ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal21a21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009268.1| Triticum aestivum clone wlk8.pk0002.f4:fis, full ... 942 0.0
2ref|NM_190436.1| Oryza sativa (japonica cultivar-group), predic... 543 e-151
3dbj|AK121100.1| Oryza sativa (japonica cultivar-group) cDNA clon... 543 e-151
4gb|AY103958.1| Zea mays PCO141591 mRNA sequence 511 e-142
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 359 7e-96
6dbj|AP003252.4| Oryza sativa (japonica cultivar-group) genomic D... 359 7e-96
7dbj|AP003734.3| Oryza sativa (japonica cultivar-group) genomic D... 359 7e-96
8gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 72 2e-09
9gb|AY943856.1| Nicotiana benthamiana non-intrinsic ABC protein m... 72 2e-09
10gb|CP000316.1| Polaromonas sp. JS666, complete genome 68 4e-08
11dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 54 6e-04
12gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 50 0.009
13gb|AE016828.2| Coxiella burnetii RSA 493, complete genome 48 0.035
14gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 48 0.035
15gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 46 0.14
16gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 46 0.14
17ref|NM_116715.3| Arabidopsis thaliana ATABC1 AT4G04770 (ATABC1) ... 44 0.55
18gb|AC140245.3| Mus musculus BAC clone RP23-293J3 from chromosome... 44 0.55
19emb|AL161501.2|ATCHRIV13 Arabidopsis thaliana DNA chromosome 4, ... 44 0.55
20gb|AY142069.1| Arabidopsis thaliana At4g04770/T4B21_16 mRNA, com... 44 0.55
21gb|AF329697.1| Xanthomonas oryzae pv. oryzae insertion sequence ... 44 0.55
22dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.55
23gb|AE012389.1| Xanthomonas campestris pv. campestris str. ATCC 3... 44 0.55
24gb|AY056410.1| Arabidopsis thaliana AT4g04770/T4B21_16 mRNA, com... 44 0.55
25gb|AY052195.1| Arabidopsis thaliana AT4g04770/T4B21_16 mRNA, com... 44 0.55
26gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 44 0.55
27tpg|BK001497.1| TPA: TPA_exp: Arabidopsis thaliana putative ABC ... 44 0.55
28emb|BX827675.1|CNS0A3OT Arabidopsis thaliana Full-length cDNA Co... 44 0.55
29dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 44 0.55
30gb|AF118223.2|T4B21 Arabidopsis thaliana BAC T4B21 44 0.55
31gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 44 0.55
32gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete g... 42 2.2
33emb|BX537928.1|HSM806046 Homo sapiens genomic DNA; cDNA DKFZp686... 42 2.2
34gb|AC092421.2| Homo sapiens chromosome 3 clone RP11-476A24, comp... 42 2.2
35gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 42 2.2
36emb|BX827948.1|CNS0A3VL Arabidopsis thaliana Full-length cDNA Co... 42 2.2
37gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete... 42 2.2
38gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.6
39gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 8.6
40gb|AC182692.2| Populus trichocarpa clone Pop1-44B2, complete seq... 40 8.6
41gb|AF490364.1| Ceratium horridum extrachromosomal minicircle put... 40 8.6
42gb|DQ277922.1| Mus musculus clone Bgal-Synd+.08b immunoglobulin ... 40 8.6
43gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 40 8.6
44gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 40 8.6
45gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 40 8.6
46dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 40 8.6

>gb|BT009268.1| Triticum aestivum clone wlk8.pk0002.f4:fis, full insert mRNA sequence
          Length = 1919

 Score =  942 bits (475), Expect = 0.0
 Identities = 587/623 (94%), Gaps = 1/623 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    gaaaatctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtg 61
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1120 gaaaatctcatgg-acacaggttgagacagggtcagcaatcacctggaagtacccaagtg 1178

                                                                        
Query: 62   tggagctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggatt 121
            ||||||| |||||||||||||| ||||||||||||||||| ||||| ||| | |||||||
Sbjct: 1179 tggagcttgttggggacgacactgttggagagttctactccgtagcactgcccaaggatt 1238

                                                                        
Query: 122  accagcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccgga 181
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 1239 accagcaggccgatacagggacaaagatgatccataaggggaagaattcacgcagccgga 1298

                                                                        
Query: 182  ttatatccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccaga 241
            |||||||||| |||||||| || || ||||||||||||||||||||||||||||||||||
Sbjct: 1299 ttatatccaaaggtatctcggcaggaaagtcaaggaattgctaccgtgggctggtccaga 1358

                                                                        
Query: 242  tgaattcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattgggg 301
            |||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||
Sbjct: 1359 tgaattcaggtgcagagaatgcttataattcttcgcagtgtgattcattgctgattgggg 1418

