||||  | |||||||||||
Sbjct: 932 ccattgcagccaatgggtcgaatggtgttaaacaagaacat 972

---

>gb|AF151368.1|AF151368 Hevea brasiliensis catalase (cat) mRNA, complete cds
          Length = 1745

 Score =  117 bits (59), Expect = 5e-23
 Identities = 167/203 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            ||||||||||| || || ||||||||||| |||| ||||||||| || ||| ||||||| 
Sbjct: 844  attgcagctggcaactatccagaatggaaactttacatccagacaatggatcctgatcat 903

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            || || | |||||| ||||| || |||||||| || ||||||||||| ||||| ||| | 
Sbjct: 904  gaagacaaatttgattttgatccacttgatgtgactaagacctggcccgaggatatcctg 963

                                                                        
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaa 597
            || || ||||| ||||| ||  ||||  |||| |||||||||||||||||||| || || 
Sbjct: 964  cctcttcaaccggttggccgcttggtcttgaataagaacattgacaatttctttgctgag 1023

                                   
Query: 598  aatgaacagcttgctttctgccc 620
            ||||| || ||||| ||||||||
Sbjct: 1024 aatgagcaacttgcgttctgccc 1046



 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| |||||||| ||||||||||||||||||||||| || || || |||||| | 
Sbjct: 430 ggttttgctgtgaagttttacaccagagagggtaactttgatctggtgggaaacaatttc 489

                                                                      
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcc 122
           ||||| ||||| ||||| ||||| ||||||||||| ||  |||| |||||||| |||||
Sbjct: 490 cctgtttttttcatccgcgatggaatgaagttcccagatgtggtgcatgcttttaagcc 548



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 319 tggaaacctacatgtggtgtgaagtg 344
           ||||||||||| ||||||||||||||
Sbjct: 745 tggaaacctacttgtggtgtgaagtg 770

---

>gb|AY170463.1| Morus alba catalase (CAT1) mRNA, partial cds
          Length = 585

 Score =  117 bits (59), Expect = 5e-23
 Identities = 272/343 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| |||||||||||||||||||||||||| ||||| || || || ||||||
Sbjct: 142 cgtggttttgctgtgaagttctacaccagagagggtaattttgatctcgtcggaaacaat 201

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||||| ||||| || || ||||| ||||||||||||||| | |||
Sbjct: 202 ttccctgtcttcttcatccgtgatggaattaaattcccagacatggtccatgctcttaag 261

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || |  || ||| |  |||| |||||    |||||| |  | |||||||| || ||||| 
Sbjct: 262 cccaacccaaagtctcacatccaggaattttggagaatcttggacttcttctcacaccat 321

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || |||||  ||||||||||||||||||||||||| ||  ||||  | ||||   | || 
Sbjct: 322 ccagagagcttgcacatgttcaccttcctatttgatgacattggtgtcccacaagattac 381

                                                                       
Query: 241 aggcacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaaggct 300
           ||||||||||| || |  ||||| |||||||||||  | |||  || || ||||||||||
Sbjct: 382 aggcacatggatggctccggtgttaacacctacactctgatcgacaaggctggaaaggct 441

                                                      
Query: 301 cacctggttaagttccattggaaacctacatgtggtgtgaagt 343
           |||   || || |||||||||||||| || |||||||| ||||
Sbjct: 442 cactatgtgaaattccattggaaacccacctgtggtgtcaagt 484

---

>gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds
          Length = 1680

 Score =  113 bits (57), Expect = 8e-22
 Identities = 216/269 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||||||||| |||||||| |||||||| || || |||||||| 
Sbjct: 335 cgtggttttgctgtcaagttctacactagagagggaaactttgatctggtagggaacaac 394

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| |||||||||||||||||||| ||| || | |||
Sbjct: 395 ttccccgtcttcttcatccgtgatggaatgaagttccctgacatggttcattctctgaag 454

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||| || | || |||||||| ||||| ||  |||| || || || || || 
Sbjct: 455 ccaaatcctaagtcccatatccaggagaattggagggtccttgattttttctctcatcat 514

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || || |||||||||||||| |||||||| || ||| |||| || ||||   | || 
Sbjct: 515 cctgaaagcctgcacatgttcactttcctattcgatgatattggtataccacaagattac 574

                                        
Query: 241 aggcacatggacggttttggtgtcaacac 269
           |||||||||||||| | ||||||| ||||
Sbjct: 575 aggcacatggacggatctggtgtccacac 603



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           |||||||||||||| ||||| || ||||||||||||||||| |||||||| ||| | | |
Sbjct: 749 tctattgcagctggaaattatcctgaatggaagcttttcattcagaccatggatccagct 808

                                                                   
Query: 475 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           || || || |||||||| ||||| || || ||||| || || || |||||||||||
Sbjct: 809 catgaagacagatttgattttgatccactcgatgtgacaaaaacttggccagagga 864

---

>gb|AY987854.1| Euphorbia characias catalase mRNA, complete cds
          Length = 1761

 Score =  113 bits (57), Expect = 8e-22
 Identities = 234/293 (79%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           ||||||||||| |||||||||||  ||||||| || || ||||| || || |||||| | 
Sbjct: 435 ggttttgcagtcaagttctacactcgagagggcaatttcgacctagtgggaaacaatttc 494

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           || ||||| || ||||| |||||||||||||| || |||||||| |||||| ||||||||
Sbjct: 495 ccagtgttcttcatccgtgatgggatgaagtttccagacatggttcatgctctcaagcca 554

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           | ||| ||| |  |||| || || || |||||  |  |||||||||| || ||||| || 
Sbjct: 555 aatccaaagtcacacatccaagaaaattggaggattcttgacttcttctcccaccatcct 614

                                                                       
Query: 184 gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 243
           || || || |||||||||||||||||||| |||||| | ||  ||||||   | || |||
Sbjct: 615 gaaagcctccacatgttcaccttcctattcgacgatatcggagttccacaggattacagg 674

                                                                
Query: 244 cacatggacggttttggtgtcaacacctacaccttaatcagcagggatggaaa 296
           || |||||||| |  ||||| ||||||||||| || |||| || || ||||||
Sbjct: 675 catatggacggctcgggtgtgaacacctacacattgatcaacaaggctggaaa 727



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 418 attgcagctgggaattacccagaatggaagcttttcatccagac 461
           ||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 849 attgcagctggaaactatccagaatggaaacttttcattcagac 892

---

>gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, complete cds
          Length = 1658

 Score =  113 bits (57), Expect = 8e-22
 Identities = 171/209 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||| ||||| || |||||||||||||||||||| |||||||| ||||| || ||||| 
Sbjct: 413 cgtggctttgccgtcaagttctacaccagagagggaaactttgatcttgtcggaaacaac 472

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||||| || || ||||||||||||||||||||||| ||| | |||
Sbjct: 473 ttccctgtcttcttcatccgcgacggtatgaagttccctgacatggtccacgctcttaag 532

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           ||||  || ||  |  |||| || ||||||||||||||  |||||||||| || ||||||
Sbjct: 533 ccaaacccaaaatctcacatccaagagaactggagagtccttgacttcttctcccaccac 592

                                        
Query: 181 ccggagagtctgcacatgttcaccttcct 209
           || |||||  |  |||||||||| |||||
Sbjct: 593 cctgagagcttaaacatgttcactttcct 621



 Score =  111 bits (56), Expect = 3e-21
 Identities = 146/176 (82%)
 Strand = Plus / Plus

                                                                        
Query: 490  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
            |||||||||||||| ||||| |||||||||||||| |||||  || | || || || || 
Sbjct: 902  gactttgaccctctcgatgtgaccaagacctggcctgaggatctcttgcctctccagccc 961

                                                                        
Query: 550  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 609
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 962  gttggtcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 1021

                                                                    
Query: 610  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgct 665
            || |||||||| ||  ||| ||| || || || |||||||||||||| ||||||||
Sbjct: 1022 gccttctgccctgcgatcattgttccggggatacactactctgatgacaagctgct 1077

---

>emb|Z99633.1|SACATALAS Soldanella alpina mRNA for catalase (cat1 gene)
          Length = 1772

 Score =  111 bits (56), Expect = 3e-21
 Identities = 182/224 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||||||||| |||||||| |||||||||||||||||| | || || ||||||
Sbjct: 401 cgtggttttgcagtgaaattctacacaagagagggtaactttgacttggtgggaaacaat 460

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || ||| | || ||||| ||||| || || ||||||||||||||| | |||
Sbjct: 461 ttcccagttttctttgttcgtgatggaatgaaatttcccgacatggtccatgctcttaag 520

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           || |  || ||| |  |||| ||||| || |||||| || | |||||||| || ||||||
Sbjct: 521 cccaaccccaagtcacacattcaggaaaattggagaatactcgacttcttctctcaccac 580

                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttgg 224
           || |||||| |||| |||||||| ||||| || |||||| ||||
Sbjct: 581 ccagagagtttgcatatgttcactttccttttcgacgatcttgg 624



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 307 gttaagttccattggaaacctacatgtggtgtgaa 341
           ||||||||||||||||||||||||||||| |||||
Sbjct: 707 gttaagttccattggaaacctacatgtggagtgaa 741

---

>emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 gene)
          Length = 1688

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                        
Query: 412  gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 471
            ||||| ||||| ||||| || || ||||| ||||| || |||||||| |  || ||| ||
Sbjct: 803  gattcaattgctgctggaaactatccagagtggaaactgttcatccaaattatcgatcct 862

                                                                        
Query: 472  gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 531
            ||||| || || ||||||||||||||||| || ||||| |||||||||||||| ||||||
Sbjct: 863  gatcatgaagacagatttgactttgaccccctagatgtaaccaagacctggcctgaggac 922

                                                                        
Query: 532  atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            ||| | ||| |||| |||||||| ||  ||||| |||| ||||| || || || ||||| 
Sbjct: 923  atcttgccattgcagccagttggtcgcttggtattgaataagaatatcgataacttcttt 982

                                
Query: 592  gcggaaaatgaacagcttgc 611
            || || ||||||||||||||
Sbjct: 983  gcagagaatgaacagcttgc 1002



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 157/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 22  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 81
           |||||||||||||| ||||||||  | ||||| |||||  | || || || ||| |||| 
Sbjct: 413 tacaccagagagggcaactttgatttggttggaaacaacttccccgtcttctttgtccgt 472

                                                                       
Query: 82  gatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatg 141
           |||||||||||||||||||||||||| |||||  | || |||| ||| ||| || |||| 
Sbjct: 473 gatgggatgaagttccctgacatggttcatgcactgaaaccaaatccaaagtcccacatt 532

                                                                       
Query: 142 caggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttc 201
           ||||||||||||||  |  |||| ||||| || || || || || |||||||| ||||||
Sbjct: 533 caggagaactggaggatccttgatttcttctctcatcatccagaaagtctgcatatgttc 592

                         
Query: 202 accttcctatttga 215
            ||||||| |||||
Sbjct: 593 tccttcctgtttga 606

---

>gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds
          Length = 1745

 Score =  111 bits (56), Expect = 3e-21
 Identities = 203/252 (80%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||||| ||||| |||||||| || ||| | ||||| || |||||||| || || ||| |
Sbjct: 800  tgattcaattgctgctgggaactatccaaagtggaaactgttcatccaaactatcgatcc 859

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            |||||| || || | |||||||||||||||  | ||||| ||||||| |||||| |||||
Sbjct: 860  tgatcatgaagacaaatttgactttgaccccttagatgtaaccaagatctggcctgagga 919

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
            |||  | ||| | ||||||||||| ||  ||||| |||||||||| || ||||| |||||
Sbjct: 920  cattttgccattacaaccagttggtcgcttggtattgaacaagaatatcgacaacttctt 979

                                                                        
Query: 591  cgcggaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactc 650
             |  || || || ||||||||||| ||||| ||  | | ||||||||| ||||| |||||
Sbjct: 980  tgtagagaacgagcagcttgctttttgccctgccattattgtccctggtatccattactc 1039

                        
Query: 651  tgatgataagct 662
             |||||||||||
Sbjct: 1040 ggatgataagct 1051



 Score =  103 bits (52), Expect = 7e-19
 Identities = 208/260 (80%)
 Strand = Plus / Plus

                                                                       
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 75
           ||||| |||||||||||||||||||| || || ||||| |||||  | ||||| || |||
Sbjct: 405 aagttttacaccagagagggtaacttcgatctggttggaaacaacttccctgtcttcttt 464

                                                                       
Query: 76  atccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagacc 135
            |||| ||||| |||||||||||||||||||| |||||| | || |||| ||| ||| ||
Sbjct: 465 gtccgtgatggaatgaagttccctgacatggttcatgctctaaaaccaaatccaaagtcc 524

                                                                       
Query: 136 aacatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcac 195
            |||| ||||||||||||||  |  |||| ||||| || ||||| || || ||||| || 
Sbjct: 525 cacattcaggagaactggaggatccttgatttcttctctcaccatccagaaagtcttcat 584

                                                                       
Query: 196 atgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggacggt 255
           |||||||  ||||| ||||| ||| | || || ||||   | || ||||||||||| |||
Sbjct: 585 atgttcagtttcctgtttgatgatctgggtatcccacaagattacaggcacatggaaggt 644

                               
Query: 256 tttggtgtcaacacctacac 275
           |  ||||| || ||||||||
Sbjct: 645 tccggtgttaatacctacac 664

---

>gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, complete cds
          Length = 4780

 Score =  111 bits (56), Expect = 3e-21
 Identities = 146/176 (82%)
 Strand = Plus / Plus

                                                                        
Query: 490  gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
            |||||||||||||| ||||| |||||||||||||| |||||  || | || || || || 
Sbjct: 3648 gactttgaccctctcgatgtgaccaagacctggcctgaggatctcttgcctctccagccc 3707

                                                                        
Query: 550  gttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagctt 609
            ||||| || |||||  |||||||||||||||| || ||||| ||||| ||||| ||||||
Sbjct: 3708 gttggtcgtatggtgttgaacaagaacattgataacttctttgcggagaatgagcagctt 3767

                                                                    
Query: 610  gctttctgcccagcagtcactgtccctggaatccactactctgatgataagctgct 665
            || |||||||| ||  ||| ||| || || || |||||||||||||| ||||||||
Sbjct: 3768 gccttctgccctgcgatcattgttccggggatacactactctgatgacaagctgct 3823



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            |||| |||||||| ||||| || |||||  | ||||| || || ||||| || || ||||
Sbjct: 3190 agggaaactttgatcttgtcggaaacaacttccctgtcttcttcatccgcgacggtatga 3249

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            ||||||||||||||||||| ||| | |||||||  || ||  |  |||| || |||||||
Sbjct: 3250 agttccctgacatggtccacgctcttaagccaaacccaaaatctcacatccaagagaact 3309

                                                                      
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
            |||||||  |||||||||| || |||||||| |||||  |  |||||||||| |||||
Sbjct: 3310 ggagagtccttgacttcttctcccaccaccctgagagcttaaacatgttcactttcct 3367



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            ||||| ||||| || |||||||||||||||||||
Sbjct: 2690 cgtggctttgccgtcaagttctacaccagagagg 2723

---

>dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds
          Length = 1800

