ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal20a13 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) mRNA, complete cds Length = 859 Score = 151 bits (76), Expect = 8e-34 Identities = 96/103 (93%) Strand = Plus / Plus Query: 60 cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 119 ||||||||||||||| |||||||||||||||| |||||||||||||||||| || ||||| Sbjct: 44 cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 103 Query: 120 cgccccggccggccgcatcgtgatggagctgtncaaggacgcg 162 ||| |||||||| ||||||||||||||||||| |||||||||| Sbjct: 104 cgcgccggccgggcgcatcgtgatggagctgtacaaggacgcg 146
>gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) mRNA, complete cds Length = 869 Score = 143 bits (72), Expect = 2e-31 Identities = 95/103 (92%) Strand = Plus / Plus Query: 60 cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 119 ||||||||||||||| |||||||||||||||| |||||||||||||||||| || ||||| Sbjct: 52 cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 111 Query: 120 cgccccggccggccgcatcgtgatggagctgtncaaggacgcg 162 ||| ||||| || ||||||||||||||||||| |||||||||| Sbjct: 112 cgcgccggcggggcgcatcgtgatggagctgtacaaggacgcg 154
>gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) mRNA, complete cds Length = 845 Score = 127 bits (64), Expect = 1e-26 Identities = 81/87 (93%) Strand = Plus / Plus Query: 76 gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 135 |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| ||| Sbjct: 68 gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 127 Query: 136 atcgtgatggagctgtncaaggacgcg 162 |||||||||||||||| |||||||||| Sbjct: 128 atcgtgatggagctgtacaaggacgcg 154
>gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, complete cds Length = 781 Score = 127 bits (64), Expect = 1e-26 Identities = 81/87 (93%) Strand = Plus / Plus Query: 76 gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 135 |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| ||| Sbjct: 32 gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 91 Query: 136 atcgtgatggagctgtncaaggacgcg 162 |||||||||||||||| |||||||||| Sbjct: 92 atcgtgatggagctgtacaaggacgcg 118
>gb|BT016412.1| Zea mays clone Contig245 mRNA sequence Length = 858 Score = 77.8 bits (39), Expect = 9e-12 Identities = 51/55 (92%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||| || |||||||||||||| ||||| |||||||||||||||| Sbjct: 82 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgt 136
>gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds Length = 681 Score = 77.8 bits (39), Expect = 9e-12 Identities = 60/67 (89%) Strand = Plus / Plus Query: 85 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 144 |||||||| ||||||||||||||| || | ||||| || ||||| ||||||||||||||| Sbjct: 54 aacccgaaagtgttcttcgacatgtcgatcggcggggctccggcgggccgcatcgtgatg 113 Query: 145 gagctgt 151 ||||||| Sbjct: 114 gagctgt 120
>emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin Length = 2598 Score = 77.8 bits (39), Expect = 9e-12 Identities = 51/55 (92%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||| || |||||||||||||| ||||| |||||||||||||||| Sbjct: 1080 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgt 1134
>gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds Length = 792 Score = 77.8 bits (39), Expect = 9e-12 Identities = 51/55 (92%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||| || |||||||||||||| ||||| |||||||||||||||| Sbjct: 43 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgt 97
>gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence Length = 978 Score = 69.9 bits (35), Expect = 2e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||| || ||||| ||||| |||||||| |||||||||||||||| Sbjct: 183 ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagctgt 237
>emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclosporin A-binding protein, (pPA0005 gene) Length = 1026 Score = 65.9 bits (33), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Plus Query: 85 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 144 ||||| ||||| ||||| |||||| ||| ||||||||||| |||||||| ||||||||| Sbjct: 108 aacccaaaggttttctttgacatgcaggtcggcggcgccccagccggccggatcgtgatg 167 Query: 145 gagct 149 ||||| Sbjct: 168 gagct 172
>gb|BT016413.1| Zea mays clone Contig246 mRNA sequence Length = 868 Score = 63.9 bits (32), Expect = 1e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagc 148 |||||||||||||| || ||||| ||||| |||||||| ||||||||||||| Sbjct: 67 ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagc 118