                                                                        
Query: 302  acaaggctgctgctaacacctatcccaccattcaggtgggttgtactagtggccgtgttg 361
            |||| ||||| || ||||||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 1419 acaacgctgccgccaacacctatccgaccattcaggtgggttgcactagtggccgtgttg 1478

                                                                        
Query: 362  agcatgaagcaagcacatccaaaattggagaggaccagctgttttactttcagcaaaggg 421
            ||||||| |||||||||||||||||||| ||||| ||||| || |||||||||||||| |
Sbjct: 1479 agcatgaggcaagcacatccaaaattggcgaggatcagctattctactttcagcaaagag 1538

                                                                        
Query: 422  ggatagatcatgaaaaggccgttgcagccatgatcggtggattctgtagggccgtctttg 481
            |||| ||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||
Sbjct: 1539 ggattgatcatgaaaaggccgttgcagccatgataggtgggttctgtagagccgtctttg 1598

                                                                        
Query: 482  aacaccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaagctggagg 541
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1599 aacaccttccttacgagtttgcccaggaggtggatgcactaatgaacctgaagctggagg 1658

                                                                        
Query: 542  gatcagttggctaagttcttggttcaacaagtatgtgaaatatcatccgataattatctg 601
            ||||||||||||||||| |||||||||||||| || ||||||||| ||||||||||||||
Sbjct: 1659 gatcagttggctaagttattggttcaacaagtctgcgaaatatcacccgataattatctg 1718

                                   
Query: 602  aaataccatacgatggtcatcta 624
            ||||||||||||||||| |||||
Sbjct: 1719 aaataccatacgatggttatcta 1741



to top

>ref|NM_190436.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1635

 Score =  543 bits (274), Expect = e-151
 Identities = 479/546 (87%), Gaps = 1/546 (0%)
 Strand = Plus / Plus

                                                                        
Query: 6    atctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtgtgga 65
            ||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1087 atctcatgg-acacaggttgagacaggttcagcaattacatggaagtacccaagtgtgga 1145

                                                                        
Query: 66   gctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggattacca 125
            |||  ||||||| || || ||||||||||||||||| || || ||||| |||||||||||
Sbjct: 1146 gcttcttggggatgatactgttggagagttctactcagttgcactgacgaaggattacca 1205

                                                                        
Query: 126  gcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccggattat 185
            |||||| || ||||||||||| |||||||||||||| |||||||| || || ||||||||
Sbjct: 1206 gcaggcagacacagggacaaaaatgatccacaagggaaagaattcgcggagtcggattat 1265

                                                                        
Query: 186  atccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccagatgaa 245
            |||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||| ||
Sbjct: 1266 atccaaaggtatctcagctgggaagtcacggaattgctaccgtgggttggtccagataaa 1325

                                                                        
Query: 246  ttcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattggggacaa 305
             ||||| ||||| ||||| ||||| ||||| ||||||||||| |||||||||||||| ||
Sbjct: 1326 ctcaggcgcagaaaatgcttataattcttcacagtgtgattctttgctgattggggataa 1385

                                                                        
Query: 306  ggctgctgctaacacctatcccaccattcaggtgggttgtactagtggccgtgttgagca 365
             |||||||| ||||||||||| || |||||||||||||| | |  | | |||||||||||
Sbjct: 1386 cgctgctgccaacacctatccgactattcaggtgggttgcatttctagtcgtgttgagca 1445

                                                                        
Query: 366  tgaagcaagcacatccaaaattggagaggaccagctgttttactttcagcaaagggggat 425
            ||| |||||||| || ||||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 1446 tgaggcaagcacttcaaaaataggggaggaccagctattttatttccaacaaagggggat 1505

                                                                        
Query: 426  agatcatgaaaaggccgttgcagccatgatcggtggattctgtagggccgtctttgaaca 485
            ||| ||||||||||| |||||||| ||||| ||||||||||| ||||| || || ||  |
Sbjct: 1506 agaccatgaaaaggctgttgcagcgatgattggtggattctgcagggctgttttcgagaa 1565

                                                                        
Query: 486  ccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaagctggagggatc 545
             ||||||||||||||||| || ||| ||||||||||||||||||||||||| ||||||||
Sbjct: 1566 tcttccttacgagtttgcacatgagatggatgcacttatgaacctgaagcttgagggatc 1625

                  
Query: 546  agttgg 551
            ||||||
Sbjct: 1626 agttgg 1631



to top

>dbj|AK121100.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069G03, full
            insert sequence
          Length = 1978