 Score =  111 bits (56), Expect = 3e-21
 Identities = 167/204 (81%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||||| |||||||| || || ||||| || |||||||||||||| ||||| |||||  |
Sbjct: 883  tgattcaattgcagcaggcaactaccccgagtggaagcttttcattcagactattgaccc 942

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            |||||| || || | || ||||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 943  tgatcatgaagacaaatatgactttgaccctctagatgtaaccaagacatggcctgagga 1002

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
             ||| | || ||||| |||||||| || |||||  |||| |||||||| || || |||||
Sbjct: 1003 tatcttgcccctgcagccagttggccgcatggttttgaataagaacatcgataacttctt 1062

                                    
Query: 591  cgcggaaaatgaacagcttgcttt 614
             || || |||||||| || |||||
Sbjct: 1063 tgcagagaatgaacaactggcttt 1086



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| ||||||||||||||||| |||||||| ||||| || || || |||||  | 
Sbjct: 476 ggttttgctgtgaagttctacaccagggagggtaattttgatctcgtgggcaacaacttc 535

                                        
Query: 64  cctgtgttttttatccgagatgggatgaa 92
           ||||| ||||| ||||| ||||| |||||
Sbjct: 536 cctgtatttttcatccgtgatggtatgaa 564

---

>gb|AF243518.1|AF243518 Helianthus annuus catalase 3 (CATA3) mRNA, complete cds
          Length = 1860

 Score =  109 bits (55), Expect = 1e-20
 Identities = 118/139 (84%)
 Strand = Plus / Plus

                                                                        
Query: 470  ctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagg 529
            ||||||| || |||||  ||||||||||||| || |||| ||||| ||||||||| ||||
Sbjct: 864  ctgatcatgaagataggcttgactttgacccgctcgatggcaccatgacctggcccgagg 923

                                                                        
Query: 530  acatcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttct 589
            ||||||| ||  |||| || ||||| || |||||  ||||||||||||||||||| ||||
Sbjct: 924  acatcatacctttgcagcccgttgggcgtatggtgttgaacaagaacattgacaacttct 983

                               
Query: 590  tcgcggaaaatgaacagct 608
            | || ||||||||||||||
Sbjct: 984  ttgctgaaaatgaacagct 1002



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 16  aagttctacaccagagagggtaactttgac 45
           ||||||||||||||||||||||||||||||
Sbjct: 410 aagttctacaccagagagggtaactttgac 439

---

>ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.1 mRNA, complete cds
          Length = 1832

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 834  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 893

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 894  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 953

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 954  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1007



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 417 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 476

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 477 actccggtgttcttcatccgtgatgggattcagttccc 514



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 627 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 686

                
Query: 271 tacac 275
           |||||
Sbjct: 687 tacac 691

---

>ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.2 mRNA, complete cds
          Length = 1931

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 834  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 893

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 894  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 953

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 954  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1007



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 417 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 476

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 477 actccggtgttcttcatccgtgatgggattcagttccc 514



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 627 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 686

                
Query: 271 tacac 275
           |||||
Sbjct: 687 tacac 691

---

>ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.5 mRNA, complete cds
          Length = 1817

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 433 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 492

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 493 actccggtgttcttcatccgtgatgggattcagttccc 530



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 643 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 702

                
Query: 271 tacac 275
           |||||
Sbjct: 703 tacac 707

---

>ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.4 mRNA, complete cds
          Length = 1930

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 433 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 492

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 493 actccggtgttcttcatccgtgatgggattcagttccc 530



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 643 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 702

                
Query: 271 tacac 275
           |||||
Sbjct: 703 tacac 707

---

>ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3)
            transcript variant AT1G20620.3 mRNA, complete cds
          Length = 1901

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 850  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 909

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 910  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 969

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 970  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1023



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 433 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 492

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 493 actccggtgttcttcatccgtgatgggattcagttccc 530



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 643 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 702

                
Query: 271 tacac 275
           |||||
Sbjct: 703 tacac 707

---

>gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds
          Length = 1759

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 832  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 891

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 892  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 951

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 952  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1005



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 415 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 474

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 475 actccggtgttcttcatccgtgatgggattcagttccc 512



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 625 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 684

                
Query: 271 tacac 275
           |||||
Sbjct: 685 tacac 689

---

>gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds
          Length = 1757

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 829  attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 888

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 889  gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 948

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 949  cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 1002



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 412 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 471

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 472 actccggtgttcttcatccgtgatgggattcagttccc 509



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 622 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 681

                
Query: 271 tacac 275
           |||||
Sbjct: 682 tacac 686

---

>emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZD06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1709

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 418 attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
           |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 810 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 869

                                                                       
Query: 478 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
           |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 870 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 929

                                                                 
Query: 538 ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
           || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 930 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 983



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 393 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 452

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 453 actccggtgttcttcatccgtgatgggattcagttccc 490



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 603 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 662

                
Query: 271 tacac 275
           |||||
Sbjct: 663 tacac 667

---

>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I,
             complete sequence
          Length = 143879

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                         
Query: 418   attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
             |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 35671 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 35730

                                                                         
Query: 478   gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
             |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 35731 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 35790

                                                                   
Query: 538   ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
             || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 35791 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 35844



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             |||| |||||||| ||||||||||||||  | ||||| || ||  |||| ||||| ||||
Sbjct: 38695 aggggaactttgatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatga 38754

                                                                         
Query: 92    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
             | |||||||||||||||||||| || || || | ||| ||| |  |||| ||||||||||
Sbjct: 38755 aattccctgacatggtccatgcattgaaaccgaatcccaagtctcacattcaggagaact 38814

                                                              
Query: 152   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgtt 200
             ||||  || | |||||||| || |||||||| |||||| ||||||||||
Sbjct: 38815 ggaggatactggacttcttctcccaccacccagagagtttgcacatgtt 38863



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 211   tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
             ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 35464 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 35523

                  
Query: 271   tacac 275
             |||||
Sbjct: 35524 tacac 35528



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 35285 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 35344

                    
Query: 92    agttccc 98
             |||||||
Sbjct: 35345 agttccc 35351



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             ||||||||||| || ||||| |||||||||||||
Sbjct: 38486 cgtggttttgctgttaagttttacaccagagagg 38519



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             ||||||||||| || ||||| |||||||||||||
Sbjct: 35162 cgtggttttgctgtcaagttttacaccagagagg 35195

---

>gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana BAC F5M15 from chromosome I,
             complete sequence
          Length = 99231

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                         
Query: 418   attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
             |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 19444 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 19385

                                                                         
Query: 478   gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
             |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 19384 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 19325

                                                                   
Query: 538   ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
             || |||||||| ||||| ||  |||| ||||||| || ||||||||||||||||
Sbjct: 19324 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaatttcttc 19271



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 139/169 (82%)
 Strand = Plus / Minus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             |||| |||||||| ||||||||||||||  | ||||| || ||  |||| ||||| ||||
Sbjct: 16420 aggggaactttgatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatga 16361

                                                                         
Query: 92    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
             | |||||||||||||||||||| || || || | ||| ||| |  |||| ||||||||||
Sbjct: 16360 aattccctgacatggtccatgcattgaaaccgaatcccaagtctcacattcaggagaact 16301

                                                              
Query: 152   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgtt 200
             ||||  || | |||||||| || |||||||| |||||| ||||||||||
Sbjct: 16300 ggaggatactggacttcttctcccaccacccagagagtttgcacatgtt 16252



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                         
Query: 211   tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
             ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 19651 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 19592

                  
Query: 271   tacac 275
             |||||
Sbjct: 19591 tacac 19587



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 19830 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 19771

                    
Query: 92    agttccc 98
             |||||||
Sbjct: 19770 agttccc 19764



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             ||||||||||| || ||||| |||||||||||||
Sbjct: 19953 cgtggttttgctgtcaagttttacaccagagagg 19920



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             ||||||||||| || ||||| |||||||||||||
Sbjct: 16629 cgtggttttgctgttaagttttacaccagagagg 16596

---

>emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 gene)
          Length = 1777

 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| || ||| |
Sbjct: 868  tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaatggatcc 927

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            |||||||||||| |||||||||||||||||||||||  | || ||||||||||| || ||
Sbjct: 928  tgatcacgaggacagatttgactttgaccctcttgacttaactaagacctggcctgaaga 987

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
             ||| | || ||||| |||||||| ||  |||| ||||| || ||||| || || |||||
Sbjct: 988  tatccttcccctgcagccagttggccgtttggttctgaataaaaacatcgataacttctt 1047

                                 
Query: 591  cgcggaaaatgaacagcttgc 611
             || || |||||||| |||||
Sbjct: 1048 tgcagagaatgaacaacttgc 1068



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 458 cgtggttttgcagtgaagttttacaccagagagggtaattttgacctggttggaaacaat 517

                                                                      
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaa 119
            | || || |||||| |||| ||||  ||||| ||||| |||  | ||| |||||||||
Sbjct: 518 ttccccgtcttttttgtccgtgatgcaatgaaattcccggacgcgatccgtgctttcaa 576

---

>emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, partial
          Length = 1610

 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Plus

                                                                       
Query: 411 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
           |||||| ||||||||||| || ||||| || ||||| ||||  || ||||| || ||| |
Sbjct: 562 tgattccattgcagctggcaactaccctgagtggaaactttatattcagacaatggatcc 621

                                                                       
Query: 471 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           |||||||||||| |||||||||||||||||||||||  | || ||||||||||| || ||
Sbjct: 622 tgatcacgaggacagatttgactttgaccctcttgacttaactaagacctggcctgaaga 681

                                                                       
Query: 531 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
            ||| | || ||||| |||||||| ||  |||| ||||| || ||||| || || |||||
Sbjct: 682 tatccttcccctgcagccagttggccgtttggttctgaataaaaacatcgataacttctt 741

                                
Query: 591 cgcggaaaatgaacagcttgc 611
            || || |||||||| |||||
Sbjct: 742 tgcagagaatgaacaacttgc 762



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 152 cgtggttttgcagtgaagttttacaccagagagggtaattttgacctggttggaaacaat 211

                                                                      
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaa 119
            | || || |||||| |||| ||||  ||||| ||||| |||  | ||| |||||||||
Sbjct: 212 ttccccgtcttttttgtccgtgatgcaatgaaattcccggacgcgatccgtgctttcaa 270

---

>gb|AF443179.1|AF443179 Nicotiana tabacum catalase mRNA, partial cds
          Length = 683

 Score =  105 bits (53), Expect = 2e-19
 Identities = 215/269 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || |||||||||||||||||||| |||||||| || || |||||||| 
Sbjct: 190 cgtggttttgctgtcaagttctacaccagagagggaaactttgatctggtagggaacaac 249

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| ||||||||||||||||||||||| ||  | |||
Sbjct: 250 ttccccgtcttcttcatccgtgatggaatgaagttccctgacatggtccacgcgctgaag 309

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           |||| ||| ||  || | || |||||||| ||||| ||  |||| || || || ||    
Sbjct: 310 ccaaatcctaaatcccatatccaggagaattggagggtccttgattttttctctcatgtt 369

                                                                       
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactat 240
           || || || |||||||||||||| ||||| || |||||| |||| |||||||   | || 
Sbjct: 370 cctgaaagcctgcacatgttcactttcctcttcgacgatattggtattccacaagattac 429

                                        
Query: 241 aggcacatggacggttttggtgtcaacac 269
           ||||| |||||||||| ||||||| ||||
Sbjct: 430 aggcatatggacggttctggtgtccacac 458



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 604 tctattgccgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 663

                            
Query: 475 cacgaggatagatttga 491
           || || || ||||||||
Sbjct: 664 catgaagacagatttga 680

---

>emb|AJ302710.1|BPE302710 Betula pendula partial mRNA for catalase (cat gene)
          Length = 451

 Score =  103 bits (52), Expect = 7e-19
 Identities = 139/168 (82%)
 Strand = Plus / Plus

                                                                       
Query: 453 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 512
           ||||||||  |||||  ||||||| ||||| | ||||||||||||||| |||||||| ||
Sbjct: 121 catccagataattgaccctgatcatgaggacaaatttgactttgacccacttgatgtgac 180

                                                                       
Query: 513 caagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaa 572
           ||| | |||||| ||||||||  | || ||||| |||||||| ||  ||||  |||||||
Sbjct: 181 caaaatctggcccgaggacattctgcccctgcagccagttggccgcttggtcttgaacaa 240

                                                           
Query: 573 gaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
           |||||| ||||| |||||||| || |||||||| ||||| || |||||
Sbjct: 241 gaacatcgacaacttcttcgcagagaatgaacaacttgcattttgccc 288

---

>emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catalase (cat gene)
          Length = 992

 Score =  103 bits (52), Expect = 7e-19
 Identities = 202/252 (80%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           ||||||||||| || || || ||||| ||||| || || || ||||| || ||| | |||
Sbjct: 91  tctattgcagcaggcaactatccagagtggaaactgtttattcagactatagatccagat 150

                                                                       
Query: 475 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 534
           ||||| || |||||||| |||||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 151 cacgaagacagatttgattttgacccacttgatgtgaccaaaacatggcctgaggatatc 210

                                                                       
Query: 535 atcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttcgcg 594
            | || || || ||||| || || |||||  |||||||||||||||| || ||||| || 
Sbjct: 211 ttgcctctccagccagtcggtcgcatggttttgaacaagaacattgataacttctttgct 270

                                                                       
Query: 595 gaaaatgaacagcttgctttctgcccagcagtcactgtccctggaatccactactctgat 654
           || ||||||||| | ||||||||||| ||  |   |||||||||  |  |||| ||||||
Sbjct: 271 gagaatgaacagttggctttctgccctgctattgttgtccctggtgtttactattctgat 330

                       
Query: 655 gataagctgctc 666
           ||||||||||||
Sbjct: 331 gataagctgctc 342

---

>gb|AY338958.1| Cucumis sativus catalase-like (cat) mRNA, partial sequence
          Length = 275

 Score =  101 bits (51), Expect = 3e-18
 Identities = 117/139 (84%)
 Strand = Plus / Plus

                                                                       
Query: 137 acatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcaca 196
           |||| |||||||| |||||| |  ||||||||||||| ||||| || || ||| || |||
Sbjct: 4   acattcaggagaattggagaatccttgacttcttttctcaccatcctgaaagtttgaaca 63

                                                                       
Query: 197 tgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggacggtt 256
           ||||||| || |||||||||||| ||||||| ||||   | || ||||||||||||||||
Sbjct: 64  tgttcacatttctatttgacgatattggcatcccacaagattacaggcacatggacggtt 123

                              
Query: 257 ttggtgtcaacacctacac 275
             |||||||||||||||||
Sbjct: 124 caggtgtcaacacctacac 142

---

>emb|AJ295295.1|BPE295295 Betula pendula partial mRNA for catalase (cat gene)
          Length = 451

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 131/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 453 catccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcac 512
           ||||||||  |||||  ||||||| ||||| | ||||||||||||||| |||||||| ||
Sbjct: 121 catccagataattgaccctgatcatgaggacaaatttgactttgacccacttgatgtgac 180

                                                                       
Query: 513 caagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaa 572
           ||| | |||||| ||||||||  | || ||||| |||||||| ||  ||||  |||||||
Sbjct: 181 caaaatctggcccgaggacattctgcccctgcagccagttggccgcttggtcttgaacaa 240