>ref|XM_463914.1| Oryza sativa (japonica cultivar-group), mRNA Length = 885 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 166
>ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBb0088N06.23 mRNA Length = 887 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 167
>gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence Length = 905 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 167
>gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA mRNA, complete cds Length = 588 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 25 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 83
>emb|AJ245940.1|RCO245940 Ricinus communis mRNA for cyclophilin (cyp1 gene) Length = 679 Score = 61.9 bits (31), Expect = 5e-07 Identities = 58/67 (86%) Strand = Plus / Plus Query: 85 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 144 ||||| ||||| ||||| |||||||| || ||||| || ||||| |||||||| |||||| Sbjct: 10 aaccctaaggtcttctttgacatgactgtcggcggtgctccggcgggccgcatagtgatg 69 Query: 145 gagctgt 151 ||||||| Sbjct: 70 gagctgt 76
>dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-G07, full insert sequence Length = 887 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 167
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 1116174 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 1116232 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 26646274 cgatcccgatcccgatccc 26646256
>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1020_C02 Length = 124578 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 68698 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 68756
>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0088N06 Length = 123454 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 104882 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 104940
>dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N03, full insert sequence Length = 885 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 166
>gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, complete cds Length = 824 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 53 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 111
>gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, complete cds Length = 2323 Score = 61.9 bits (31), Expect = 5e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 93 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgt 151 |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||| Sbjct: 1164 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgt 1222
>gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complete cds Length = 760 Score = 58.0 bits (29), Expect = 8e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 149 |||||||||||||| || ||||| | ||||||||||| |||||||||||||| Sbjct: 75 ttcttcgacatgaccgtcggcggatcaccggccggccgaatcgtgatggagct 127
>gb|AY229877.1| Populus tremuloides cyclophilin mRNA, complete cds Length = 709 Score = 58.0 bits (29), Expect = 8e-06 Identities = 35/37 (94%) Strand = Plus / Plus Query: 115 ggcggcgccccggccggccgcatcgtgatggagctgt 151 ||||||||||| |||||||| |||||||||||||||| Sbjct: 63 ggcggcgccccagccggccggatcgtgatggagctgt 99
>gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, complete cds Length = 1080 Score = 50.1 bits (25), Expect = 0.002 Identities = 55/65 (84%) Strand = Plus / Plus Query: 85 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 144 ||||| ||||| ||||| || ||| ||| ||||| ||||| |||||||| ||||||||| Sbjct: 88 aacccaaaggttttctttgatatgcaggtcggcggtgccccagccggccggatcgtgatg 147 Query: 145 gagct 149 ||||| Sbjct: 148 gagct 152
>gb|AY652862.1| Populus balsamifera subsp. trichocarpa peptidyl-prolyl cis-trans isomerase (CYC063) gene, complete cds Length = 519 Score = 50.1 bits (25), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Plus Query: 115 ggcggcgccccggccggccgcatcgtgatggagctgt 151 ||||||| |||||||||||| |||||||| ||||||| Sbjct: 37 ggcggcgtcccggccggccggatcgtgattgagctgt 73
>ref|NM_205373.1| Gallus gallus sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D (SEMA3D), mRNA Length = 2715 Score = 48.1 bits (24), Expect = 0.008 Identities = 24/24 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccggc 71 |||||||||||||||||||||||| Sbjct: 13 cccgatcccgatcccgatcccggc 36
>gb|U28240.1|GGU28240 Gallus gallus collapsin-2 mRNA, complete cds Length = 2715 Score = 48.1 bits (24), Expect = 0.008 Identities = 24/24 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccggc 71 |||||||||||||||||||||||| Sbjct: 13 cccgatcccgatcccgatcccggc 36