 Score =  543 bits (274), Expect = e-151
 Identities = 479/546 (87%), Gaps = 1/546 (0%)
 Strand = Plus / Plus

                                                                        
Query: 6    atctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtgtgga 65
            ||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1133 atctcatgg-acacaggttgagacaggttcagcaattacatggaagtacccaagtgtgga 1191

                                                                        
Query: 66   gctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggattacca 125
            |||  ||||||| || || ||||||||||||||||| || || ||||| |||||||||||
Sbjct: 1192 gcttcttggggatgatactgttggagagttctactcagttgcactgacgaaggattacca 1251

                                                                        
Query: 126  gcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccggattat 185
            |||||| || ||||||||||| |||||||||||||| |||||||| || || ||||||||
Sbjct: 1252 gcaggcagacacagggacaaaaatgatccacaagggaaagaattcgcggagtcggattat 1311

                                                                        
Query: 186  atccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccagatgaa 245
            |||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||| ||
Sbjct: 1312 atccaaaggtatctcagctgggaagtcacggaattgctaccgtgggttggtccagataaa 1371

                                                                        
Query: 246  ttcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattggggacaa 305
             ||||| ||||| ||||| ||||| ||||| ||||||||||| |||||||||||||| ||
Sbjct: 1372 ctcaggcgcagaaaatgcttataattcttcacagtgtgattctttgctgattggggataa 1431

                                                                        
Query: 306  ggctgctgctaacacctatcccaccattcaggtgggttgtactagtggccgtgttgagca 365
             |||||||| ||||||||||| || |||||||||||||| | |  | | |||||||||||
Sbjct: 1432 cgctgctgccaacacctatccgactattcaggtgggttgcatttctagtcgtgttgagca 1491

                                                                        
Query: 366  tgaagcaagcacatccaaaattggagaggaccagctgttttactttcagcaaagggggat 425
            ||| |||||||| || ||||| || ||||||||||| ||||| || || |||||||||||
Sbjct: 1492 tgaggcaagcacttcaaaaataggggaggaccagctattttatttccaacaaagggggat 1551

                                                                        
Query: 426  agatcatgaaaaggccgttgcagccatgatcggtggattctgtagggccgtctttgaaca 485
            ||| ||||||||||| |||||||| ||||| ||||||||||| ||||| || || ||  |
Sbjct: 1552 agaccatgaaaaggctgttgcagcgatgattggtggattctgcagggctgttttcgagaa 1611

                                                                        
Query: 486  ccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaagctggagggatc 545
             ||||||||||||||||| || ||| ||||||||||||||||||||||||| ||||||||
Sbjct: 1612 tcttccttacgagtttgcacatgagatggatgcacttatgaacctgaagcttgagggatc 1671

                  
Query: 546  agttgg 551
            ||||||
Sbjct: 1672 agttgg 1677



to top

>gb|AY103958.1| Zea mays PCO141591 mRNA sequence
          Length = 1691

 Score =  511 bits (258), Expect = e-142
 Identities = 478/550 (86%), Gaps = 1/550 (0%)
 Strand = Plus / Plus

                                                                        
Query: 6    atctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtgtgga 65
            ||||||||| ||||||||||||||||| || || || || |||||||||||||| || ||
Sbjct: 841  atctcatgg-acacaggttgagacaggatctgctattacatggaagtacccaagcgttga 899

                                                                        
Query: 66   gctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggattacca 125
            ||| || ||||| ||||  |||||||||||||||||||| ||||| || ||||||| |||
Sbjct: 900  gctcgtcggggatgacagtgttggagagttctactcggttgcgcttacaaaggattgcca 959

                                                                        
Query: 126  gcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccggattat 185
            ||| || || |||||||| || ||||||||||||||||| ||||||||||||||||||||
Sbjct: 960  gcaagcagacacagggacgaaaatgatccacaaggggaaaaattcacgcagccggattat 1019

                                                                        
Query: 186  atccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccagatgaa 245
            ||||||||| ||||| || ||||||||||||||||||||||||||  |||||| ||||||
Sbjct: 1020 atccaagggcatctctgcagggaagtcaaggaattgctaccgtggcttggtcctgatgaa 1079

                                                                        
Query: 246  ttcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattggggacaa 305
             ||  ||||||||||||| ||||| ||||| |||||||| |||||| |||| ||||| ||
Sbjct: 1080 ctctagtgcagagaatgcttataattcttcacagtgtgactcattgttgatcggggataa 1139

                                                                        
Query: 306  ggctgctgctaacacctatcccaccattcaggtgggttgtactagtggccgtgttgagca 365
             || ||||| |||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 1140 tgcggctgcgaacacctatcccaccattcaggtggggtgcactagtggccgggttgagca 1199