                                                 
Query: 573 gaacattgacaatttcttcgcggaaaatgaacagcttg 610
           |||||| ||||| |||||||| || |||||||| ||||
Sbjct: 241 gaacatcgacaacttcttcgcagagaatgaacaacttg 278

---

>gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds
          Length = 1756

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || |||||||||||||||||||| |||||||| || || |||||||| 
Sbjct: 410 cgtggttttgctgtcaagttctacaccagagagggaaactttgatctggtagggaacaac 469

                                                             
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtcca 110
            | || || || || ||||| ||||| |||||||||||||||||||||||
Sbjct: 470 ttccccgtcttcttcatccgtgatggaatgaagttccctgacatggtcca 519



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           |||||||| ||||| ||||| || ||||||||||| ||||| ||||| || ||| | |||
Sbjct: 824 tctattgccgctggaaattatcctgaatggaagctcttcattcagactatggatccagat 883

                                                                   
Query: 475 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           || || || |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 884 catgaagacagatttgattttgatccacttgatgttacaaaaacttggccagagga 939

---

>gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, complete cds
          Length = 1769

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||| || ||||| ||||||||||||||||| || |||||||| ||||| || ||||| 
Sbjct: 420 cgtggcttcgcagtcaagttctacaccagagaagggaactttgatcttgtcggaaacaac 479

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||  | || |||||||||||||||||||||||||| ||| | || 
Sbjct: 480 ttccctgtcttcttcataagggacgggatgaagttccctgacatggtccacgctcttaaa 539

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           ||||  || ||  |  |||| || || |||||||||||  |||||||||| || ||||||
Sbjct: 540 ccaaaccctaaatctcacatccaagaaaactggagagtccttgacttcttctcacaccac 599

                                                 
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacga 218
           || |||||  || |||||||||| ||||| ||||||||
Sbjct: 600 cctgagagcttgaacatgttcactttcctctttgacga 637



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 216/272 (79%)
 Strand = Plus / Plus

                                                                        
Query: 394  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 453
            |||||| ||||||||  ||| || ||||| ||||| || ||||| || |||||||| || 
Sbjct: 813  gccacacaggacttgtatgactccattgctgctggaaactaccctgagtggaagctcttt 872

                                                                        
Query: 454  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 513
            ||||||  ||||||| | | | |||| || |  || ||||||||||| || |||||||||
Sbjct: 873  atccaggtcattgatccagctgacgaagacaagttcgactttgacccactcgatgtcacc 932

                                                                        
Query: 514  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 573
            ||||||||||| ||| |  |  | || || ||||| ||||| || |||||  ||||||||
Sbjct: 933  aagacctggcctgagaatcttttgcctctccaacccgttggtcgtatggtgttgaacaag 992

                                                                        
Query: 574  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 633
            ||||||||||| ||||| ||||| ||||| |||||||| || ||||| ||  ||| ||| 
Sbjct: 993  aacattgacaacttctttgcggagaatgagcagcttgccttttgccctgctatcattgtt 1052

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| || || ||||| || || ||||||||
Sbjct: 1053 cctgggatacattactcggacgacaagctgct 1084

---

>gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, complete cds
          Length = 1778

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||| || ||||| ||||||||||||||||| || |||||||| ||||| || ||||| 
Sbjct: 400 cgtggcttcgcagtcaagttctacaccagagaagggaactttgatcttgtcggaaacaac 459

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||  | || |||||||||||||||||||||||||| ||| | || 
Sbjct: 460 ttccctgtcttcttcataagggacgggatgaagttccctgacatggtccacgctcttaaa 519

                                                                       
Query: 121 ccaagtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccac 180
           ||||  || ||  |  |||| || || |||||||||||  |||||||||| || ||||||
Sbjct: 520 ccaaaccctaaatctcacatccaagaaaactggagagtccttgacttcttctcacaccac 579

                                                 
Query: 181 ccggagagtctgcacatgttcaccttcctatttgacga 218
           || |||||  || |||||||||| ||||| ||||||||
Sbjct: 580 cctgagagcttgaacatgttcactttcctctttgacga 617



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 216/272 (79%)
 Strand = Plus / Plus

                                                                        
Query: 394  gccacaaaggacttgactgattctattgcagctgggaattacccagaatggaagcttttc 453
            |||||| ||||||||  ||| || ||||| ||||| || ||||| || |||||||| || 
Sbjct: 793  gccacacaggacttgtatgactccattgctgctggaaactaccctgagtggaagctcttt 852

                                                                        
Query: 454  atccagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcacc 513
            ||||||  ||||||| | | | |||| || |  || ||||||||||| || |||||||||
Sbjct: 853  atccaggtcattgatccagctgacgaagacaagttcgactttgacccactcgatgtcacc 912

                                                                        
Query: 514  aagacctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaag 573
            ||||||||||| ||| |  |  | || || ||||| ||||| || |||||  ||||||||
Sbjct: 913  aagacctggcctgagaatcttttgcctctccaacccgttggtcgtatggtgttgaacaag 972

                                                                        
Query: 574  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 633
            ||||||||||| ||||| ||||| ||||| |||||||| || ||||| ||  ||| ||| 
Sbjct: 973  aacattgacaacttctttgcggagaatgagcagcttgccttttgccctgctatcattgtt 1032

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| || || ||||| || || ||||||||
Sbjct: 1033 cctgggatacattactcggacgacaagctgct 1064

---

>gb|U43147.1|ATU43147 Arabidopsis thaliana catalase 3 (CAT3) gene, complete cds
          Length = 4058

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 2740 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 2799

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 2800 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 2859

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 2860 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaacttcttc 2913



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 2354 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 2413

                   
Query: 92   agttccc 98
            |||||||
Sbjct: 2414 agttccc 2420



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            ||||||||||| || ||||| |||||||||||||
Sbjct: 2232 cgtggttttgctgtcaagttttacaccagagagg 2265

---

>gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) and catalase 1 (CAT1) genes,
            complete cds
          Length = 7707

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||| |||| || ||||| || ||||| ||||||||||||||||| ||| |||   | 
Sbjct: 2738 attgcatctggcaactaccccgagtggaaacttttcatccagaccatggatcctgcagat 2797

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            |||||||  |||||||||||||| |||||||| ||||||| |||||| ||||| ||  | 
Sbjct: 2798 gaggataagtttgactttgacccacttgatgtgaccaagatctggcctgaggatattttg 2857

                                                                  
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
            || |||||||| ||||| ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 2858 cctctgcaaccggttggtcgcttggttctgaacaggaccattgacaacttcttc 2911



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            |||| |||||||| ||||||||||||||  | ||||| || ||  |||| ||||| ||||
Sbjct: 5762 aggggaactttgatcttgttgggaacaacttccctgtattcttcgtccgtgatggaatga 5821

                                                                        
Query: 92   agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
            | |||||||||||||||||||| || || || | ||| ||| |  |||| ||||||||||
Sbjct: 5822 aattccctgacatggtccatgcattgaaaccgaatcccaagtctcacattcaggagaact 5881

                                                             
Query: 152  ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgtt 200
            ||||  || | |||||||| || |||||||| |||||| ||||||||||
Sbjct: 5882 ggaggatactggacttcttctcccaccacccagagagtttgcacatgtt 5930



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                        
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
            |||| |||||||| |||||||||||||| |  || ||||| || ||||| ||||||||  
Sbjct: 2352 agggaaactttgatcttgttgggaacaacactccggtgttcttcatccgtgatgggattc 2411

                   
Query: 92   agttccc 98
            |||||||
Sbjct: 2412 agttccc 2418



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            ||||||||||| || ||||| |||||||||||||
Sbjct: 5553 cgtggttttgctgttaagttttacaccagagagg 5586



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1    cgtggttttgcagtgaagttctacaccagagagg 34
            ||||||||||| || ||||| |||||||||||||
Sbjct: 2230 cgtggttttgctgtcaagttttacaccagagagg 2263

---

>dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds
          Length = 1824

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 170/210 (80%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||||| ||||| ||||| || || || || ||||| || ||||| ||||| || ||| |
Sbjct: 821  tgattcgattgctgctggtaactatcctgagtggaaactattcattcagacaatagatcc 880

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            ||| ||||| || | |||||||||||||||||||||||| |||||||| ||||| |||||
Sbjct: 881  tgagcacgaagacaaatttgactttgaccctcttgatgtaaccaagacttggcccgagga 940

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
            ||| || ||  |||| || ||||| ||  |||| ||||| |||||||| || || |||||
Sbjct: 941  cattatacccttgcagcctgttggtcgcttggtcctgaataagaacatagataacttctt 1000

                                          
Query: 591  cgcggaaaatgaacagcttgctttctgccc 620
             || || |||||||| ||||| || |||||
Sbjct: 1001 tgctgagaatgaacaacttgcattttgccc 1030



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           |||||||| ||||| || ||||||||||||||||||||||| |||||||| |||||
Sbjct: 414 ggttttgctgtgaaattttacaccagagagggtaactttgatcttgttggaaacaa 469

---

>gb|AF295641.1| Beta vulgaris catalase (cat) mRNA, partial cds
          Length = 379

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 75
           ||||||||||||||||||||||||||||| ||||| ||||||||| | ||||||||||| 
Sbjct: 1   aagttctacaccagagagggtaactttgatcttgtggggaacaatttccctgtgtttttc 60

                                           
Query: 76  atccgagatgggatgaagttccctgacatggt 107
           || || ||||| ||||| ||||| || |||||
Sbjct: 61  attcgtgatggaatgaaattcccggatatggt 92



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 ttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgttggc 225
           ||||| || ||||| || |||||| ||||||||||||| ||||| ||||| ||| |||| 
Sbjct: 151 ttcttctctcaccatcctgagagtttgcacatgttcactttcctctttgatgatattgga 210

                                                       
Query: 226 attccactcaactataggcacatggacggttttggtgtcaacac 269
            ||||    ||||| ||||| ||||| |||| |||||| |||||
Sbjct: 211 gttcctgcaaactacaggcatatggaaggttctggtgttaacac 254

---

>gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete sequence
          Length = 1756

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 131/159 (82%)
 Strand = Plus / Plus

                                                                        
Query: 433  tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 492
            ||||| || ||||| ||||||||||||||||| ||| |||   | |||||||  ||||||
Sbjct: 847  taccccgagtggaaacttttcatccagaccatggatcctgcagatgaggataagtttgac 906

                                                                        
Query: 493  tttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagtt 552
            |||||||| |||||||| ||||||| |||||| ||||| ||  | || |||||||| |||
Sbjct: 907  tttgacccacttgatgtgaccaagatctggcctgaggatattttgcctctgcaaccggtt 966

                                                   
Query: 553  ggacggatggtactgaacaagaacattgacaatttcttc 591
            || ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 967  ggtcgcttggttctgaacaggaccattgacaacttcttc 1005



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||| |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 415 cgtggttttgctgtcaagttttacaccagagagggaaactttgatcttgttgggaacaac 474

                                                 
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccc 98
           |  || ||||| || ||||| ||||||||  |||||||
Sbjct: 475 actccggtgttcttcatccgtgatgggattcagttccc 512



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||||||||| ||||| |||||| |||||
Sbjct: 625 tttgatgatgttggtattccacaagattacaggcacatggagggtttcggtgtccacacc 684

                
Query: 271 tacac 275
           |||||
Sbjct: 685 tacac 689

---

>emb|AJ538651.1|NTA538651 Nicotiana tabacum cDNA-AFLP-fragment BC33-M2-001
          Length = 346

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||| ||||| || |||||||||||||||||||| |||||||| || || |||||||| 
Sbjct: 189 cgtgggtttgctgtcaagttctacaccagagagggaaactttgatctggtagggaacaac 130

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | || || || || ||||| ||||| |||||||||| |||||||||||||||| | |||
Sbjct: 129 ttccccgtcttcttcatccgcgatggaatgaagttccttgacatggtccatgctgtgaag 70

                                              
Query: 121 ccaagtccgaagaccaacatgcaggagaactggag 155
           || | ||| ||| || | || |||||||| |||||
Sbjct: 69  cccaatcccaagtcccagatccaggagaattggag 35

---

>dbj|D63384.1|CUSCA Cucumis sativus mRNA for catalase, partial cds, clone CRR1 and 6
          Length = 303

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 116/139 (83%)
 Strand = Plus / Plus

                                                                       
Query: 137 acatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcaca 196
           |||| |||||||| |||||| |  ||||||||||||| ||||| || || ||| || |||
Sbjct: 3   acattcaggagaattggagaatccttgacttcttttctcaccatcctgaaagtatgaaca 62

                                                                       
Query: 197 tgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggacggtt 256
           ||||||| || |||||||||||| ||||||| ||||   | || ||||||||||||||||
Sbjct: 63  tgttcacatttctatttgacgatattggcatcccacaagattacaggcacatggacggtt 122

                              
Query: 257 ttggtgtcaacacctacac 275
             ||||||||||| |||||
Sbjct: 123 caggtgtcaacacatacac 141

---

>dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete cds
          Length = 1833

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 162/201 (80%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||||| |||||||| || || || || || ||||| || | |||||| ||||||||| |
Sbjct: 834  tgattcaattgcagccggaaactatcctgagtggaaactctacatccaaaccattgatcc 893

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            ||||   || || ||||||||||||||||| |||||||  ||||||||||||||||||||
Sbjct: 894  tgattttgaagacagatttgactttgacccacttgatggaaccaagacctggccagagga 953

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
            | || | || || ||||||||||| ||  ||||  |||| | |||||| ||||| |||||
Sbjct: 954  cctcgtacctctccaaccagttggtcgcttggtcttgaataggaacatcgacaacttctt 1013

                                 
Query: 591  cgcggaaaatgaacagcttgc 611
             || || ||||| || |||||
Sbjct: 1014 tgctgagaatgagcaacttgc 1034



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 101/124 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||| || || ||||| |||||||||||||||||||| || || ||||| ||||| 
Sbjct: 424 cgtggtttcgctgtcaagttttacaccagagagggtaacttcgatctagttggaaacaac 483

                                                                       
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaag 120
            | ||||| || || ||||| ||||| |||||||| || ||  || | ||||||||||| 
Sbjct: 484 tttcctgtcttcttcatccgtgatggaatgaagtttccagatgtgattcatgctttcaaa 543

               
Query: 121 ccaa 124
           ||||
Sbjct: 544 ccaa 547

---

>emb|X60169.1|PSCATAL Pisum sativum mRNA for catalase
          Length = 1738

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                        
Query: 484  agatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactg 543
            |||||||| |||||||| |||||||| || ||||| ||||| ||||||||||| || || 
Sbjct: 897  agatttgagtttgacccacttgatgtaactaagacttggcccgaggacatcatacccctt 956

                                                                        
Query: 544  caaccagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaa 603
            || || || || || |||||  ||||||||||||| || |||||||| || || ||||||
Sbjct: 957  cagcccgtaggtcgcatggtcttgaacaagaacatagataatttctttgctgagaatgaa 1016

                    
Query: 604  cagcttgc 611
            ||||||||
Sbjct: 1017 cagcttgc 1024



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           |||||||| ||||| || ||||||||||||||||||| |||||||||||| |||||
Sbjct: 417 ggttttgctgtgaaattttacaccagagagggtaactatgaccttgttggaaacaa 472