>gb|DQ215080.1| Taeniopygia guttata clone 0058P0004D09 CLE7 protein-like mRNA, complete sequence Length = 1047 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 23 cccgatcccgatcccgatcccgg 1 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 53 cccgatcccgatcccgatcccg 32 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 47 cccgatcccgatcccgatcccg 26 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 41 cccgatcccgatcccgatcccg 20 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 35 cccgatcccgatcccgatcccg 14 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 29 cccgatcccgatcccgatcccg 8 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 58 ccgatcccgatcccgatcccg 38
>ref|XM_422376.1| PREDICTED: Gallus gallus similar to RNA processing factor 1 (LOC424539), mRNA Length = 2081 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 740 cccgatcccgatcccgatcccgg 718
>ref|XM_854702.1| PREDICTED: Canis familiaris similar to protein phosphatase 1, regulatory (inhibitor) subunit 11 isoform 1, transcript variant 2 (LOC608919), mRNA Length = 1688 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 46 cccgatcccgatcccgatcccgg 68 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 41 ccgatcccgatcccgatcccg 61 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||| |||||| Sbjct: 52 cccgatcccgatcccggtcccgg 74
>ref|XM_844699.1| PREDICTED: Canis familiaris similar to protein phosphatase 1, regulatory (inhibitor) subunit 11 isoform 1, transcript variant 1 (LOC608919), mRNA Length = 1599 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 87 cccgatcccgatcccgatcccgg 109 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 82 ccgatcccgatcccgatcccg 102 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||| |||||| Sbjct: 93 cccgatcccgatcccggtcccgg 115
>emb|CR723470.2|CNS0GL6C Tetraodon nigroviridis full-length cDNA Length = 1442 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatcccg 69 ||||||||||||||||||||||| Sbjct: 161 ccccgatcccgatcccgatcccg 139
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 818619 cccgatcccgatcccgatcccgg 818641
>gb|AC092247.1|AC092247 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone BACR36B06, complete sequence Length = 183436 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 102488 cccgatcccgatcccgatcccgg 102510
>gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequence Length = 124024 Score = 46.1 bits (23), Expect = 0.032 Identities = 26/27 (96%) Strand = Plus / Minus Query: 42 cctagccccgatcccgatcccgatccc 68 |||| |||||||||||||||||||||| Sbjct: 101534 cctaaccccgatcccgatcccgatccc 101508
>gb|AE003647.3| Drosophila melanogaster chromosome 2L, section 56 of 83 of the complete sequence Length = 261949 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||||||||||||||||||| Sbjct: 35122 cccgatcccgatcccgatcccgg 35144
>gb|M55018.1|BNACYP Brassica napus cyclophilin (CyP) mRNA, 3' end Length = 661 Score = 46.1 bits (23), Expect = 0.032 Identities = 23/23 (100%) Strand = Plus / Plus Query: 127 gccggccgcatcgtgatggagct 149 ||||||||||||||||||||||| Sbjct: 40 gccggccgcatcgtgatggagct 62
>gb|AC154048.1| Drosophila melanogaster clone BACR29A04, complete sequence Length = 159930 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 148983 cccgatcccgatcccgatcccg 149004 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 148989 cccgatcccgatcccgatcc 149008
>gb|AC154047.2| Drosophila melanogaster clone BACR26B05, complete sequence Length = 162638 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 50882 cccgatcccgatcccgatcccg 50903 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 50888 cccgatcccgatcccgatcc 50907
>emb|AL021346.1|CEH37A05 Caenorhabditis elegans Fosmid H37A05, complete sequence Length = 31226 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 18661 cccgatcccgatcccgatcccg 18682 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 18655 cccgatcccgatcccgatcccg 18676 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 18649 cccgatcccgatcccgatcccg 18670 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 18667 cccgatcccgatcccgatcc 18686
>emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA Length = 786 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagct 135
>emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA Length = 772 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagct 135
>emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA Length = 771 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagct 135
>emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA Length = 772 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagct 135
>emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA Length = 773 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagct 134
>emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA Length = 783 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 111 ccggcgggccgcatcgtgatggagct 136
>emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA Length = 782 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagct 134
>emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA Length = 764 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 91 ccggcgggccgcatcgtgatggagct 116
>emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA Length = 776 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 104 ccggcgggccgcatcgtgatggagct 129
>emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA Length = 769 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 97 ccggcgggccgcatcgtgatggagct 122
>emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA Length = 679 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 7 ccggcgggccgcatcgtgatggagct 32
>emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA Length = 781 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagct 134
>emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA Length = 778 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 106 ccggcgggccgcatcgtgatggagct 131
>emb|CR663102.2|CNS0FAMC Tetraodon nigroviridis full-length cDNA Length = 784 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagct 134
>emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 94 ccggcgggccgcatcgtgatggagct 119
>emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA Length = 782 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagct 135
>emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA Length = 783 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 111 ccggcgggccgcatcgtgatggagct 136
>emb|CR656960.2|CNS0F5VQ Tetraodon nigroviridis full-length cDNA Length = 694 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 22 ccggcgggccgcatcgtgatggagct 47
>emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA Length = 780 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 108 ccggcgggccgcatcgtgatggagct 133
>emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA Length = 781 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagct 134
>emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA Length = 779 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 108 ccggcgggccgcatcgtgatggagct 133
>emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA Length = 780 Score = 44.1 bits (22), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 124 ccggccggccgcatcgtgatggagct 149 ||||| |||||||||||||||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagct 134
>emb|Z68280.1|HSL25A3 Human DNA sequence from clone LA04NC01-25A3 on chromosome 4, complete sequence Length = 43583 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 2873 cccgatcccgatcccgatcccg 2852 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 2867 cccgatcccgatcccgatccc 2847 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 2876 gatcccgatcccgatcccg 2858
>emb|AL390065.20| Human DNA sequence from clone RP11-520M5 on chromosome 4, complete sequence Length = 157119 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 138957 cccgatcccgatcccgatcccg 138936 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 138951 cccgatcccgatcccgatccc 138931 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 138960 gatcccgatcccgatcccg 138942
>emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BAC contig B23G1 Length = 106111 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 64873 cccgatcccgatcccgatcccg 64894 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 64867 cccgatcccgatcccgatcccg 64888 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 64862 ccgatcccgatcccgatcccg 64882
>gb|AC091203.3| Drosophila melanogaster 3L BAC RP98-48N8 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 176929 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatccc 68 |||||||||||||||||||||| Sbjct: 26804 ccccgatcccgatcccgatccc 26783
>gb|AC010022.8| Drosophila melanogaster 3L BAC RP98-1E12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 165852 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatccc 68 |||||||||||||||||||||| Sbjct: 110284 ccccgatcccgatcccgatccc 110263