                                                                        
Query: 366  tgaagcaagcacatccaaaattggagaggaccagctgttttactttcagcaaagggggat 425
            ||| |||||||| ||||||||||||||||| ||||| ||||| || |||||||| ||| |
Sbjct: 1200 tgaggcaagcacttccaaaattggagaggatcagctattttatttccagcaaagaggggt 1259

                                                                        
Query: 426  agatcatgaaaaggccgttgcagccatgatcggtggattctgtagggccgtctttgaaca 485
            ||||||||||||||| ||||| |||||||| ||||||||||| ||  | || || || ||
Sbjct: 1260 agatcatgaaaaggcagttgccgccatgattggtggattctgcagatctgttttcgagca 1319

                                                                        
Query: 486  ccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaagctggagggatc 545
            |||||| || || || || ||||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 1320 ccttccctatgaattcgcacaggaggtggacgcactcatgaacctgaaactcgagggatc 1379

                      
Query: 546  agttggctaa 555
            ||||||||||
Sbjct: 1380 agttggctaa 1389



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  359 bits (181), Expect = 7e-96
 Identities = 296/333 (88%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                            
Query: 6        atctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtgtgga 65
                ||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 35500648 atctcatgg-acacaggttgagacaggttcagcaattacatggaagtacccaagtgtgga 35500590

                                                                            
Query: 66       gctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggattacca 125
                |||  ||||||| || || ||||||||||||||||| || || ||||| |||||||||||
Sbjct: 35500589 gcttcttggggatgatactgttggagagttctactcagttgcactgacgaaggattacca 35500530

                                                                            
Query: 126      gcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccggattat 185
                |||||| || ||||||||||| |||||||||||||| |||||||| || || ||||||||
Sbjct: 35500529 gcaggcagacacagggacaaaaatgatccacaagggaaagaattcgcggagtcggattat 35500470

                                                                            
Query: 186      atccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccagatgaa 245
                |||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||| ||
Sbjct: 35500469 atccaaaggtatctcagctgggaagtcacggaattgctaccgtgggttggtccagataaa 35500410

                                                                            
Query: 246      ttcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattggggacaa 305
                 ||||| ||||| ||||| ||||| ||||| ||||||||||| |||||||||||||| ||
Sbjct: 35500409 ctcaggcgcagaaaatgcttataattcttcacagtgtgattctttgctgattggggataa 35500350

                                                 
Query: 306      ggctgctgctaacacctatcccaccattcaggt 338
                 |||||||| ||||||||||| || ||||||||
Sbjct: 35500349 cgctgctgccaacacctatccgactattcaggt 35500317



 Score =  200 bits (101), Expect = 4e-48
 Identities = 173/197 (87%)
 Strand = Plus / Minus

                                                                            
Query: 355      cgtgttgagcatgaagcaagcacatccaaaattggagaggaccagctgttttactttcag 414
                |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 35499269 cgtgttgagcatgaggcaagcacttcaaaaataggggaggaccagctattttatttccaa 35499210

                                                                            
Query: 415      caaagggggatagatcatgaaaaggccgttgcagccatgatcggtggattctgtagggcc 474
                |||||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 35499209 caaagggggatagaccatgaaaaggctgttgcagcgatgattggtggattctgcagggct 35499150

                                                                            
Query: 475      gtctttgaacaccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaag 534
                || || ||  | ||||||||||||||||| || ||| |||||||||||||||||||||||
Sbjct: 35499149 gttttcgagaatcttccttacgagtttgcacatgagatggatgcacttatgaacctgaag 35499090

                                 
Query: 535      ctggagggatcagttgg 551
                || ||||||||||||||
Sbjct: 35499089 cttgagggatcagttgg 35499073



to top

>dbj|AP003252.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0446G04
          Length = 143515

 Score =  359 bits (181), Expect = 7e-96
 Identities = 296/333 (88%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                         
Query: 6     atctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtgtgga 65
             ||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 30835 atctcatgg-acacaggttgagacaggttcagcaattacatggaagtacccaagtgtgga 30777

                                                                         
Query: 66    gctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggattacca 125
             |||  ||||||| || || ||||||||||||||||| || || ||||| |||||||||||
Sbjct: 30776 gcttcttggggatgatactgttggagagttctactcagttgcactgacgaaggattacca 30717

                                                                         
Query: 126   gcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccggattat 185
             |||||| || ||||||||||| |||||||||||||| |||||||| || || ||||||||
Sbjct: 30716 gcaggcagacacagggacaaaaatgatccacaagggaaagaattcgcggagtcggattat 30657