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 193 cacatgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggac 252
           ||||||||| ||||||||||||| ||||| ||  | ||||   | |||||||| ||||| 
Sbjct: 606 cacatgttctccttcctatttgatgatgtgggtgtcccacaagattataggcatatggat 665

                                   
Query: 253 ggttttggtgtcaacacctacacc 276
           |||||||| || ||||| ||||||
Sbjct: 666 ggttttggagttaacacatacacc 689

---

>gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial cds
          Length = 1134

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 134/164 (81%)
 Strand = Plus / Plus

                                                                       
Query: 457 cagaccattgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaag 516
           ||||| || ||| |||| ||||| || | |||||||||||||||||||||||| || |||
Sbjct: 264 cagacaatagatcctgagcacgaagacaaatttgactttgaccctcttgatgttactaag 323

                                                                       
Query: 517 acctggccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaac 576
           || ||||| |||||||| || ||  |||| || ||||| ||  |||| ||||| ||||||
Sbjct: 324 acttggcctgaggacattatacccttgcagcctgttggtcgcttggtcctgaataagaac 383

                                                       
Query: 577 attgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
           || || |||||||| || || |||||||| ||||| || |||||
Sbjct: 384 atagataatttctttgctgagaatgaacaacttgcattttgccc 427

---

>gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRNA, complete cds
          Length = 1804

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| || ||||||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 390 cgtggttttgctgtcaagttctacaccagagagggtaactttgatcttgttggaaacaat 449

---

>gb|DQ226689.1| Boechera divaricarpa isolate SLW-348-443-G06 mRNA sequence
          Length = 719

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                       
Query: 433 tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 492
           ||||| || ||||| |||||||||||||| || ||| |||   | ||||| |  ||||| 
Sbjct: 285 taccccgagtggaaacttttcatccagacgatggatcctgcggatgaggacaagtttgat 344

                                                                       
Query: 493 tttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagtt 552
           |||||||| |||||||| ||||||| |||||| ||||| ||| | || ||||||||||||
Sbjct: 345 tttgacccgcttgatgtgaccaagatctggcctgaggatatcttgcctctgcaaccagtt 404

                                                  
Query: 553 ggacggatggtactgaacaagaacattgacaatttcttc 591
           || ||  |||| ||||||| || ||||||||| ||||||
Sbjct: 405 ggtcgcttggttctgaacaggaccattgacaacttcttc 443



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                       
Query: 211 tttgacgatgttggcattccactcaactataggcacatggacggttttggtgtcaacacc 270
           ||||| |||||||| |||||||   | || ||||| ||||| ||||| |||||| |||||
Sbjct: 63  tttgatgatgttggtattccacaagattacaggcatatggaaggtttcggtgtccacacc 122

                 
Query: 271 tacacc 276
           ||||||
Sbjct: 123 tacacc 128

---

>gb|DQ124022.1| Coffea arabica clone MN-SSH2-H06 mRNA sequence
          Length = 525

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 421 gcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcacgag 480
           |||||||| || ||||| || |||||||||||||||||||| |||||| ||||| | || 
Sbjct: 196 gcagctggaaactaccctgagtggaagcttttcatccagacaattgatcctgattatgaa 255

                                                                       
Query: 481 gatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatccca 540
           || | || |||||||||||| |||||||| || ||||| ||||| ||||| ||| | || 
Sbjct: 256 gacaaatatgactttgacccacttgatgtgactaagacttggcctgaggatatcttgccc 315

                      
Query: 541 ctgcaaccagt 551
           ||||| |||||
Sbjct: 316 ctgcagccagt 326

---

>gb|AY162277.1| Prunus armeniaca catalase1 (CAT1) mRNA, partial cds
          Length = 572

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||| |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 142 cgtggttctgcagtgaagttttacaccagagagggtaattttgacctggttggaaacaat 201

                                                                      
Query: 61  atgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaa 119
            | || || |||||| |||| ||||  ||||| ||||| |||  | ||| |||||||||
Sbjct: 202 ttccccgtcttttttgtccgtgatgcaatgaaattcccggacgcgatccgtgctttcaa 260

---

>gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds
          Length = 1761

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| || ||||| ||||||||||||||||||||||| |||||||| |||||| | 
Sbjct: 361 ggttttgctgtcaagttttacaccagagagggtaactttgatcttgttggaaacaatgtc 420

                        
Query: 64  cctgtgtttttta 76
           |||||||| ||||
Sbjct: 421 cctgtgttcttta 433

---

>emb|Z12021.1|GMCATALG G.max gene for catalase
          Length = 4687

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 215/273 (78%)
 Strand = Plus / Plus

                                                                        
Query: 4    ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
            |||||||| || || ||||||||||||||||||||||| |||||||| || |||||  | 
Sbjct: 2386 ggttttgctgtcaaattctacaccagagagggtaacttcgaccttgtgggaaacaacttc 2445

                                                                        
Query: 64   cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
            ||||| || ||  |||| |||||  | ||||| ||||||||||| |||||  |||| || 
Sbjct: 2446 cctgtcttcttcgtccgcgatggcctcaagtttcctgacatggttcatgccctcaaaccc 2505

                                                                        
Query: 124  agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
            |  || ||| || |||| |||||||| |||||  |  |||| ||||| || ||||| || 
Sbjct: 2506 aacccaaagtcccacatccaggagaattggaggatccttgatttcttctcccaccatccc 2565

                                                                        
Query: 184  gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 243
            || || || ||||||||| ||||| |||| ||||| ||||| || || |   | || |||
Sbjct: 2566 gaaagccttcacatgttctccttcttattcgacgacgttggtatccctcaagattacagg 2625

                                             
Query: 244  cacatggacggttttggtgtcaacacctacacc 276
            || ||||| || || ||||||||||||||||||
Sbjct: 2626 catatggatggcttcggtgtcaacacctacacc 2658



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 108/133 (81%)
 Strand = Plus / Plus

                                                                        
Query: 488  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 547
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 2870 ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 2929

                                                                        
Query: 548  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 607
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 2930 ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 2989

                         
Query: 608  ttgctttctgccc 620
            |||| || |||||
Sbjct: 2990 ttgcattttgccc 3002

---

>gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds
          Length = 1779

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 122/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 442 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
           |||||||||||||||||||| || ||| |||| || || || |  ||||||||||| || 
Sbjct: 835 tggaagcttttcatccagacgatggatcctgaacatgaagacaagtttgactttgatcca 894

                                                                       
Query: 502 cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
           |||||||| |||||||| ||||| ||||| ||| | ||  |||| ||||| || ||| ||
Sbjct: 895 cttgatgttaccaagacttggcctgaggatatcttgcccttgcagccagtgggccggttg 954

                                        
Query: 562 gtactgaacaagaacattgacaatttctt 590
           ||| | ||||||||||| || ||||||||
Sbjct: 955 gtattaaacaagaacatagataatttctt 983



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 135/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| ||||||||||| || |||||||| || |||||  | || || |||||| | 
Sbjct: 397 ggttttgctgtgaagttctatactagagagggcaattttgatatggtgggaaacaatttc 456

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           || || || ||||| || ||||  ||||||||||||||  || ||||||||||||| || 
Sbjct: 457 ccagtcttctttattcgtgatgcaatgaagttccctgatgtgatccatgctttcaaaccc 516

                                                          
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttctt 170
           | ||||||| || | || |||||| | |||||||| |||||||||||
Sbjct: 517 aatccgaagtcccatatccaggagtattggagagttgttgacttctt 563



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 236 actataggcacatggacggttttggtgt 263
           |||||||||||||||| || ||||||||
Sbjct: 629 actataggcacatggaaggctttggtgt 656

---

>gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complete cds
          Length = 1719

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 169/212 (79%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| |||||  | 
Sbjct: 398 ggttttgccgtgaagttttacaccagagaaggtaactttgaccttgttggaaacaacctt 457

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           || || || ||| | || ||||| |||||||| || || ||||| |||||| | || || 
Sbjct: 458 cccgtcttctttgtacgtgatggcatgaagtttccagatatggttcatgctcttaaaccc 517

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           | ||| |||| | |||| |||||||| |||||  |  |||||||||| || |||   || 
Sbjct: 518 aatcccaagaaccacatccaggagaattggaggatccttgacttcttctctcactttcca 577

                                           
Query: 184 gagagtctgcacatgttcaccttcctatttga 215
           || || || ||||||||||||||  |||||||
Sbjct: 578 gaaagccttcacatgttcacctttttatttga 609



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 111/135 (82%)
 Strand = Plus / Plus

                                                                        
Query: 486  atttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgca 545
            |||||||||||||||||||||||| || ||||| ||||| |||||||| || ||  ||||
Sbjct: 880  atttgactttgaccctcttgatgttactaagacttggcctgaggacattatacccttgca 939

                                                                        
Query: 546  accagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaaca 605
             || ||||| ||  |||| ||||| || ||||| || |||||||| || || ||||||||
Sbjct: 940  gcctgttggtcgcttggtcctgaataaaaacatagataatttctttgctgagaatgaaca 999

                           
Query: 606  gcttgctttctgccc 620
             ||||| || |||||
Sbjct: 1000 acttgcattttgccc 1014

---

>emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8
          Length = 3147

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                        
Query: 82   gatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatg 141
            |||||||||||||||||||| ||||| |||||| ||||||| |  || ||  |  |||| 
Sbjct: 1278 gatgggatgaagttccctgatatggttcatgctctcaagcccaaccctaaatcacacatt 1337

                                                                        
Query: 142  caggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttc 201
            ||||| ||||||||  || |||||||||| || ||||| || |||||  |||||||||||
Sbjct: 1338 caggaaaactggaggatacttgacttcttctcacaccatcccgagagcttgcacatgttc 1397

                                                                        
Query: 202  accttcctatttgacgatgttggcattccactcaactataggcacatggacggttttggt 261
             |||||||  |||||||  ||||  ||||||   | || ||||||||||| || | ||||
Sbjct: 1398 tccttcctgcttgacgacattggtgttccacaagattacaggcacatggaaggctctggt 1457

                       
Query: 262  gtcaacaccta 272
            || ||||||||
Sbjct: 1458 gttaacaccta 1468



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 487  tttgactttgaccctcttgatgtcaccaagacctggccagaggacatc 534
            |||||||||||||| |||||||| |||||||| ||||| || ||||||
Sbjct: 1683 tttgactttgacccacttgatgtaaccaagacttggcctgaagacatc 1730

---

>emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1 gene)
          Length = 1735

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 88  atgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggag 147
           ||||||||||| |||||||| || ||  ||||||| |  || |||||| |||| ||||||
Sbjct: 448 atgaagttcccggacatggtgcacgcgctcaagcccaaccccaagacccacatccaggag 507

                                                                       
Query: 148 aactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttc 207
           |||||| | ||  | |||||||| |||||||||||||||   || |||||||||||||||
Sbjct: 508 aactggcgcgtgctggacttcttctcgcaccacccggagtccctccacatgttcaccttc 567

                      
Query: 208 ctatttgacga 218
           || || |||||
Sbjct: 568 ctcttcgacga 578

---

>dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1, complete cds (exon 1-8)
          Length = 3711

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 167/210 (79%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||||| ||| | ||||| || || ||||| ||||| |||| ||||||||  || ||| |
Sbjct: 2106 tgattcaatttcggctggaaactatccagagtggaaactttacatccagataatggatcc 2165

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            || ||| || || | |||||||||||| || ||||| || ||||| |||||||| |||||
Sbjct: 2166 tgctcatgaagacaaatttgactttgatccacttgacgtgaccaaaacctggcccgagga 2225

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
             ||| | || ||||| |||||||| ||  ||||  |||| ||||||||||| || |||||
Sbjct: 2226 tatcctacccctgcagccagttggccgcctggtcttgaataagaacattgataacttctt 2285

                                          
Query: 591  cgcggaaaatgaacagcttgctttctgccc 620
             || || ||||| |||||||| || |||||
Sbjct: 2286 tgctgagaatgagcagcttgcattttgccc 2315



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 4    ggttttgcagtgaagttctacaccagagagg 34
            ||||| ||||||||||| |||||||||||||
Sbjct: 1448 ggtttcgcagtgaagttttacaccagagagg 1478

---

>gb|AY726007.1| Petunia x hybrida catalase gene, partial cds
          Length = 465

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
           ||||||||||| ||||| || |||||||| || || || ||||| || ||| ||| ||||
Sbjct: 145 attgcagctggaaattatcctgaatggaaactctttattcagactatggatcctgctcac 204

                                                                
Query: 478 gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           || ||||| ||||| ||||| || |||||||| || ||||| |||||||||||
Sbjct: 205 gaagatagttttgattttgatccacttgatgtgacgaagacttggccagagga 257



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 310 aagttccattggaaacctacatgtggtgtgaagt 343
           |||||||||||||| |||||||||||||| ||||
Sbjct: 37  aagttccattggaagcctacatgtggtgtcaagt 70

---

>emb|AJ973128.1| Andrographis paniculata partial cat gene for putative catalase,
           exons 1-2
          Length = 941

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 166/209 (79%)
 Strand = Plus / Plus

                                                                       
Query: 412 gattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgct 471
           ||||| |||||||| || || || |||||||||||||| ||||||||||| || ||| ||
Sbjct: 615 gattcaattgcagcaggaaactatccagaatggaagctgttcatccagactatagatcct 674

                                                                       
Query: 472 gatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggac 531
           |  || ||||| || || ||||| || || || ||||| |||||||| ||||| ||||| 
Sbjct: 675 gtccatgaggacaggttcgacttcgatccgctggatgtaaccaagacttggcctgaggat 734

                                                                       
Query: 532 atcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttcttc 591
           ||  | || ||||| || || ||  | |||||  ||||||||||||| ||||| || || 
Sbjct: 735 atattgcccctgcagccggtggggagaatggtgttgaacaagaacatcgacaactttttt 794

                                        
Query: 592 gcggaaaatgaacagcttgctttctgccc 620
           || || ||||| |||||||| ||||||||
Sbjct: 795 gcagagaatgagcagcttgcattctgccc 823



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  atccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagacc 135
           ||||||||||| || || ||||| |||||||| ||| | || ||||| | ||| ||| ||
Sbjct: 279 atccgagatggaataaaattccccgacatggttcattccttgaagccgaatcccaagtcc 338

                                                                       
Query: 136 aacatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcac 195
            |||| ||||||||||||||| |  | || |||||||| ||||| || || || || |||
Sbjct: 339 cacatccaggagaactggagaatcctggatttcttttcccaccatcccgaaagcctacac 398

                                  
Query: 196 atgttcaccttcctatttgacga 218
           |||||||||||||| || |||||
Sbjct: 399 atgttcaccttcctcttcgacga 421

---

>emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2
          Length = 1778

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 222
           |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 556 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 615

                
Query: 223 ggcat 227
           |||||
Sbjct: 616 ggcat 620



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 74/92 (80%)
 Strand = Plus / Plus

                                                                        
Query: 574  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 633
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 967  aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 1026

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| ||| ||||||| || || ||||||||
Sbjct: 1027 cctggtatctactactccgacgacaagctgct 1058

