ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal20i22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL953874.2| Human DNA sequence from clone CTD-2267G17 on chr... 42 0.34
2gb|AC150310.1| Latimeria menadoensis clone VMRC4-40C18, complete... 40 1.3
3gb|AC011013.17|AC011013 Mus musculus chromosome 11, clone RP23-2... 40 1.3
4emb|AL592489.13| Mouse DNA sequence from clone RP23-226J16 on ch... 40 1.3
5gb|AC107772.19| Mus musculus chromosome 15, clone RP23-102L5, co... 38 5.3
6gb|AC112330.5| Rattus norvegicus 15 BAC CH230-185E8 (Children's ... 38 5.3
7gb|AC118414.9| Rattus norvegicus 3 BAC CH230-223K21 (Children's ... 38 5.3
8gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 38 5.3
9emb|AL591400.8| Human DNA sequence from clone RP11-65C6 on chrom... 38 5.3
10dbj|AB199308.1| Pongo pygmaeus Popy-T2R68* pseudogene for bitter... 38 5.3
11ref|NM_001003529.1| Danio rerio zgc:100863 (zgc:100863), mRNA 38 5.3
12gb|BC078293.1| Danio rerio zgc:100863, mRNA (cDNA clone MGC:1008... 38 5.3
13gb|AY724981.1| Pongo pygmaeus chromosome 12 taste receptor Ps6 p... 38 5.3
14gb|AY724968.2| Pongo pygmaeus chromosome 12 taste receptor Ps7 p... 38 5.3
15emb|AL133500.4|HSP12 Homo sapiens chromosome X sequence from BA... 38 5.3
16emb|AL596457.6| Human DNA sequence from clone RP11-523P2 on chro... 38 5.3

>emb|AL953874.2| Human DNA sequence from clone CTD-2267G17 on chromosome X Contains the
             GAGED3 gene for family D G antigen 3, a GAGE family
             pseudogene and the 5' end of a pseudogene similar to part
             of family D G antigen 2 (GAGED2), complete sequence
          Length = 94514

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 64    agtggttcagggccagctggg 84
             |||||||||||||||||||||
Sbjct: 29644 agtggttcagggccagctggg 29664



to top

>gb|AC150310.1| Latimeria menadoensis clone VMRC4-40C18, complete sequence
          Length = 170774

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    caactcagtggttcagggcc 77
             ||||||||||||||||||||
Sbjct: 71439 caactcagtggttcagggcc 71420



to top

>gb|AC011013.17|AC011013 Mus musculus chromosome 11, clone RP23-218N2, complete sequence
          Length = 201728

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     gttcagggccagctgggttt 87
              ||||||||||||||||||||
Sbjct: 152836 gttcagggccagctgggttt 152855



to top

>emb|AL592489.13| Mouse DNA sequence from clone RP23-226J16 on chromosome 11, complete
              sequence
          Length = 155262

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     gttcagggccagctgggttt 87
              ||||||||||||||||||||
Sbjct: 144246 gttcagggccagctgggttt 144265



to top

>gb|AC107772.19| Mus musculus chromosome 15, clone RP23-102L5, complete sequence
          Length = 194704

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 69     ttcagggccagctgggttt 87
              |||||||||||||||||||
Sbjct: 124682 ttcagggccagctgggttt 124664



to top

>gb|AC112330.5| Rattus norvegicus 15 BAC CH230-185E8 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 158526

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 34    catggagctgcaacatctg 52
             |||||||||||||||||||
Sbjct: 87254 catggagctgcaacatctg 87272



to top

>gb|AC118414.9| Rattus norvegicus 3 BAC CH230-223K21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 217330

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    tggttcagggccagctggg 84
             |||||||||||||||||||
Sbjct: 46723 tggttcagggccagctggg 46741



to top

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 75      gccagctgggtttcagtga 93
               |||||||||||||||||||
Sbjct: 1441448 gccagctgggtttcagtga 1441466



to top

>emb|AL591400.8| Human DNA sequence from clone RP11-65C6 on chromosome 6 Contains 40s
             ribosomal protein S3a (v-fos transformation effector
             protein 1) (RPS3A)(FTE1) pseudogene, complete sequence
          Length = 101739

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    catctgcacaacaactcag 65
             |||||||||||||||||||
Sbjct: 61618 catctgcacaacaactcag 61636



to top

>dbj|AB199308.1| Pongo pygmaeus Popy-T2R68* pseudogene for bitter taste receptor
           T2R68
          Length = 825

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 33  ccatggagctgcaacatct 51
           |||||||||||||||||||
Sbjct: 600 ccatggagctgcaacatct 582



to top

>ref|NM_001003529.1| Danio rerio zgc:100863 (zgc:100863), mRNA
          Length = 2615

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 21  gtgctctcttccccatgga 39
           |||||||||||||||||||
Sbjct: 914 gtgctctcttccccatgga 896



to top

>gb|BC078293.1| Danio rerio zgc:100863, mRNA (cDNA clone MGC:100863 IMAGE:7140594),
           complete cds
          Length = 2615

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 21  gtgctctcttccccatgga 39
           |||||||||||||||||||
Sbjct: 914 gtgctctcttccccatgga 896



to top

>gb|AY724981.1| Pongo pygmaeus chromosome 12 taste receptor Ps6 pseudogene,
           complete sequence
          Length = 929

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 33  ccatggagctgcaacatct 51
           |||||||||||||||||||
Sbjct: 637 ccatggagctgcaacatct 619



to top

>gb|AY724968.2| Pongo pygmaeus chromosome 12 taste receptor Ps7 pseudogene,
           complete sequence
          Length = 946

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 33  ccatggagctgcaacatct 51
           |||||||||||||||||||
Sbjct: 310 ccatggagctgcaacatct 328



to top

>emb|AL133500.4|HSP12 Homo sapiens  chromosome X sequence from BAC CEPHB328P12 map Xq13
             region PHKA1-DXS227, complete sequence
          Length = 201387

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    ctgggtttcagtgatgtag 98
             |||||||||||||||||||
Sbjct: 80194 ctgggtttcagtgatgtag 80212



to top

>emb|AL596457.6| Human DNA sequence from clone RP11-523P2 on chromosome Xq13.1-13.3,
             complete sequence
          Length = 86688

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    ctgggtttcagtgatgtag 98
             |||||||||||||||||||
Sbjct: 36291 ctgggtttcagtgatgtag 36273


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 951,333
Number of Sequences: 3902068
Number of extensions: 951333
Number of successful extensions: 71927
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71869
Number of HSP's gapped (non-prelim): 58
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top