                                                                         
Query: 186   atccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccagatgaa 245
             |||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||| ||
Sbjct: 30656 atccaaaggtatctcagctgggaagtcacggaattgctaccgtgggttggtccagataaa 30597

                                                                         
Query: 246   ttcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattggggacaa 305
              ||||| ||||| ||||| ||||| ||||| ||||||||||| |||||||||||||| ||
Sbjct: 30596 ctcaggcgcagaaaatgcttataattcttcacagtgtgattctttgctgattggggataa 30537

                                              
Query: 306   ggctgctgctaacacctatcccaccattcaggt 338
              |||||||| ||||||||||| || ||||||||
Sbjct: 30536 cgctgctgccaacacctatccgactattcaggt 30504



 Score =  200 bits (101), Expect = 4e-48
 Identities = 173/197 (87%)
 Strand = Plus / Minus

                                                                         
Query: 355   cgtgttgagcatgaagcaagcacatccaaaattggagaggaccagctgttttactttcag 414
             |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 29456 cgtgttgagcatgaggcaagcacttcaaaaataggggaggaccagctattttatttccaa 29397

                                                                         
Query: 415   caaagggggatagatcatgaaaaggccgttgcagccatgatcggtggattctgtagggcc 474
             |||||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 29396 caaagggggatagaccatgaaaaggctgttgcagcgatgattggtggattctgcagggct 29337

                                                                         
Query: 475   gtctttgaacaccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaag 534
             || || ||  | ||||||||||||||||| || ||| |||||||||||||||||||||||
Sbjct: 29336 gttttcgagaatcttccttacgagtttgcacatgagatggatgcacttatgaacctgaag 29277

                              
Query: 535   ctggagggatcagttgg 551
             || ||||||||||||||
Sbjct: 29276 cttgagggatcagttgg 29260



to top

>dbj|AP003734.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1088C09
          Length = 154084

 Score =  359 bits (181), Expect = 7e-96
 Identities = 296/333 (88%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                          
Query: 6      atctcatggnacacaggttgagacagggtcagcaatcacctggaagtacccaagtgtgga 65
              ||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 124597 atctcatgg-acacaggttgagacaggttcagcaattacatggaagtacccaagtgtgga 124539

                                                                          
Query: 66     gctggttggggacgacaccgttggagagttctactcggtagcgctgactaaggattacca 125
              |||  ||||||| || || ||||||||||||||||| || || ||||| |||||||||||
Sbjct: 124538 gcttcttggggatgatactgttggagagttctactcagttgcactgacgaaggattacca 124479

                                                                          
Query: 126    gcaggccgatacagggacaaagatgatccacaaggggaagaattcacgcagccggattat 185
              |||||| || ||||||||||| |||||||||||||| |||||||| || || ||||||||
Sbjct: 124478 gcaggcagacacagggacaaaaatgatccacaagggaaagaattcgcggagtcggattat 124419

                                                                          
Query: 186    atccaagggtatctcagcggggaagtcaaggaattgctaccgtgggctggtccagatgaa 245
              |||||| ||||||||||| ||||||||| ||||||||||||||||| |||||||||| ||
Sbjct: 124418 atccaaaggtatctcagctgggaagtcacggaattgctaccgtgggttggtccagataaa 124359

                                                                          
Query: 246    ttcaggtgcagagaatgcgtataactcttctcagtgtgattcattgctgattggggacaa 305
               ||||| ||||| ||||| ||||| ||||| ||||||||||| |||||||||||||| ||
Sbjct: 124358 ctcaggcgcagaaaatgcttataattcttcacagtgtgattctttgctgattggggataa 124299

                                               
Query: 306    ggctgctgctaacacctatcccaccattcaggt 338
               |||||||| ||||||||||| || ||||||||
Sbjct: 124298 cgctgctgccaacacctatccgactattcaggt 124266



 Score =  200 bits (101), Expect = 4e-48
 Identities = 173/197 (87%)
 Strand = Plus / Minus

                                                                          
Query: 355    cgtgttgagcatgaagcaagcacatccaaaattggagaggaccagctgttttactttcag 414
              |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 123218 cgtgttgagcatgaggcaagcacttcaaaaataggggaggaccagctattttatttccaa 123159

                                                                          
Query: 415    caaagggggatagatcatgaaaaggccgttgcagccatgatcggtggattctgtagggcc 474
              |||||||||||||| ||||||||||| |||||||| ||||| ||||||||||| ||||| 
Sbjct: 123158 caaagggggatagaccatgaaaaggctgttgcagcgatgattggtggattctgcagggct 123099