---

>emb|AJ299450.1|PPI299450 Pinus pinea partial mRNA for catalase 1 (cat1 gene)
          Length = 890

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 160/201 (79%)
 Strand = Plus / Plus

                                                                       
Query: 411 tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
           ||||||||| ||||| || || || || |||||||| ||||| |||||||| || ||| |
Sbjct: 562 tgattctatagcagcaggcaactatcctgaatggaaactttttatccagacaatggatcc 621

                                                                       
Query: 471 tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           |    | ||||||| || ||||||||| ||| | ||||| || || || ||||| |||||
Sbjct: 622 tcgggatgaggataaatatgactttgatcctttagatgttacgaaaacttggcccgagga 681

                                                                       
Query: 531 catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
            ||| | || || ||||| || ||||| |||||  |||||||||| ||||||||||||||
Sbjct: 682 tatctttcctcttcaacctgtaggacgcatggtcttgaacaagaatattgacaatttctt 741

                                
Query: 591 cgcggaaaatgaacagcttgc 611
            || ||||| || ||||||||
Sbjct: 742 tgctgaaaacgagcagcttgc 762



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 203/259 (78%)
 Strand = Plus / Plus

                                                                       
Query: 13  gtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttt 72
           ||||| ||||||||||||||||| ||||| || |||||||| || ||| | ||||| || 
Sbjct: 164 gtgaaattctacaccagagaggggaacttcgatcttgttggaaataattttcctgtattc 223

                                                                       
Query: 73  tttatccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaag 132
           ||| | || ||||| |||||||| || |||||||| ||||| || || |||| ||| || 
Sbjct: 224 tttgttcgcgatggtatgaagtttccagacatggttcatgcattgaaaccaaatcccaaa 283

                                                                       
Query: 133 accaacatgcaggagaactggagagtagttgacttcttttcgcaccacccggagagtctg 192
           |   |||| || ||  |||||||  |  | || ||||| || |||||||| |||||| ||
Sbjct: 284 agtcacattcaagaagactggaggattctagatttcttctctcaccacccagagagtttg 343

                                                                       
Query: 193 cacatgttcaccttcctatttgacgatgttggcattccactcaactataggcacatggac 252
           || ||||||||||| || ||||| ||| |||| || ||  | ||||| ||||| ||||| 
Sbjct: 344 catatgttcacctttctctttgatgatcttggaatccctttaaactacaggcatatggat 403

                              
Query: 253 ggttttggtgtcaacacct 271
           || | ||||||| ||||||
Sbjct: 404 gggtctggtgtccacacct 422



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 310 aagttccattggaaacctacatgtggtgtgaagtgcctcttggatgatgaagc 362
           ||||| |||||||  ||||| ||||| || ||||| || ||||||||||||||
Sbjct: 461 aagtttcattggaggcctacttgtggagttaagtgtctattggatgatgaagc 513

---

>emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene
          Length = 3662

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 163  gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 222
            |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 2399 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 2458

                 
Query: 223  ggcat 227
            |||||
Sbjct: 2459 ggcat 2463



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 74/92 (80%)
 Strand = Plus / Plus

                                                                        
Query: 574  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 633
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 2814 aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 2873

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| ||| ||||||| || || ||||||||
Sbjct: 2874 cctggtatctactactccgacgacaagctgct 2905

---

>gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, complete cds
          Length = 1824

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 163/205 (79%)
 Strand = Plus / Plus

                                                                        
Query: 411  tgattctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgc 470
            |||| ||||| || |||| || ||||| || |||||||||||||||||||| || ||| |
Sbjct: 810  tgatgctatttcatctggtaactaccctgagtggaagcttttcatccagacgatggatcc 869

                                                                        
Query: 471  tgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
            || | | |||||||  ||||| || ||||| |||||||| ||||||| |||||| |||||
Sbjct: 870  tgctgatgaggataagtttgatttcgacccgcttgatgtgaccaagatctggcctgagga 929

                                                                        
Query: 531  catcatcccactgcaaccagttggacggatggtactgaacaagaacattgacaatttctt 590
             ||  | ||  ||||||||||||| ||  |||| || |||| || |||||| || |||||
Sbjct: 930  tattctgcctttgcaaccagttggtcgcttggttctcaacaggaccattgataacttctt 989

                                     
Query: 591  cgcggaaaatgaacagcttgctttc 615
                |||| ||| ||||||||||||
Sbjct: 990  taatgaaactgagcagcttgctttc 1014



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 75
           ||||| |||||||||||||| |||||||| |||||||| ||||| |  || ||||| || 
Sbjct: 415 aagttttacaccagagaggggaactttgatcttgttggtaacaacactccagtgttcttc 474

                                                                       
Query: 76  atccgagatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagacc 135
           ||||| || |||||  ||||||| ||  | ||||||||  | ||||| |  |||||||| 
Sbjct: 475 atccgtgacgggatccagttcccggatgttgtccatgccctgaagccgaacccgaagaca 534

                               
Query: 136 aacatgcaggagaactggag 155
           ||||| |||||| |||||||
Sbjct: 535 aacatccaggagtactggag 554



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| ||| ||||||| ||||||||||||||
Sbjct: 1033 cctgggatctactactcggatgataagctgct 1064

---

>gb|AY110648.1| Zea mays CL1739_1 mRNA sequence
          Length = 1813

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 222
           |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 570 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 629

                
Query: 223 ggcat 227
           |||||
Sbjct: 630 ggcat 634



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 74/92 (80%)
 Strand = Plus / Plus

                                                                        
Query: 574  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 633
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 981  aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 1040

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| ||| ||||||| || || ||||||||
Sbjct: 1041 cctggtatctactactccgacgacaagctgct 1072

---

>gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1-like protein
           mRNA, complete cds
          Length = 1746

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| || ||||| ||||||||||||||||||||||| || ||||| |||||| | 
Sbjct: 401 ggttttgctgtcaagttttacaccagagagggtaactttgatctagttggaaacaatgtc 460

                        
Query: 64  cctgtgtttttta 76
           |||||||| ||||
Sbjct: 461 cctgtgttcttta 473

---

>gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complete cds
          Length = 1715

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 214/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           ||||| || ||||| |||||||| |||||||||||||| |||||||| || |||||  | 
Sbjct: 366 ggtttcgctgtgaaattctacactagagagggtaacttcgaccttgtgggaaacaacttc 425

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           ||||| || ||  |||| |||||  | ||||| |||||||||||||||||| |||| || 
Sbjct: 426 cctgtcttcttcgtccgcgatggcctcaagtttcctgacatggtccatgctctcaaaccc 485

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           |  || ||| || |||| |||||||| |||||  |  | || ||||| || ||||| || 
Sbjct: 486 aaccccaagtcccacatccaggagaattggaggatcctcgatttcttctcccaccatccc 545

                                                                       
Query: 184 gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 243
           || || || ||||||||| ||||| |||| || || ||||| || || |   | || |||
Sbjct: 546 gaaagccttcacatgttctccttcttattcgatgacgttggtatccctcaagattacagg 605

                                            
Query: 244 cacatggacggttttggtgtcaacacctacacc 276
           || ||||| ||||||||||| ||||| ||||||
Sbjct: 606 catatggatggttttggtgttaacacttacacc 638



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 107/133 (80%)
 Strand = Plus / Plus

                                                                       
Query: 488 ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 547
           ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 850 ttgactttgacccccttgatgtaactaagacctggcctgaggacgttttgcccctccagc 909

                                                                       
Query: 548 cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 607
           | ||||| || |||||  |||| ||||||||||| || ||||| || || || ||||| |
Sbjct: 910 ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaacgaacaac 969

                        
Query: 608 ttgctttctgccc 620
           |||| || |||||
Sbjct: 970 ttgcattttgccc 982

---

>gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complete cds
          Length = 1831

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 214/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| || || ||||||||||||||||||||||| |||||||| || |||||  | 
Sbjct: 398 ggttttgctgtcaaattctacaccagagagggtaacttcgaccttgtgggaaacaacttc 457

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           ||||| || ||  |||| |||||  | ||||| ||||||||||| |||||  |||| || 
Sbjct: 458 cctgtcttcttcgtccgcgatggcctcaagtttcctgacatggttcatgccctcaaaccc 517

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           |  || ||| || |||| |||||||| |||||  |  | || ||||| || ||||| || 
Sbjct: 518 aaccccaagtcccacatccaggagaattggaggatcctcgatttcttctcccaccatccc 577

                                                                       
Query: 184 gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 243
           || || || ||||||||| ||||| |||| ||||| ||||| || || |   | || |||
Sbjct: 578 gaaagccttcacatgttctccttcttattcgacgacgttggtatccctcaagattacagg 637

                                            
Query: 244 cacatggacggttttggtgtcaacacctacacc 276
           || ||||| || || ||||||||||||||||||
Sbjct: 638 catatggatggcttcggtgtcaacacctacacc 670



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 108/133 (81%)
 Strand = Plus / Plus

                                                                        
Query: 488  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 547
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 882  ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 941

                                                                        
Query: 548  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 607
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 942  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 1001

                         
Query: 608  ttgctttctgccc 620
            |||| || |||||
Sbjct: 1002 ttgcattttgccc 1014

---

>gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complete cds
          Length = 1733

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 214/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| || || ||||||||||||||||||||||| |||||||| || |||||  | 
Sbjct: 413 ggttttgctgtcaaattctacaccagagagggtaacttcgaccttgtgggaaacaacttc 472

                                                                       
Query: 64  cctgtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagcca 123
           ||||| || ||  |||| |||||  | ||||| ||||||||||| |||||  |||| || 
Sbjct: 473 cctgtcttcttcgtccgcgatggcctcaagtttcctgacatggttcatgccctcaaaccc 532

                                                                       
Query: 124 agtccgaagaccaacatgcaggagaactggagagtagttgacttcttttcgcaccacccg 183
           |  || ||| || |||| |||||||| |||||  |  | || ||||| || ||||| || 
Sbjct: 533 aaccccaagtcccacatccaggagaattggaggatcctcgatttcttctcccaccatccc 592

                                                                       
Query: 184 gagagtctgcacatgttcaccttcctatttgacgatgttggcattccactcaactatagg 243
           || || || ||||||||| ||||| |||| ||||| ||||| || || |   | || |||
Sbjct: 593 gaaagccttcacatgttctccttcttattcgacgacgttggtatccctcaagattacagg 652

                                            
Query: 244 cacatggacggttttggtgtcaacacctacacc 276
           || ||||| || || ||||||||||||||||||
Sbjct: 653 catatggatggcttcggtgtcaacacctacacc 685



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 108/133 (81%)
 Strand = Plus / Plus

                                                                        
Query: 488  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 547
            ||||||||||||| |||||||| || ||||||||||| |||||| |  | || || || |
Sbjct: 897  ttgactttgacccccttgatgttactaagacctggcccgaggacgttttgcccctccagc 956

                                                                        
Query: 548  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 607
            | ||||| || |||||  |||| ||||||||||| || ||||| || || |||||||| |
Sbjct: 957  ctgttggccgcatggtcttgaataagaacattgataacttctttgccgagaatgaacaac 1016

                         
Query: 608  ttgctttctgccc 620
            |||| || |||||
Sbjct: 1017 ttgcattttgccc 1029

---

>gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1-like protein
           mRNA, complete cds
          Length = 1525

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
           |||||||| || ||||| ||||||||||||||||||||||| || ||||| |||||| | 
Sbjct: 404 ggttttgctgtcaagttttacaccagagagggtaactttgatctagttggaaacaatgtc 463

                        
Query: 64  cctgtgtttttta 76
           |||||||| ||||
Sbjct: 464 cctgtgttcttta 476

---

>gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end
          Length = 1793

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 222
           |||||||| ||||||||||||||||| |||||||||||| ||||||| || ||||| || 
Sbjct: 568 gacttcttctcgcaccacccggagagcctgcacatgttctccttcctcttcgacgacgtc 627

                
Query: 223 ggcat 227
           |||||
Sbjct: 628 ggcat 632



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 74/92 (80%)
 Strand = Plus / Plus

                                                                        
Query: 574  aacattgacaatttcttcgcggaaaatgaacagcttgctttctgcccagcagtcactgtc 633
            ||||| ||||| ||||||||||| || || ||||| || |||||||| |   |||  |||
Sbjct: 979  aacatcgacaacttcttcgcggagaacgagcagctggccttctgcccgggcctcatcgtc 1038

                                            
Query: 634  cctggaatccactactctgatgataagctgct 665
            ||||| ||| ||||||| || || ||||||||
Sbjct: 1039 cctggtatctactactccgacgacaagctgct 1070

---

>ref|XM_470174.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1626

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 442 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
           |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 799 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 858

                                                                       
Query: 502 cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
           || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 859 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 918

                                                                      
Query: 562 gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
           || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 919 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 977



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 520 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 566

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                           
Query: 442     tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
               |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1768901 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1768842

                                                                           
Query: 502     cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
               || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1768841 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1768782

                                                                          
Query: 562     gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
               || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1768781 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1768723



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 163     gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
               |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1769180 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 1769134

---

>gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase mRNA, complete cds
          Length = 1861

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 442  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 882  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 941

                                                                        
Query: 502  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 942  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1001

                                                                       
Query: 562  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1002 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1060



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 603 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 649

---

>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08,
             complete sequence
          Length = 133090

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                         
Query: 442   tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
             |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 65461 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 65520

                                                                         
Query: 502   cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
             || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 65521 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 65580

                                                                        
Query: 562   gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
             || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 65581 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 65639



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 163   gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
             |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 65182 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 65228

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Minus

                                                                           
Query: 442     tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
               |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1768899 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1768840

                                                                           
Query: 502     cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
               || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1768839 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1768780

                                                                          
Query: 562     gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
               || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1768779 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1768721



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 163     gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
               |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1769178 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 1769132

---

>dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060B21, full
            insert sequence
          Length = 1945

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 442  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 1008 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 1067

                                                                        
Query: 502  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 1068 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 1127

                                                                       
Query: 562  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 1128 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1186



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 729 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 775

---

>dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C11, full
            insert sequence
          Length = 1763

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 442  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 860  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 919

                                                                        
Query: 502  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 920  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 979

                                                                       
Query: 562  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 980  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1038



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 581 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 627

---

>dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds
          Length = 1778

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 442  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 833  tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 892

                                                                        
Query: 502  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 893  ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 952

                                                                       
Query: 562  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 953  gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 1011



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
           |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 554 gacttcttgtcccaccacccggagagcctccacatgttcaccttcct 600

---

>dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene for catalase,
            complete cds
          Length = 4167

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                        
Query: 442  tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
            |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 2594 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 2653

                                                                        
Query: 502  cttgatgtcaccaagacctggccagaggacatcatcccactgcaaccagttggacggatg 561
            || || ||||||||||| ||||| ||||||||| |||| ||||| || || ||  |||||
Sbjct: 2654 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgcagcccgtggggaggatg 2713

                                                                       
Query: 562  gtactgaacaagaacattgacaatttcttcgcggaaaatgaacagcttgctttctgccc 620
            || || |||   ||||| ||||| |||||| |||| || || ||||| || ||||||||
Sbjct: 2714 gtgctcaaccgcaacatcgacaacttcttctcggagaacgagcagctggcgttctgccc 2772



