>emb|AL157414.19| Human DNA sequence from clone RP11-560A15 on chromosome 20 Contains two
novel genes, the 3' part of the BMP7 for bone
morphogenetic protein 7 and a CpG island, complete
sequence
Length = 124849
Score = 40.1 bits (20), Expect = 8.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 584 tctggggcgaaggtagttgctgtt 607
||||||||||||| ||||||||||
Sbjct: 39520 tctggggcgaagggagttgctgtt 39497
>emb|AL139803.12| Human DNA sequence from clone RP11-77P3 on chromosome 13 Contains the
3' end of a novel gene, complete sequence
Length = 107708
Score = 40.1 bits (20), Expect = 8.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 392 aatattgatcacaaaattttgaaa 415
|||||||| |||||||||||||||
Sbjct: 82579 aatattgaccacaaaattttgaaa 82556
>emb|AL132765.38|HSA462D18 Human DNA sequence from clone RP11-462D18 on chromosome 20 Contains the
5' end of the BFSP1 gene for beaded filament structural
protein 1 (filensin), the DSTN gene for destrin (actin
depolymerizing factor ADF), a ras-like pseudogene, the
RRBP1 gene for ribosome binding protein 1 (dog 180 kDa
homolog), the 5' end of the C20orf179 gene for chromosome
20 open reading frame 179 and two CpG islands, complete
sequence
Length = 166001
Score = 40.1 bits (20), Expect = 8.4
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 392 aatattgatcacaaaattttgaaa 415
||||||||||||| ||||||||||
Sbjct: 46579 aatattgatcacataattttgaaa 46602
>emb|AL021026.1|HS127D3 Human DNA sequence from clone RP1-127D3 on chromosome 1q23-25 Contains
the FMO3 gene for flavin containing monooxygenase 3, a
novel flavin containing monooxygenase, the FMO2 gene for
flavin containing monooxygenase 2, the 3' end of a novel
gene, a novel gene and the 5' end of the FMO1 gene for
flavin containing monooxygenase 1, complete sequence
Length = 162075
Score = 40.1 bits (20), Expect = 8.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 97 ggacacagagagggcaacaa 116
||||||||||||||||||||
Sbjct: 156319 ggacacagagagggcaacaa 156338
>emb|AJ629123.1| Streptomyces sp. DSM 40477 genomic region of the apramycin biosynthesis
cluster
Length = 41623
Score = 40.1 bits (20), Expect = 8.4
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 75 tcgacctcgatggcaccctcctggacac 102
||||| |||| |||||||||||||||||
Sbjct: 22337 tcgacatcgacggcaccctcctggacac 22310
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,753,948
Number of Sequences: 3902068
Number of extensions: 4753948
Number of successful extensions: 87326
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87027
Number of HSP's gapped (non-prelim): 295
length of query: 619
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 596
effective length of database: 17,143,297,704
effective search space: 10217405431584
effective search space used: 10217405431584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)