                                                                          
Query: 475    gtctttgaacaccttccttacgagtttgcccaggaggtggatgcacttatgaacctgaag 534
              || || ||  | ||||||||||||||||| || ||| |||||||||||||||||||||||
Sbjct: 123098 gttttcgagaatcttccttacgagtttgcacatgagatggatgcacttatgaacctgaag 123039

                               
Query: 535    ctggagggatcagttgg 551
              || ||||||||||||||
Sbjct: 123038 cttgagggatcagttgg 123022



to top

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                           
Query: 91      gagttctactcggtagcgctgactaaggattaccagcaggccgatacagggacaaagatg 150
               |||||||||||||| ||| |||| ||  ||||||||||||||||||| || || ||||||
Sbjct: 2581244 gagttctactcggttgcggtgaccaacaattaccagcaggccgataccggcaccaagatg 2581185

                       
Query: 151     atccacaa 158
               ||||||||
Sbjct: 2581184 atccacaa 2581177



to top

>gb|AY943856.1| Nicotiana benthamiana non-intrinsic ABC protein mRNA, partial cds
          Length = 1638

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                        
Query: 85   gttggagagttctactcggtagcgctgactaaggattaccagcaggccgatacagggaca 144
            ||||| || ||||| || || ||| |||||||  |||| |||||||| ||||||||||||
Sbjct: 1171 gttggtgaattctattctgtggcgttgactaataattatcagcaggcggatacagggaca 1230

                                    
Query: 145  aagatgatccacaaggggaagaat 168
            |||||||| ||||| |||||||||
Sbjct: 1231 aagatgatacacaaagggaagaat 1254



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 112/138 (81%)
 Strand = Plus / Plus

                                                                           
Query: 19      caggttgagacagggtcagcaatcacctggaagtacccaagtgtggagctggttggggac 78
               ||||| ||||| || || || ||||||||||||||||| || |||   |||   ||||||
Sbjct: 4501542 caggtggagaccggctcggccatcacctggaagtaccccagcgtgatcctgcagggggac 4501601

                                                                           
Query: 79      gacaccgttggagagttctactcggtagcgctgactaaggattaccagcaggccgataca 138
                || |||| || |||||||||||||| |||||||| ||  | |||||||||||||| || 
Sbjct: 4501602 aacgccgtgggcgagttctactcggtggcgctgaccaaccactaccagcaggccgacacc 4501661

                                 
Query: 139     gggacaaagatgatccac 156
               || || ||||||||||||
Sbjct: 4501662 ggcaccaagatgatccac 4501679



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                           
Query: 91      gagttctactcggtagcgctgactaaggattaccagcaggccgatacagggacaaagatg 150
               |||||||| ||||| ||||| || ||  | ||||||||||||||||| || || ||||||
Sbjct: 1466666 gagttctattcggtggcgctcaccaacaactaccagcaggccgataccggcactaagatg 1466725

                      
Query: 151     atccaca 157
               |||||||
Sbjct: 1466726 atccaca 1466732



to top

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                
Query: 124     cagcaggccgatacagggacaaagatgatccac 156
               |||||||||||||| || |||||||||||||||
Sbjct: 1833478 cagcaggccgataccggcacaaagatgatccac 1833510



to top

>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                           
Query: 355     cgtgttgagcatgaagcaagcacatccaaaattggagaggacca 398
               ||||||||||| |||||||  || || |||||||||||||||||
Sbjct: 1309740 cgtgttgagcacgaagcaactacctctaaaattggagaggacca 1309697



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 48.1 bits (24), Expect = 0.035
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                   
Query: 122     accagcaggccgatacagggacaaagatgatccaca 157
               |||||||||||||||| || || |||||||||||||
Sbjct: 2001080 accagcaggccgataccggcaccaagatgatccaca 2001115



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 123     ccagcaggccgatacagggacaaagatgatccaca 157
               ||||||||||||||| || || |||||||||||||
Sbjct: 1038567 ccagcaggccgataccggcaccaagatgatccaca 1038533



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                          
Query: 85     gttggagagttctactcggtagcgctgactaaggattaccagcaggccgatacagggaca 144
              ||||| |||||||| ||||| ||| |||| ||  || | |||||||||||||| || || 
Sbjct: 116029 gttggcgagttctattcggttgcggtgaccaacaatcatcagcaggccgatacgggcacg 115970

                         
Query: 145    aagatgatcca 155
              |||||||||||
Sbjct: 115969 aagatgatcca 115959



to top

>ref|NM_116715.3| Arabidopsis thaliana ATABC1 AT4G04770 (ATABC1) mRNA, complete cds
          Length = 1937

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 19   caggttgagacagggtcagcaatcacctggaagtaccc 56
            ||||||||||||||||| || || || |||||||||||
Sbjct: 1203 caggttgagacagggtctgcgataacttggaagtaccc 1240