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 163  gacttcttttcgcaccacccggagagtctgcacatgttcaccttcct 209
            |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 2315 gacttcttctcccaccacccggagagcctccacatgttcaccttcct 2361

---

>gb|AF139539.2|AF139539 Raphanus sativus catalase 3 (Cat3) mRNA, complete cds
          Length = 1801

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 75
           |||||||||||||||||||| |||||||| |||||||| ||||| |  ||||| || || 
Sbjct: 416 aagttctacaccagagaggggaactttgatcttgttggtaacaacactcctgtcttcttc 475

                                     
Query: 76  atccgagatgggatgaagttccctga 101
           ||||| || |||||  ||||||||||
Sbjct: 476 atccgtgacgggattcagttccctga 501



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 236 actataggcacatggacggttttggtgtcaacacctacac 275
           |||||||||||||||| ||||| |||||| ||||||||||
Sbjct: 636 actataggcacatggaaggtttcggtgtccacacctacac 675



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 433 tacccagaatggaagcttttcatccagaccattgatgctgatcacgaggatagatttgac 492
           ||||| || |||||||||||||||||||| || ||| |||   | |||||||  || || 
Sbjct: 833 taccctgagtggaagcttttcatccagacaatggatcctgcggatgaggataagttcgat 892

                                                 
Query: 493 tttgaccctcttgatgtcaccaagacctggccagagga 530
           || ||||| |||||||| ||||||| |||||| |||||
Sbjct: 893 ttcgacccgcttgatgtgaccaagatctggcctgagga 930



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 634  cctggaatccactactctgatgataagctgctc 666
            ||||| ||| ||||||| |||||||||||||||
Sbjct: 1034 cctgggatctactactcagatgataagctgctc 1066

---

>gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C mRNA, complete cds
          Length = 1503

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 222
           |||||||| || |||||||||||||| || ||||||||||||||||| || |||||  | 
Sbjct: 518 gacttcttctcccaccacccggagagcctccacatgttcaccttcctcttcgacgacatc 577

                                                                
Query: 223 ggcattccactcaactataggcacatggacggttttggtgtcaacacctacac 275
           ||||| ||   | ||||  | |||||||||||||  || ||||||||||||||
Sbjct: 578 ggcatccccgccgactaccgccacatggacggttccggcgtcaacacctacac 630



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 442 tggaagcttttcatccagaccattgatgctgatcacgaggatagatttgactttgaccct 501
           |||||||| |||||||||||||| ||  | || ||||||||  | || ||||| ||||| 
Sbjct: 796 tggaagctgttcatccagaccatcgaccccgaccacgaggaccgcttcgacttcgacccg 855

                                                       
Query: 502 cttgatgtcaccaagacctggccagaggacatcatcccactgca 545
           || || ||||||||||| ||||| ||||||||| |||| |||||
Sbjct: 856 ctcgacgtcaccaagacgtggcccgaggacatcgtcccgctgca 899

---

>gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, complete cds
          Length = 1837

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||| || || || ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 406 ggttttgctgtcaaattttacaccagagagggtaactttgatcttgttggaaacaat 462



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 490 gactttgaccctcttgatgtcaccaagacctggccagagga 530
           ||||||||||||||||| || |||||||||||||| |||||
Sbjct: 892 gactttgaccctcttgacgtaaccaagacctggcctgagga 932

---

>gb|AF096252.1|AF096252 Lycopersicon esculentum ethylene-responsive catalase (ER60) mRNA,
           partial cds
          Length = 270

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 415 tctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgat 474
           |||| ||||||||| ||||| || ||||||||| | ||||| ||||| || ||| | |||
Sbjct: 133 tctactgcagctggaaattatcctgaatggaagatcttcattcagactatggatccggat 192

                                                                
Query: 475 cacgaggatagatttgactttgaccctcttgatgtcaccaagacctggccaga 527
           || || || |||||||||||||| || |||||||| || || || ||||||||
Sbjct: 193 catgaagacagatttgactttgatccacttgatgtgacaaaaacttggccaga 245

---

>gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA, partial cds
          Length = 1286

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 207/265 (78%)
 Strand = Plus / Plus

                                                                       
Query: 22  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 81
           |||||||||||||||||||||||||| || || |||||  | || || || ||  |||| 
Sbjct: 203 tacaccagagagggtaactttgacctcgtcggaaacaacttccccgtcttcttcgtccgt 262

                                                                       
Query: 82  gatgggatgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatg 141
           |||||  | |||||||| ||||||||||| ||  |||| || | ||| ||| || |||| 
Sbjct: 263 gatggcctcaagttccccgacatggtccacgccctcaaacccaatcccaagtcccacatc 322

                                                                       
Query: 142 caggagaactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttc 201
           |||||||| |||||  |  | || ||||| || |||||||| || || || |||||||||
Sbjct: 323 caggagaattggaggatcctcgatttcttctcccaccaccccgaaagccttcacatgttc 382

                                                                       
Query: 202 accttcctatttgacgatgttggcattccactcaactataggcacatggacggttttggt 261
            ||||| | || || || || || || || |   | || ||||||||||| |||||||||
Sbjct: 383 tccttcttgttcgatgacgtgggtatcccccaggattacaggcacatggatggttttggt 442

                                    
Query: 262 gtcaacacctacaccttaatcagca 286
           |||||||| |||||| | |||||||
Sbjct: 443 gtcaacacatacaccctcatcagca 467

---

>dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT29P11, TM0193,
             complete sequence
          Length = 102354

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 180/229 (78%)
 Strand = Plus / Minus

                                                                         
Query: 32    agggtaactttgaccttgttgggaacaatatgcctgtgttttttatccgagatgggatga 91
             ||||||||||||||||||| || |||||  | ||||| || ||  | || ||||| ||||
Sbjct: 66572 agggtaactttgaccttgtgggaaacaacttccctgtcttcttcgtacgtgatggcatga 66513

                                                                         
Query: 92    agttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggagaact 151
             | || || || |||||||||||| | ||||| | ||| ||| |  |||| |||||||| |
Sbjct: 66512 aatttccagatatggtccatgctctgaagcccaatcccaagtctcacatccaggagaatt 66453

                                                                         
Query: 152   ggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttcctat 211
             ||||| |  |||||||||| || |||   || || || || || ||||||||||| ||||
Sbjct: 66452 ggagaatccttgacttcttctcccactttccagaaagccttcatatgttcacctttctat 66393

                                                              
Query: 212   ttgacgatgttggcattccactcaactataggcacatggacggttttgg 260
             |||| ||||| ||  ||||||   | |||||||||||||| ||||||||
Sbjct: 66392 ttgatgatgtgggtgttccacaagattataggcacatggatggttttgg 66344



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                               
Query: 1     cgtggttttgcagtgaagttctacaccagagagg 34
             ||||||||||| |||||||| |||||||||||||
Sbjct: 67450 cgtggttttgctgtgaagttttacaccagagagg 67417

---

>gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, partial cds
          Length = 1728

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 125/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 416 ctattgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatc 475
           |||||||  |||| || ||||| || ||||||||||| || ||||| || ||| |||   
Sbjct: 813 ctattgcgtctggtaactaccctgagtggaagctttttattcagacaatggatcctgcgg 872

                                                                       
Query: 476 acgaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatca 535
           | |||||||  |||||||| ||||| |||||||| ||||||| |||||| ||||| ||| 
Sbjct: 873 atgaggataagtttgacttcgacccgcttgatgtgaccaagatctggcctgaggatatct 932

                                               
Query: 536 tcccactgcaaccagttggacggatggtactgaaca 571
           | || ||||| || ||||| ||| |||| |||||||
Sbjct: 933 tgcctctgcagcctgttggtcggttggttctgaaca 968



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           ||||| |||||||||||||| |||||||| || ||||| |||||
Sbjct: 413 aagttttacaccagagaggggaactttgatctcgttggaaacaa 456



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 236 actataggcacatggacggttttggtgtcaacacctacac 275
           |||| ||||||||||| ||||| || ||| ||||||||||
Sbjct: 633 actacaggcacatggaaggtttcggcgtccacacctacac 672

---

>gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid binding catalase mRNA, partial
           cds
          Length = 1860

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           ||||||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 350 cgtggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 408



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 490 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 839 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 898

                                 
Query: 550 gttggacggatggtactgaaca 571
           ||||||||  ||||||| ||||
Sbjct: 899 gttggacgattggtacttaaca 920

---

>gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase (CAT-1) mRNA, complete
           cds
          Length = 1897

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           ||||||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 386 cgtggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 444



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 490 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 875 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 934

                                 
Query: 550 gttggacggatggtactgaaca 571
           ||||||||  ||||||| ||||
Sbjct: 935 gttggacgattggtacttaaca 956

---

>gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA, partial cds
          Length = 1416

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                     
Query: 1  cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
          ||||||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 31 cgtggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 89



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 490 gactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacca 549
           |||||||| ||||||||||| |||||||||||||| ||||| ||| | ||| ||   |||
Sbjct: 520 gactttgatcctcttgatgtaaccaagacctggcctgaggatatcttgccattgatgcca 579

                                 
Query: 550 gttggacggatggtactgaaca 571
           ||||||||  ||||||| ||||
Sbjct: 580 gttggacgattggtacttaaca 601

---

>dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds
          Length = 1573

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 88  atgaagttccctgacatggtccatgctttcaagccaagtccgaagaccaacatgcaggag 147
           ||||||||||| |||||||| || ||  ||||||| |  || |||||| |||| ||||||
Sbjct: 467 atgaagttcccggacatggtgcacgcgctcaagcccaaccccaagacccacatccaggag 526

                                                                       
Query: 148 aactggagagtagttgacttcttttcgcaccacccggagagtctgcacatgttcaccttc 207
           |||||| |  |  | |||||||| || ||||||||||||   || |||||||||||||||
Sbjct: 527 aactggcggatcctcgacttcttctcccaccacccggagtcgctccacatgttcaccttc 586

                      
Query: 208 ctatttgacga 218
           || || |||||
Sbjct: 587 ctcttcgacga 597

---

>emb|AJ616025.1| Homogyne alpina mRNA for catalase (cat1 gene)
          Length = 1779

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 117/146 (80%)
 Strand = Plus / Plus

                                                                        
Query: 463  attgatgctgatcacgaggatagatttgactttgaccctcttgatgtcaccaagacctgg 522
            |||||| ||||||| || ||| |  ||||||||||||| |||||||  || | ||| |||
Sbjct: 874  attgatcctgatcatgaagatcggcttgactttgacccgcttgatgggacaatgacatgg 933

                                                                        
Query: 523  ccagaggacatcatcccactgcaaccagttggacggatggtactgaacaagaacattgac 582
            || || |||||||| ||  |||| || |||||| |||||||  |||| ||||| || |||
Sbjct: 934  cctgatgacatcattcctttgcagcctgttggaaggatggttttgaataagaatatcgac 993

                                      
Query: 583  aatttcttcgcggaaaatgaacagct 608
            || ||||| || || |||||||||||
Sbjct: 994  aacttctttgctgagaatgaacagct 1019



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 29  gagagggtaactttgaccttgttgggaacaat 60
           ||||||||||||||||  ||||||| ||||||
Sbjct: 440 gagagggtaactttgatattgttggaaacaat 471

---

>gb|DQ004737.1| Phaseolus lunatus catalase (CAT1) mRNA, partial cds
          Length = 627

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 241 aggcacatggacggttttggtgtcaacacctacaccttaatcagca 286
           ||||||||||| ||||||||||||||||| |||||| | |||||||
Sbjct: 61  aggcacatggatggttttggtgtcaacacttacaccctcatcagca 106



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 486 atttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           ||||||||||||||| |||||||| || |||| |||||| |||||
Sbjct: 306 atttgactttgacccacttgatgtaactaagatctggcctgagga 350

---

>gb|AY507670.1| Malus x domestica catalase (CAT) mRNA, partial cds
          Length = 255

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttga 215
           |||||||| || ||||| || |||||  |||||||||||||||||||||||||
Sbjct: 127 gacttcttctcacaccatccagagagcttgcacatgttcaccttcctatttga 179

---

>gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, complete cds
          Length = 1772

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||||| ||||| |||||||||||| |||||||| ||||||
Sbjct: 375 aagttctacaacagagggggtaactttgatcttgttggaaacaat 419



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 412 gattctattgcagctgggaattacccagaatggaagcttttcatcca 458
           ||||| ||||||||||| || || || || |||||||||||||||||
Sbjct: 771 gattcaattgcagctggaaactatcctgagtggaagcttttcatcca 817

---

>emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 gene)
          Length = 1716

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           |||||||| || || || ||||||||||||||||||||||| || ||||| |||||
Sbjct: 406 ggttttgctgtcaaattttacaccagagagggtaactttgatctggttggaaacaa 461



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 484 agatttgactttgaccctcttgatgtcaccaagacctggccagagga 530
           ||||| |||||||| ||||||||||| ||||||| |||||| |||||
Sbjct: 886 agattcgactttgatcctcttgatgtaaccaagatctggcctgagga 932

---

>gb|AF069320.1|AF069320 Mesembryanthemum crystallinum root catalase mRNA, complete cds
          Length = 1847

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                        
Query: 418  attgcagctgggaattacccagaatggaagcttttcatccagaccattgatgctgatcac 477
            |||||||||||||||||||| || |||| | | ||||| || || || ||| |||   | 
Sbjct: 875  attgcagctgggaattaccctgagtggaggttgttcattcaaacaatggatcctgcagat 934

                                                                        
Query: 478  gaggatagatttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatc 537
            || |||| ||| |||||||||||  | ||| | |||||||| ||||||||||||||  | 
Sbjct: 935  gaagataaattcgactttgacccgttagatattaccaagacatggccagaggacattctg 994

                                                           
Query: 538  ccactgcaaccagttggacggatggtactgaacaagaacattgacaa 584
            || ||||| ||||| || ||  ||||  ||||||||||||| |||||
Sbjct: 995  cccctgcagccagtgggtcgtttggtgttgaacaagaacatcgacaa 1041



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           |||||||||||  | ||||||||||| |||||||||||||| ||  | || || ||||||
Sbjct: 455 cgtggttttgctctcaagttctacactagagagggtaacttcgatttagtaggaaacaat 514

                         
Query: 61  atgcctgtgttttt 74
            | |||||||||||
Sbjct: 515 ttccctgtgttttt 528

---

>gb|U89384.1|PAU89384 Pseudomonas aeruginosa paraquat inducible catalase isozyme B
           (katB), ankyrin (ankB) and (radA) genes, complete cds
          Length = 5246

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 76  atccgagatgggatgaagttccctgacatggtccatgctttcaagcc 122
           ||||| |||| ||| |||||||| |||||||||||||| ||||||||
Sbjct: 813 atccgcgatgcgatcaagttcccggacatggtccatgccttcaagcc 859

---

>gb|U34896.1|PAU34896 Pseudomonas aeruginosa catalase (katB) gene, complete cds
          Length = 2086

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 76  atccgagatgggatgaagttccctgacatggtccatgctttcaagcc 122
           ||||| |||| ||| |||||||| |||||||||||||| ||||||||
Sbjct: 813 atccgcgatgcgatcaagttcccggacatggtccatgccttcaagcc 859