>ref|NM_165086.1| Drosophila melanogaster wing blister CG15288-RB, transcript variant B (wb), mRNA Length = 10841 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 858 cccgatcccgatcccgatcccg 837 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 852 cccgatcccgatcccgatcccg 831
>ref|NM_078571.2| Drosophila melanogaster Resistance to Juvenile Hormone CG1705-RA (Rst(1)JH), mRNA Length = 2151 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 80 cccgatcccgatcccgatcccg 59 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 74 cccgatcccgatcccgatcc 55
>ref|NM_057442.3| Drosophila melanogaster wing blister CG15288-RA, transcript variant A (wb), mRNA Length = 10818 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 858 cccgatcccgatcccgatcccg 837 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 852 cccgatcccgatcccgatcccg 831
>gb|AC008357.8| Drosophila melanogaster, chromosome 3R, region 86A-86A, BAC clone BACR03L12, complete sequence Length = 190672 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 101127 cccgatcccgatcccgatcccg 101148
>gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone BACR37K07, complete sequence Length = 157722 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 36464 cccgatcccgatcccgatcccg 36443 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 36458 cccgatcccgatcccgatcccg 36437
>gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone BACR20P10, complete sequence Length = 157482 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 15689 cccgatcccgatcccgatcccg 15710 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 15683 cccgatcccgatcccgatcccg 15704
>gb|BT024194.1| Drosophila melanogaster RE71296 full insert cDNA Length = 3769 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 823 cccgatcccgatcccgatcccg 802 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 817 cccgatcccgatcccgatcc 798
>gb|AF135118.1|AF135118 Drosophila melanogaster laminin alpha1,2 (wing blister) mRNA, complete cds Length = 10830 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 858 cccgatcccgatcccgatcccg 837 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 852 cccgatcccgatcccgatcccg 831
>gb|AE003686.4| Drosophila melanogaster chromosome 3R, section 24 of 118 of the complete sequence Length = 223505 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 205463 cccgatcccgatcccgatcccg 205484
>gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52 of 83 of the complete sequence Length = 236144 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 43807 cccgatcccgatcccgatcccg 43786 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 43801 cccgatcccgatcccgatcccg 43780
>gb|AE003552.4| Drosophila melanogaster chromosome 3L, section 33 of 83 of the complete sequence Length = 286770 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatccc 68 |||||||||||||||||||||| Sbjct: 26169 ccccgatcccgatcccgatccc 26148
>gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 of 74 of the complete sequence Length = 328128 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 239945 cccgatcccgatcccgatcccg 239924 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 239939 cccgatcccgatcccgatcc 239920
>gb|AF034859.1|AF034859 Drosophila melanogaster juvenile hormone resistance protein mRNA, complete cds Length = 2151 Score = 44.1 bits (22), Expect = 0.13 Identities = 22/22 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccg 69 |||||||||||||||||||||| Sbjct: 80 cccgatcccgatcccgatcccg 59 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 74 cccgatcccgatcccgatcc 55
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 1824484 ccgatcccgatcccgatcccg 1824464 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 1824479 cccgatcccgatcccgatccc 1824459
>gb|DQ214204.1| Taeniopygia guttata clone 0061P0010D07 DNA directed RNA polymerase II polypeptide L-like mRNA, complete sequence Length = 782 Score = 42.1 bits (21), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatcccggc 71 |||||||| |||||||||||||||| Sbjct: 75 ccccgatcgcgatcccgatcccggc 51
>gb|AC012162.11| Drosophila melanogaster clone BACR01N10, complete sequence Length = 169856 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 115717 cccgatcccgatcccgatccc 115737 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 115713 cgatcccgatcccgatcccg 115732
>gb|AC011070.8| Drosophila melanogaster clone BACR02B12, complete sequence Length = 168850 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 25432 cccgatcccgatcccgatccc 25452