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 124  cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
            ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 1308 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 1352



to top

>gb|AC140245.3| Mus musculus BAC clone RP23-293J3 from chromosome 18, complete sequence
          Length = 195082

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 509   aggtggatgcacttatgaacct 530
             ||||||||||||||||||||||
Sbjct: 95093 aggtggatgcacttatgaacct 95114



to top

>emb|AL161501.2|ATCHRIV13 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 13
          Length = 200001

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 19     caggttgagacagggtcagcaatcacctggaagtaccc 56
              ||||||||||||||||| || || || |||||||||||
Sbjct: 155664 caggttgagacagggtctgcgataacttggaagtaccc 155627



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                           
Query: 124    cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
              ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 155559 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 155515



to top

>gb|AY142069.1| Arabidopsis thaliana At4g04770/T4B21_16 mRNA, complete cds
          Length = 1674

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 19   caggttgagacagggtcagcaatcacctggaagtaccc 56
            ||||||||||||||||| || || || |||||||||||
Sbjct: 1138 caggttgagacagggtctgcgataacttggaagtaccc 1175



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 124  cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
            ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 1243 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 1287



to top

>gb|AF329697.1| Xanthomonas oryzae pv. oryzae insertion sequence IS1051-X and
            insertion sequence IS1389-X, complete sequence
          Length = 17229

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 124  cagcaggccgatacagggacaaagatgatccaca 157
            |||||||||||||| || || |||||||||||||
Sbjct: 4549 cagcaggccgataccggcaccaagatgatccaca 4582



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 124     cagcaggccgatacagggacaaagatgatccaca 157
               |||||||||||||| || || |||||||||||||
Sbjct: 1413561 cagcaggccgataccggcaccaagatgatccaca 1413528



to top

>gb|AE012389.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 297
            of 460 of the complete genome
          Length = 13391

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 124  cagcaggccgatacagggacaaagatgatccaca 157
            |||||||||||||| || || |||||||||||||
Sbjct: 9395 cagcaggccgataccggcaccaagatgatccaca 9428



to top

>gb|AY056410.1| Arabidopsis thaliana AT4g04770/T4B21_16 mRNA, complete cds
          Length = 1842

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 19   caggttgagacagggtcagcaatcacctggaagtaccc 56
            ||||||||||||||||| || || || |||||||||||
Sbjct: 1142 caggttgagacagggtctgcgataacttggaagtaccc 1179



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 124  cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
            ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 1247 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 1291



to top

>gb|AY052195.1| Arabidopsis thaliana AT4g04770/T4B21_16 mRNA, complete cds
          Length = 1904

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 19   caggttgagacagggtcagcaatcacctggaagtaccc 56
            ||||||||||||||||| || || || |||||||||||
Sbjct: 1205 caggttgagacagggtctgcgataacttggaagtaccc 1242



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 124  cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
            ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 1310 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 1354



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 124     cagcaggccgatacagggacaaagatgatccaca 157
               |||||||||||||| || || |||||||||||||
Sbjct: 1634197 cagcaggccgataccggcaccaagatgatccaca 1634164



to top

>tpg|BK001497.1| TPA: TPA_exp: Arabidopsis thaliana putative ABC transporter 1 mRNA,
            complete cds; nuclear gene for plastid product
          Length = 1674

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 19   caggttgagacagggtcagcaatcacctggaagtaccc 56
            ||||||||||||||||| || || || |||||||||||
Sbjct: 1138 caggttgagacagggtctgcgataacttggaagtaccc 1175



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 124  cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
            ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 1243 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 1287



to top

>emb|BX827675.1|CNS0A3OT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS9ZB06 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1812

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 19   caggttgagacagggtcagcaatcacctggaagtaccc 56
            ||||||||||||||||| || || || |||||||||||
Sbjct: 1201 caggttgagacagggtctgcgataacttggaagtaccc 1238



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 124  cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
            ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 1307 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 1351



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                           
Query: 83      ccgttggagagttctactcggtagcgctgactaaggattaccagcaggccgatacaggga 142
               ||||||| || || |||||||| |||||||| ||  ||   ||||| |||||||| ||||
Sbjct: 2992656 ccgttggtgaattttactcggtggcgctgacaaataatatgcagcaagccgataccggga 2992715

                         
Query: 143     caaagatgat 152
               ||||||||||
Sbjct: 2992716 caaagatgat 2992725



to top

>gb|AF118223.2|T4B21 Arabidopsis thaliana BAC T4B21
          Length = 91470

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 19    caggttgagacagggtcagcaatcacctggaagtaccc 56
             ||||||||||||||||| || || || |||||||||||
Sbjct: 43986 caggttgagacagggtctgcgataacttggaagtaccc 43949