---

>emb|Y13220.1|CRCATALAS Chlamydomonas reinhardtii mRNA for catalase
          Length = 1934

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 487  tttgactttgaccctcttgatgtcaccaagacctggcc 524
            ||||||||||||||||| || || ||||||||||||||
Sbjct: 1020 tttgactttgaccctctggacgtgaccaagacctggcc 1057



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 55  aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgct 114
           ||||| ||||| ||||| || ||||| || || ||||||||||| |||||||| || || 
Sbjct: 588 aacaacatgccggtgttcttcatccgcgacggcatgaagttcccggacatggttcacgcc 647

                   
Query: 115 ttcaagcc 122
           ||||||||
Sbjct: 648 ttcaagcc 655

---

>gb|AF016902.1|AF016902 Chlamydomonas reinhardtii catalase (CAT) mRNA, complete cds
          Length = 1835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 487 tttgactttgaccctcttgatgtcaccaagacctggcc 524
           ||||||||||||||||| || || ||||||||||||||
Sbjct: 915 tttgactttgaccctctggacgtgaccaagacctggcc 952



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 55  aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgct 114
           ||||| ||||| ||||| || ||||| || || ||||||||||| |||||||| || || 
Sbjct: 483 aacaacatgccggtgttcttcatccgcgacggcatgaagttcccggacatggttcacgcc 542

                   
Query: 115 ttcaagcc 122
           ||||||||
Sbjct: 543 ttcaagcc 550

---

>gb|AF332973.2| Zantedeschia aethiopica catalase 2 (Cat2) mRNA, complete cds
          Length = 1854

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 235 aactataggcacatggacggttttggtgtcaacacctacaccttaatca 283
           ||||| ||||||||||| || || || ||||||||||||||||| ||||
Sbjct: 645 aactacaggcacatggaaggcttcggcgtcaacacctacaccttcatca 693



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                        
Query: 489  tgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaacc 548
            |||||| ||||| || || | ||||||||||||||| |||||| |  |||| ||||| ||
Sbjct: 899  tgacttcgacccactggacgacaccaagacctggccggaggacctgctccccctgcagcc 958

                                                       
Query: 549  agttggacggatggtactgaacaagaacattgacaatttcttc 591
            ||| || ||  |||| || |||| |||||| ||||| ||||||
Sbjct: 959  agtgggccgcctggttctcaacaggaacatcgacaacttcttc 1001



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 7   tttgcagtgaagttctacaccagagagggtaact 40
           ||||| ||||| || |||||||||||||||||||
Sbjct: 417 tttgctgtgaaattttacaccagagagggtaact 450

---

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                          
Query: 1      cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
              ||||||||||| ||||||||||||||   ||| |||||||  || ||||| || || |||
Sbjct: 986645 cgtggttttgccgtgaagttctacacagaagatggtaactacgatcttgtaggcaataat 986586

                               
Query: 61     atgcctgtgttttttat 77
              |  ||||||||||||||
Sbjct: 986585 acccctgtgttttttat 986569

---

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                          
Query: 14     tgaagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttt 73
              |||||||||||||||| ||||| ||||  ||||| || || ||||| | ||| ||||| |
Sbjct: 940017 tgaagttctacaccagcgagggcaactacgacctcgtcggcaacaacacgccggtgttct 939958

                                       
Query: 74     ttatccgagatgggatgaagttccc 98
              ||||||| |||  |||||| |||||
Sbjct: 939957 ttatccgcgatccgatgaaattccc 939933



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                          
Query: 14     tgaagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttt 73
              |||||||||||||||| ||||| ||||  ||||| || || ||||| | ||| ||||| |
Sbjct: 889089 tgaagttctacaccagcgagggcaactacgacctcgtcggcaacaacacgccggtgttct 889030

                                       
Query: 74     ttatccgagatgggatgaagttccc 98
              ||||||| |||  |||||| |||||
Sbjct: 889029 ttatccgcgatccgatgaaattccc 889005

---

>emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (partial)
          Length = 4272

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 32   agggtaactttgaccttgttgggaacaatatgcctgtgtttttta 76
            ||||||||||||| |||||||| |||||| | |||||||| ||||
Sbjct: 2019 agggtaactttgatcttgttggaaacaatgtccctgtgttcttta 2063

---

>emb|AJ005939.1|MBA005939 Methanosarcina barkeri kat gene
          Length = 1846

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
           ||||||||||| ||||||||||||||   ||| |||||||  || ||||| || || |||
Sbjct: 572 cgtggttttgccgtgaagttctacacagaagatggtaactacgatcttgtaggcaataat 631

                            
Query: 61  atgcctgtgttttttat 77
           |  ||||||||||||||
Sbjct: 632 acccctgtgttttttat 648

---

>emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene)
          Length = 1781

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 487 tttgactttgaccctcttgatgtcaccaagacctggccagaggac 531
           |||||||||||||| || |||| ||||||||| ||||| ||||||
Sbjct: 923 tttgactttgacccgctggatgacaccaagacgtggcccgaggac 967



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 93/116 (80%)
 Strand = Plus / Plus

                                                                       
Query: 163 gacttcttttcgcaccacccggagagtctgcacatgttcaccttcctatttgacgatgtt 222
           |||||| |||| |||||||| ||||| || ||||  |||  |||||| || |||||||| 
Sbjct: 599 gacttcctttcccaccaccccgagagcctccacaccttcttcttcctcttcgacgatgtc 658

                                                                   
Query: 223 ggcattccactcaactataggcacatggacggttttggtgtcaacacctacacctt 278
           ||||| ||   | ||||  | ||||||||||| || || |||||||||||||||||
Sbjct: 659 ggcatccccaccgactaccgccacatggacggcttcggcgtcaacacctacacctt 714

---

>gb|AF170272.1|AF170272 Manihot esculenta catalase CAT1 mRNA, complete cds
          Length = 1792

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 16  aagttctacaccagagagggtaactttga 44
           |||||||||||||||||||| ||||||||
Sbjct: 394 aagttctacaccagagagggcaactttga 422

---

>gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA, complete cds
          Length = 1871

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 97/121 (80%)
 Strand = Plus / Plus

                                                                        
Query: 488  ttgactttgaccctcttgatgtcaccaagacctggccagaggacatcatcccactgcaac 547
            ||||||||||||| || |||| ||||| ||||||||| |||||  | || || ||||| |
Sbjct: 882  ttgactttgacccgctcgatggcaccatgacctggcctgaggatgtgataccgctgcagc 941

                                                                        
Query: 548  cagttggacggatggtactgaacaagaacattgacaatttcttcgcggaaaatgaacagc 607
            | || || || |||||  |||| ||||| ||||| || ||||| || || ||||||||||
Sbjct: 942  ctgtcgggcgtatggtgttgaataagaatattgataacttctttgctgagaatgaacagc 1001

             
Query: 608  t 608
            |
Sbjct: 1002 t 1002



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 16  aagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           ||||| || ||||||||||||||||||||  |||| ||||||||
Sbjct: 410 aagttttataccagagagggtaactttgatattgtggggaacaa 453

---

>ref|XM_365841.1| Magnaporthe grisea 70-15 hypothetical protein (MG10061.4) partial
           mRNA
          Length = 2232

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 253 ggttttggtgtcaacacctacacc 276
           ||||||||||||||||||||||||
Sbjct: 706 ggttttggtgtcaacacctacacc 729

---

>emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase
          Length = 1691

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 4   ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaa 59
           |||||||| || || || |||||||||||||| |||||||| || ||||| |||||
Sbjct: 380 ggttttgctgtcaaattttacaccagagaggggaactttgatctggttggaaacaa 435

---

>gb|BC051626.1| Danio rerio catalase, mRNA (cDNA clone MGC:56675 IMAGE:6033748),
           complete cds
          Length = 2260

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 1   cgtggttttgcagtgaagttctacacc 27
           |||||||| ||||||||||||||||||
Sbjct: 502 cgtggtttcgcagtgaagttctacacc 528

---

>ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1
           mRNA
          Length = 1874

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 673 cacatggacggcttcggcgtcaacacctacacctt 707

---

>ref|XM_463869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1874

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 673 cacatggacggcttcggcgtcaacacctacacctt 707

---

>ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1
           mRNA
          Length = 1876

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 675 cacatggacggcttcggcgtcaacacctacacctt 709

---

>gb|AF170069.1| Danio rerio catalase mRNA, complete cds
          Length = 1636

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 1   cgtggttttgcagtgaagttctacacc 27
           |||||||| ||||||||||||||||||
Sbjct: 388 cgtggtttcgcagtgaagttctacacc 414

---

>gb|DQ493908.1| Anguilla anguilla catalase mRNA, partial cds
          Length = 779

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 4   ggttttgcagtgaagttctacac 26
           |||||||||||||||||||||||
Sbjct: 478 ggttttgcagtgaagttctacac 500

---

>emb|AJ007505.1|DRE7505 Danio rerio mRNA for catalase
          Length = 2272

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 1   cgtggttttgcagtgaagttctacacc 27
           |||||||| ||||||||||||||||||
Sbjct: 486 cgtggtttcgcagtgaagttctacacc 512

---

>emb|Z99108.2|BSUB0005 Bacillus subtilis complete genome (section 5 of 21): from 813670 to
              1011078
          Length = 197409

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 55     aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 101
              ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 146275 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 146229

---

>emb|Z82044.1|BSZ82044 Bacillus subtilis 25 kb genomic DNA segment (from sspE to katA)
          Length = 24524

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 55    aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 101
             ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 24146 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 24100

---

>emb|Z54143.2|SSCATMR Secale cereale mRNA for catalase (cat1a gene)
          Length = 1747

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 676 cacatggacggcttcggcgtcaacacctacacctt 710

---

>emb|X97673.1|XOKATX X.oryzae katX gene
          Length = 2935

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 55  aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgc 113
           |||||||| || |||||||| ||||  |||| ||| |||||||||||| || |||||||
Sbjct: 863 aacaatatcccggtgtttttcatccaggatgcgatcaagttccctgacctgatccatgc 921

---

>emb|X61626.1|OSCATAL O.sativa mRNA for catalase
          Length = 1865

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 632 cacatggacggcttcggcgtcaacacctacacctt 666

---

>ref|NM_130912.1| Danio rerio catalase (cat), mRNA
          Length = 2260

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 1   cgtggttttgcagtgaagttctacacc 27
           |||||||| ||||||||||||||||||
Sbjct: 502 cgtggtttcgcagtgaagttctacacc 528

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 55      aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgc 113
               |||||||| || |||||||| ||||  |||| ||| |||||||||||| || |||||||
Sbjct: 3653891 aacaatatcccggtgtttttcatccaggatgcgatcaagttccctgacctgatccatgc 3653949

---

>gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds
          Length = 2036

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                       
Query: 22  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 81
           |||||||||||||| ||||||||  |||| ||||||||  | || || || || || || 
Sbjct: 389 tacaccagagaggggaactttgatattgtggggaacaacttccccgtcttcttcattcgc 448

                                                      
Query: 82  gatgggatgaagttccctgacatggtccatgctttcaagccaa 124
           |||| ||| || ||||||||| || | |||||||| |||||||
Sbjct: 449 gatgcgatcaaattccctgacgtgattcatgcttttaagccaa 491

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 244    cacatggacggttttggtgtcaacacctacacctt 278
              ||||||||||| || || |||||||||||||||||
Sbjct: 826682 cacatggacggcttcggcgtcaacacctacacctt 826648

---

>gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds
          Length = 1754

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                       
Query: 22  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 81
           |||||||||||||| ||||||||  |||| ||||||||  | || || || || || || 
Sbjct: 399 tacaccagagaggggaactttgatattgtggggaacaacttccccgtcttcttcattcgc 458

                                                      
Query: 82  gatgggatgaagttccctgacatggtccatgctttcaagccaa 124
           |||| ||| || ||||||||| || | |||||||| |||||||
Sbjct: 459 gatgcgatcaaattccctgacgtgattcatgcttttaagccaa 501

---

>dbj|AB046412.1| Bacillus subtilis katA gene for catalase, complete cds
          Length = 1827

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 55  aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 101
           ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 547 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 593

---

>gb|AE004875.1| Pseudomonas aeruginosa PAO1, section 436 of 529 of the complete
            genome
          Length = 10429

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 76   atccgagatgggatgaagttccctgacatggtccatgctttcaagcc 122
            ||||| |||| ||| |||||||| || ||||||||||| ||||||||
Sbjct: 5257 atccgcgatgcgatcaagttcccggatatggtccatgccttcaagcc 5211

---

>dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1442_E05
          Length = 162407

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 244   cacatggacggttttggtgtcaacacctacacctt 278
             ||||||||||| || || |||||||||||||||||
Sbjct: 35890 cacatggacggcttcggcgtcaacacctacacctt 35856

---

>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0036E06
          Length = 137926

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 244    cacatggacggttttggtgtcaacacctacacctt 278
              ||||||||||| || || |||||||||||||||||
Sbjct: 104813 cacatggacggcttcggcgtcaacacctacacctt 104779

---

>emb|AJ234404.1|HVU234404 Hordeum vulgare partial mRNA; clone cMWG0652.uni
          Length = 525

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 92  cacatggacggcttcggcgtcaacacctacacctt 126

---

>dbj|AK099923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116M08, full
           insert sequence
          Length = 1875

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 674 cacatggacggcttcggcgtcaacacctacacctt 708

---

>dbj|AK099231.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095I04, full
           insert sequence
          Length = 1873

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 672 cacatggacggcttcggcgtcaacacctacacctt 706

---

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 77/95 (81%)
 Strand = Plus / Minus

                                                                           
Query: 16      aagttctacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgtttttt 75
               |||||||||||| | || || ||||  ||||| || || |||||  |||| ||||| || 
Sbjct: 1984944 aagttctacacccgcgaaggcaactgggacctggtcggcaacaacctgccggtgttcttc 1984885

                                                  
Query: 76      atccgagatgggatgaagttccctgacatggtcca 110
               ||||| || | |||||||||||| |||||||||||
Sbjct: 1984884 atccgcgacgcgatgaagttcccggacatggtcca 1984850

---

>dbj|AK065094.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M08, full
           insert sequence
          Length = 1873

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 672 cacatggacggcttcggcgtcaacacctacacctt 706

---

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 86/107 (80%)
 Strand = Plus / Minus

                                                                           
Query: 4       ggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaatatg 63
               |||||||| |||||| |||| |||  ||| || ||||  ||||||||||| ||||| |||
Sbjct: 1249100 ggttttgccgtgaagctctataccgaagaaggcaactgggaccttgttggcaacaacatg 1249041

                                                              
Query: 64      cctgtgttttttatccgagatgggatgaagttccctgacatggtcca 110
               || || ||||| ||||  || |  || |||||||| |||||||||||
Sbjct: 1249040 cccgtctttttcatccaggacgccatcaagttcccggacatggtcca 1248994

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 55      aacaatatgcctgtgttttttatccgagatgggatgaagttccctgacatggtccatgc 113
               |||||||| || |||||||| ||||  |||| ||| |||||||||||| || |||||||
Sbjct: 3651320 aacaatatcccggtgtttttcatccaggatgcgatcaagttccctgacctgatccatgc 3651378