>gb|AC007893.8| Drosophila melanogaster clone BACR02E15, complete sequence Length = 182430 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 67715 ccgatcccgatcccgatcccg 67695
>gb|AC099038.2| Drosophila melanogaster clone BACR28A23, complete sequence Length = 164826 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 77790 cccgatcccgatcccgatccc 77770
>gb|AC009842.9| Drosophila melanogaster clone BACR04C12, complete sequence Length = 163183 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 45235 cccgatcccgatcccgatccc 45255
>gb|AC008231.4| Drosophila melanogaster clone BACR12O13, complete sequence Length = 177339 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 116812 ccccgatcccgatcccgatcc 116792
>ref|XM_591672.2| PREDICTED: Bos taurus similar to sarcalumenin (LOC513912), mRNA Length = 1956 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 59 ccgatcccgatcccgatcccg 79
>gb|BT011029.1| Drosophila melanogaster RE45537 full insert cDNA Length = 1916 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 1503 cccgatcccgatcccgatccc 1523
>gb|AY382628.1| Drosophila melanogaster strain Raleigh Inbred 9 xeroderma pigmentosum D (Xpd) gene, partial cds; and punch (Pu) gene, complete cds Length = 11690 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 5676 ccccgatcccgatcccgatcc 5696
>gb|AY382626.1| Drosophila melanogaster strain Raleigh Inbred 6 xeroderma pigmentosum D (Xpd) gene, partial cds; and punch (Pu) gene, complete cds Length = 11687 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 5682 ccccgatcccgatcccgatcc 5702
>gb|AY382625.1| Drosophila melanogaster strain Raleigh Inbred 33 xeroderma pigmentosum D (Xpd) gene, partial cds; and punch (Pu) gene, complete cds Length = 11698 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 5676 ccccgatcccgatcccgatcc 5696
>gb|AY382624.1| Drosophila melanogaster strain Raleigh Inbred 30 xeroderma pigmentosum D-like (Xpd) gene, partial sequence; and punch (Pu) gene, complete cds Length = 11695 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 5674 ccccgatcccgatcccgatcc 5694
>gb|AY382622.1| Drosophila melanogaster strain Raleigh Inbred 24 xeroderma pigmentosum D (Xpd) gene, partial cds; and punch (Pu) gene, complete cds Length = 11676 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 5689 ccccgatcccgatcccgatcc 5709
>gb|AY382619.1| Drosophila melanogaster strain Raleigh Inbred 1 xeroderma pigmentosum D (Xpd) gene, partial cds; and punch (Pu) gene, complete cds Length = 11704 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 5688 ccccgatcccgatcccgatcc 5708
>emb|CR690956.2|CNS0FW3C Tetraodon nigroviridis full-length cDNA Length = 1648 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 193 cccgatcccgatcccgatccc 173 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatcccg 69 ||||| ||||||||||||||||| Sbjct: 200 ccccgttcccgatcccgatcccg 178
>emb|CR681972.2|CNS0FP5S Tetraodon nigroviridis full-length cDNA Length = 1630 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 185 cccgatcccgatcccgatccc 165 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatcccg 69 ||||| ||||||||||||||||| Sbjct: 192 ccccgttcccgatcccgatcccg 170
>gb|BT023822.1| Drosophila melanogaster RH46383 full insert cDNA Length = 1839 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 810 cccgatcccgatcccgatccc 790
>dbj|AB254820.1| Cryptomeria japonica mRNA for putative peptidyl-prolyl cis-trans isomerase, complete cds Length = 793 Score = 42.1 bits (21), Expect = 0.50 Identities = 33/37 (89%) Strand = Plus / Plus Query: 115 ggcggcgccccggccggccgcatcgtgatggagctgt 151 ||||| || ||||| ||||| |||||||||||||||| Sbjct: 101 ggcggtgcaccggcgggccgaatcgtgatggagctgt 137
>gb|AC010564.7| Drosophila melanogaster 3L BAC RP98-27O1 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 196594 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 145113 ccgatcccgatcccgatcccg 145093 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 145108 cccgatcccgatcccgatcc 145089
>gb|AC010713.5| Drosophila melanogaster 3L BAC RP98-17E13 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173714 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 131054 cccgatcccgatcccgatccc 131074 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||| |||||||||| Sbjct: 20651 cccgatcccgattccgatcccgg 20629
>ref|NM_168555.1| Drosophila melanogaster CG10741-RA, transcript variant A (CG10741), mRNA Length = 1957 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 1651 cccgatcccgatcccgatccc 1671