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                          
Query: 124   cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
             ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 43881 cagcaagctgatacagggactaagatgattcacaaaggaaagaat 43837



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 124     cagcaggccgatacagggacaaagatgatccaca 157
               |||||||||||||| || || |||||||||||||
Sbjct: 1439215 cagcaggccgataccggcaccaagatgatccaca 1439182



to top

>gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete genome
          Length = 1709204

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 359   ttgagcatgaagcaagcacat 379
             |||||||||||||||||||||
Sbjct: 79572 ttgagcatgaagcaagcacat 79552



to top

>emb|BX537928.1|HSM806046 Homo sapiens genomic DNA; cDNA DKFZp686C2092 (from clone
           DKFZp686C2092)
          Length = 4427

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 416 aaagggggatagatcatgaaa 436
           |||||||||||||||||||||
Sbjct: 710 aaagggggatagatcatgaaa 690



to top

>gb|AC092421.2| Homo sapiens chromosome 3 clone RP11-476A24, complete sequence
          Length = 160726

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 567   aacaagtatgtgaaatatcat 587
             |||||||||||||||||||||
Sbjct: 30130 aacaagtatgtgaaatatcat 30150



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 123     ccagcaggccgatacagggacaaagatgatcca 155
               ||||||||||||||| || || |||||||||||
Sbjct: 2992651 ccagcaggccgataccggcaccaagatgatcca 2992619



to top

>emb|BX827948.1|CNS0A3VL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZA11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 678

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 124 cagcaggccgatacagggacaaagatgatccacaaggggaagaat 168
           ||||| || ||||||||||| |||||||| ||||| || ||||||
Sbjct: 51  cagcaagctgatacagggactaagatgattcacaaaggaaagaat 95



to top

>gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete genome
          Length = 1308759

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 359    ttgagcatgaagcaagcacatccaaaatt 387
              |||||||||||||||  ||||||||||||
Sbjct: 724233 ttgagcatgaagcaacaacatccaaaatt 724261



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 124     cagcaggccgatacagggacaaagatgatcca 155
               |||||||||||||| || || |||||||||||
Sbjct: 2150046 cagcaggccgataccggcaccaagatgatcca 2150015



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 124     cagcaggccgatacagggacaaagatgatcca 155
               |||||||||||||| || || |||||||||||
Sbjct: 2172127 cagcaggccgataccggcaccaagatgatcca 2172096



to top

>gb|AC182692.2| Populus trichocarpa clone Pop1-44B2, complete sequence
          Length = 105327

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 362   agcatgaagcaagcacatccaaaa 385
             |||||||| |||||||||||||||
Sbjct: 16261 agcatgaaacaagcacatccaaaa 16284



to top

>gb|AF490364.1| Ceratium horridum extrachromosomal minicircle putative ABC
           transporter membrane protein Ycf24 (ycf24) gene, partial
           cds; and putative ATP-dependent transporter Ycf16
           (ycf16) gene, complete cds
          Length = 1954

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 33/36 (91%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 3   aaaatctcatggnacacaggttgagacagggtcagc 38
           ||||| |||||| ||||||||||||||||| |||||
Sbjct: 565 aaaatttcatgg-acacaggttgagacaggttcagc 599



to top

>gb|DQ277922.1| Mus musculus clone Bgal-Synd+.08b immunoglobulin lambda1 light
           chain variable region gene, partial cds
          Length = 279

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 292 ctgattggggacaaggctgc 311
           ||||||||||||||||||||
Sbjct: 193 ctgattggggacaaggctgc 212



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 121     taccagcaggccgatacagggacaaagatgat 152
               ||||||||||||||||| || || ||||||||
Sbjct: 1473544 taccagcaggccgataccggcaccaagatgat 1473513



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 121     taccagcaggccgatacagggacaaagatgat 152
               ||||||||||||||||| || || ||||||||
Sbjct: 2210667 taccagcaggccgataccggcaccaagatgat 2210698



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 127    caggccgatacagggacaaagatgatccacaa 158
              ||||||||||| || || ||||||||||||||
Sbjct: 202839 caggccgataccggcaccaagatgatccacaa 202870



to top

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 81      caccgttggagagttctact 100
               ||||||||||||||||||||
Sbjct: 1535225 caccgttggagagttctact 1535244


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,229,028
Number of Sequences: 3902068
Number of extensions: 5229028
Number of successful extensions: 93727
Number of sequences better than 10.0: 46
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 93316
Number of HSP's gapped (non-prelim): 409
length of query: 630
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 607
effective length of database: 17,143,297,704
effective search space: 10405981706328
effective search space used: 10405981706328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top