---

>gb|AF021939.1|AF021939 Hordeum vulgare catalase 2 (CAT2) gene, partial cds
          Length = 1326

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 301 cacatggacggcttcggcgtcaacacctacacctt 335

---

>gb|U20778.1|HVU20778 Hordeum vulgare catalase (Cat2) mRNA, complete cds
          Length = 1756

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 244 cacatggacggttttggtgtcaacacctacacctt 278
           ||||||||||| || || |||||||||||||||||
Sbjct: 659 cacatggacggcttcggcgtcaacacctacacctt 693

---

>gb|M80796.1|BACDNA Bacillus subtilis vegetative catalase (kat-19+) gene, complete cds
          Length = 1452

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 55  aacaatatgcctgtgttttttatccgagatgggatgaagttccctga 101
           ||||||| |||||| || |||||||| |||| ||| |||||||||||
Sbjct: 379 aacaatacgcctgtattctttatccgcgatgcgattaagttccctga 425

---

>gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, complete cds,
           alternatively spliced
          Length = 2254

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 83/103 (80%)
 Strand = Plus / Plus

                                                                       
Query: 22  tacaccagagagggtaactttgaccttgttgggaacaatatgcctgtgttttttatccga 81
           |||||||||||||| ||||||||  |||| ||||||||  | || || || || || || 
Sbjct: 430 tacaccagagaggggaactttgatattgtggggaacaacttccccgtcttcttcattcgc 489

                                                      
Query: 82  gatgggatgaagttccctgacatggtccatgctttcaagccaa 124
           |||| ||| || ||||||||| || | |||||||| |||||||
Sbjct: 490 gatgcgatcaaattccctgacgtgattcatgcttttaagccaa 532

---

>dbj|D29966.1|RICCA Rice CatA gene for catalase, complete cds
          Length = 4670

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 244  cacatggacggttttggtgtcaacacctacacctt 278
            ||||||||||| || || |||||||||||||||||
Sbjct: 2479 cacatggacggcttcggcgtcaacacctacacctt 2513

---

>emb|X05549.1|IBCATR Seet potato mRNA for catalase (EC 1.11.1.6)
          Length = 1804

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                       
Query: 67  gtgttttttatccgagatgggatgaagttccctgacatggtccatgctttcaagccaagt 126
           ||||| |||||||| || || | | ||||||| ||| || |||| || ||||||||||  
Sbjct: 505 gtgttctttatccgggacggaacgcagttcccggacgtgatccacgcgttcaagccaaac 564

                                         
Query: 127 ccgaagaccaacatgcaggagaactggaga 156
           |||||  || |||| |||||||||||||||
Sbjct: 565 ccgaaatcccacatccaggagaactggaga 594

---

>gb|AY159321.1| Simian immunodeficiency virus isolate SIVdrl1FAO, complete genome
          Length = 9732

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 285  cagggatggaaaggctcacctg 306
            ||||||||||||||||||||||
Sbjct: 2567 cagggatggaaaggctcacctg 2588

---

>gb|U64156.1|HIVU64156 HIV-1 isolate MM351 from Australia, reverse transcriptase (pol)
           gene, partial cds
          Length = 726

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 285 cagggatggaaaggctcacctg 306
           ||||||||||||||||||||||
Sbjct: 428 cagggatggaaaggctcacctg 449

---

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                           
Query: 1       cgtggttttgcagtgaagttctacaccagagagggtaactttgaccttgttgggaacaat 60
               ||||||||||| || |||||||||||| | || || ||||| ||||| || || ||||| 
Sbjct: 5983680 cgtggttttgcggtcaagttctacaccggcgaaggcaacttcgacctggtgggcaacaac 5983739

                    
Query: 61      atgcc 65
               |||||
Sbjct: 5983740 atgcc 5983744

---

>gb|AC115122.4| Mus musculus BAC clone RP24-108L20 from chromosome 14, complete
            sequence
          Length = 163480

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 98   ctgacatggtccatgctttca 118
            |||||||||||||||||||||
Sbjct: 5117 ctgacatggtccatgctttca 5097

---

>gb|AY802593.1| HIV-1 isolate CA10424 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 780

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 gcagggatggaaaggctcacc 304
           |||||||||||||||||||||
Sbjct: 450 gcagggatggaaaggctcacc 470

---

>gb|AY802587.1| HIV-1 isolate CA4230 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 771

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 gcagggatggaaaggctcacc 304
           |||||||||||||||||||||
Sbjct: 450 gcagggatggaaaggctcacc 470

---

>gb|AE012515.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 423
            of 460 of the complete genome
          Length = 10679

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 82   gatgggatgaagttccctgacatggtccatgctttcaagcc 122
            |||| ||| |||||||| ||||||||||| || ||||||||
Sbjct: 4602 gatgcgatcaagttccccgacatggtccacgcgttcaagcc 4562

---

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 82      gatgggatgaagttccctgacatggtccatgctttcaagcc 122
               |||| ||| |||||||| ||||||||||| || ||||||||
Sbjct: 4751968 gatgcgatcaagttccccgacatggtccacgcgttcaagcc 4751928

---

>gb|DQ024058.1| HIV-1 isolate mA142 from Martinique reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 gcagggatggaaaggctcacc 304
           |||||||||||||||||||||
Sbjct: 329 gcagggatggaaaggctcacc 349

---

>gb|AF260737.1|AF260737 Cucurbita pepo catalase mRNA, partial cds
          Length = 492

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 566 tgaacaagaacattgacaatttctt 590
           ||||||||||||| |||||||||||
Sbjct: 253 tgaacaagaacatagacaatttctt 277

---

>gb|AC148978.3| Mus musculus BAC clone RP23-359K8 from 14, complete sequence
          Length = 241799

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 98    ctgacatggtccatgctttca 118
             |||||||||||||||||||||
Sbjct: 92093 ctgacatggtccatgctttca 92073

---

>gb|AY365745.1| HIV-1 isolate 106239 from Argentina pol protein (pol) gene, partial
           cds
          Length = 1497

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 284 gcagggatggaaaggctcacc 304
           |||||||||||||||||||||
Sbjct: 747 gcagggatggaaaggctcacc 767

---

>dbj|D55647.1|CUCCAT3 Pumpkin mRNA for catalase (cat3), complete cds
          Length = 1804

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 566  tgaacaagaacattgacaatttcttcgcggaaaatga 602
            ||||||||||||| || |||||||| ||||| |||||
Sbjct: 964  tgaacaagaacatagataatttctttgcggagaatga 1000

---

>gb|DQ025189.1| HIV-1 isolate pE90394 from Puerto Rico reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 330 cagggatggaaaggctcacc 349

---

>gb|DQ025104.1| HIV-1 isolate pE85105 from Puerto Rico reverse transcriptase (pol)
           gene, partial cds
          Length = 577

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 330 cagggatggaaaggctcacc 349

---

>ref|NM_194840.1| Oryza sativa (japonica cultivar-group) putative transposon protein
            (OSJNBa0030B02.14), mRNA
          Length = 2526

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 218  atgttggcattccactcaac 237
            ||||||||||||||||||||
Sbjct: 1367 atgttggcattccactcaac 1348

---

>gb|AY701391.1| HIV-1 isolate RW0550 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 632

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 342 cagggatggaaaggctcacc 361

---

>gb|AY388831.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949

---

>gb|AY388830.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949

---

>gb|AY388829.1| HIV-1 from USA isolate P00046 nonfunctional pol protein (pol) gene,
           partial sequence
          Length = 1529

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 930 cagggatggaaaggctcacc 949

---

>gb|AY362104.1| HIV-1 isolate 111925 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY362101.1| HIV-1 isolate 134795 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY362100.1| HIV-1 isolate 134284 from United Kingdom pol protein (pol) gene,
           partial cds
          Length = 969

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY316083.1| HIV-1 from Spain isolate 67.00 pol protein (pol) gene, partial cds
          Length = 1971

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY471869.1| HIV-1 isolate 206140 from USA pol protein (pol) gene, partial cds
          Length = 1022

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 751 cagggatggaaaggctcacc 770

---

>gb|AY528204.1| HIV-1 isolate A0387 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY528203.1| HIV-1 isolate A0386 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY528202.1| HIV-1 isolate A0385 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY527896.1| HIV-1 isolate A0079 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|AY527895.1| HIV-1 isolate A0078 from USA pol protein (pol) gene, partial cds
          Length = 1020

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 739 cagggatggaaaggctcacc 758

---

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 4      ggttttgcagtgaagttctacacc 27
              |||||||| |||||||||||||||
Sbjct: 421306 ggttttgcggtgaagttctacacc 421283

---

>gb|AY149565.1| HIV-1 isolate DK.IM.123-f.RT reverse transcriptase (pol) gene,
           partial cds
          Length = 630

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 340 cagggatggaaaggctcacc 359

---

>gb|AY275769.1| HIV-1 isolate 128PR_RT from Brazil pol protein (pol) gene, partial
           cds
          Length = 972

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY815698.1| Schistosoma japonicum SJCHGC08499 protein mRNA, complete cds
          Length = 724

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 463 attgatgctgatcacgagga 482
           ||||||||||||||||||||
Sbjct: 535 attgatgctgatcacgagga 554

---

>gb|AY334713.1| HIV-1 isolate 51581.f from Puerto Rico pol protein (pol) gene,
           partial cds
          Length = 620

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 340 cagggatggaaaggctcacc 359

---

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 91      aagttccctgacatggtccatgctttcaagcc 122
               |||||||| ||||||||||| || ||||||||
Sbjct: 3795113 aagttcccggacatggtccacgccttcaagcc 3795144

---

>gb|AY714472.1| HIV-1 isolate F56706_RT from USA reverse transcriptase (Pol) gene,
           partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY714470.1| HIV-1 from USA reverse transcriptase (Pol) gene, partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY714434.1| HIV-1 isolate F74928_RT from USA reverse transcriptase (Pol) gene,
           partial cds
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>ref|XM_742595.1| Aspergillus fumigatus Af293 catalase A (Afu6g03890) partial mRNA
          Length = 2253

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 47  ttgttgggaacaatatgcctgtgttttt 74
           ||||||||||||| || |||||||||||
Sbjct: 488 ttgttgggaacaacatccctgtgttttt 515

---

>gb|AY165273.1| HIV-1 isolate 01SE-22264 from Sweden gag-pol fusion polyprotein
           gene, partial cds
          Length = 1475

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 903 cagggatggaaaggctcacc 922

---

>gb|DQ157817.1| HIV-1 isolate PE.5895 from Peru protease (pol) gene, partial cds
          Length = 1024

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 869 cagggatggaaaggctcacc 888

---

>emb|AL606504.14| Human DNA sequence from clone RP11-358K2 on chromosome 10, complete
             sequence
          Length = 81147

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 518   cctggccagaggacatcatcccactgca 545
             |||||||||||||| ||| |||||||||
Sbjct: 67121 cctggccagaggacctcaccccactgca 67148

---

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 7       tttgcagtgaagttctacac 26
               ||||||||||||||||||||
Sbjct: 2031829 tttgcagtgaagttctacac 2031810

---

>gb|AF454535.1| HIV-1 isolate 66936VI from Czech Republic reverse transcriptase
           (pol) gene, partial cds
          Length = 543

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 334 cagggatggaaaggctcacc 353

---

>gb|AY213503.1| HIV-1 isolate BRP2177RT from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 571

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 346 cagggatggaaaggctcacc 365

---

>gb|AY213272.1| HIV-1 isolate BRRJ917RT from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 571

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 346 cagggatggaaaggctcacc 365

---

>gb|AY260398.1| HIV-1 isolate 213 from France reverse transcriptase (pol) gene,
           partial cds
          Length = 596

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 337 cagggatggaaaggctcacc 356

---

>gb|AY260380.1| HIV-1 isolate 195 from France reverse transcriptase (pol) gene,
           partial cds
          Length = 596

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 337 cagggatggaaaggctcacc 356

---

>gb|AY075969.1| HIV-1 isolate 91USG191814pc2 from USA pol polyprotein (pol) gene,
           partial cds
          Length = 997

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 757 cagggatggaaaggctcacc 776

---

>gb|DQ087444.1| Cerebratulus lacteus catalase mRNA, partial cds
          Length = 792

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 600 tgaacagcttgctttctgcccagc 623
           ||||||| ||||||||||||||||
Sbjct: 720 tgaacagattgctttctgcccagc 743

---

>gb|AY877247.1| HIV-1 isolate BR02SP167 from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 623

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 382 cagggatggaaaggctcacc 401

---

>gb|AY877199.1| HIV-1 isolate BR02SP183 from Brazil reverse transcriptase (pol)
           gene, partial cds
          Length = 1005

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|DQ455125.1| Medicago truncatula cDNA-AFLP fragment BC21M31_53 sequence
          Length = 170

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 32  agggtaactttgaccttgttgggaacaa 59
           ||||||||||||||||||| || |||||
Sbjct: 82  agggtaactttgaccttgtcggaaacaa 109

---

>emb|AL596129.27| Mouse DNA sequence from clone RP23-294E23 on chromosome 11 Contains the
             3' end of the Myh3 gene for embryonic skeletal muscle
             myosin heavy polypeptide 3, four novel genes
             (2310065F04Rik), the Myh2 gene for adult skeletal muscle
             myosin heavy polypeptide 2, the Myh1 gene for adult
             skeletal muscle myosin heavy polypeptide 1, the Myh4 gene
             for skeletal muscle  myosin heavy polypeptide 4 and the
             Myh8 gene for perinatal skeletal muscle myosin heavy
             polypeptide 8 (4832426G23Rik), complete sequence
          Length = 221384

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   tcagcagggatggaaaggct 300
             ||||||||||||||||||||
Sbjct: 64019 tcagcagggatggaaaggct 64038

---

>gb|DQ059651.1| HIV-1 isolate TV811 from Canada reverse transcriptase (pol) gene,
           partial cds
          Length = 522

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 402 cagggatggaaaggctcacc 421

---

>emb|AJ419504.1|HIM419504 Human immunodeficiency virus type 1 partial polyprotein gene for
           protease and reverse transcriptase precursor, genomic
           RNA, patient 296
          Length = 1269

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>emb|AJ419503.1|HIM419503 Human immunodeficiency virus type 1 partial polyprotein gene for
           protease and reverse transcriptase precursor, genomic
           RNA, patient 295
          Length = 1323

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 748 cagggatggaaaggctcacc 767

---

>gb|AY801196.1| HIV-1 isolate CA34461 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY801175.1| HIV-1 isolate CA48112 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY801006.1| HIV-1 isolate CA9339 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 660

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470

---

>gb|AY800826.1| HIV-1 isolate CA38923 from USA reverse transcriptase (pol) gene,
           partial cds
          Length = 903

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 285 cagggatggaaaggctcacc 304
           ||||||||||||||||||||
Sbjct: 451 cagggatggaaaggctcacc 470


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,656,146
Number of Sequences: 3902068
Number of extensions: 5656146
Number of successful extensions: 153528
Number of sequences better than 10.0: 466
Number of HSP's better than 10.0 without gapping: 466
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 152210
Number of HSP's gapped (non-prelim): 1241
length of query: 666
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 643
effective length of database: 17,143,297,704
effective search space: 11023140423672
effective search space used: 11023140423672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---