>ref|NM_165255.1| Drosophila melanogaster CG10283-RB, transcript variant B (CG10283), mRNA Length = 2874 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 1652 ccgatcccgatcccgatcccg 1632
>ref|NM_140401.1| Drosophila melanogaster CG10741-RB, transcript variant B (CG10741), mRNA Length = 1809 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 1503 cccgatcccgatcccgatccc 1523
>ref|NM_136035.4| Drosophila melanogaster CG10283-RA, transcript variant A (CG10283), mRNA Length = 3001 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 1782 ccgatcccgatcccgatcccg 1762
>ref|NM_135791.1| Drosophila melanogaster CG15639-RA (CG15639), mRNA Length = 1590 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 1493 cccgatcccgatcccgatccc 1473
>gb|AF178458.1|AF178458 Lupinus luteus cytosolic cyclophilin gene, complete cds Length = 1968 Score = 42.1 bits (21), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Plus Query: 127 gccggccgcatcgtgatggagctgt 151 |||||||||||||| |||||||||| Sbjct: 1147 gccggccgcatcgtcatggagctgt 1171
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 52 atcccgatcccgatcccggcg 72 ||||||||||||||||||||| Sbjct: 1575442 atcccgatcccgatcccggcg 1575462
>gb|AC008099.5| Drosophila melanogaster, chromosome 2L, region 25A-25A, BAC clone BACR37J18, complete sequence Length = 199916 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 167257 cccgatcccgatcccgatccc 167277
>gb|AC012161.8|AC012161 Drosophila melanogaster, chromosome X, region 16B-16D, BAC clone BACR01I22, complete sequence Length = 173281 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 137810 cccgatcccgatcccgatccc 137790 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 137814 cgatcccgatcccgatcccg 137795
>gb|AC006590.11|AC006590 Drosophila melanogaster, chromosome 2L, region 36E-, BAC clone BACR13N02, complete sequence Length = 172479 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 41441 ccgatcccgatcccgatcccg 41461
>gb|AC008184.4|AC008184 Drosophila melanogaster, chromosome 2L, region 36E5-36F2, BAC clone BACR04D05, complete sequence Length = 154730 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 118962 ccgatcccgatcccgatcccg 118982
>gb|AC009340.4|AC009340 Drosophila melanogaster, chromosome 2L, region 34A-34E, BAC clone BACR04E19, complete sequence Length = 197159 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 94141 cccgatcccgatcccgatccc 94161
>gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone BACR10E05, complete sequence Length = 188766 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 2576 ccgatcccgatcccgatcccg 2556
>gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, region 17E-18A, BAC clone BACR32F24, complete sequence Length = 162307 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 95930 ccgatcccgatcccgatcccg 95910 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 68944 cgatcccgatcccgatccc 68926
>gb|AC007892.4|AC007892 Drosophila melanogaster, chromosome 3R, region 99B-99B, BAC clone BACR02O03, complete sequence Length = 202929 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 193417 ccgatcccgatcccgatcccg 193397
>gb|AY942800.1| Cucumis sativus cyclophilin (M2) mRNA, complete cds Length = 814 Score = 42.1 bits (21), Expect = 0.50 Identities = 45/53 (84%) Strand = Plus / Plus Query: 97 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 149 |||||||||||||| | |||||| | ||||||||||| ||| | |||||||| Sbjct: 59 ttcttcgacatgacaatcggcggcacaccggccggccggatcatcatggagct 111
>gb|BT003317.1| Drosophila melanogaster GH01086 full insert cDNA Length = 4888 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 1249 ccgatcccgatcccgatcccg 1269 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 1254 cccgatcccgatcccgatcc 1273
>gb|AC023743.4| Drosophila melanogaster X BAC RP98-40O10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185405 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 97517 cccgatcccgatcccgatccc 97497 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 97520 gatcccgatcccgatcccg 97502
>emb|Y16088.1|LLCYCLOPH Lupinus luteus mRNA for cyclophilin Length = 758 Score = 42.1 bits (21), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Plus Query: 127 gccggccgcatcgtgatggagctgt 151 |||||||||||||| |||||||||| Sbjct: 78 gccggccgcatcgtcatggagctgt 102
>gb|BT021445.1| Drosophila melanogaster GH02263 full insert cDNA Length = 2244 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 964 ccgatcccgatcccgatcccg 944
>gb|AC007053.15|AC007053 Drosophila melanogaster, chromosome 3R, region 92A1-92A2, BAC clone BACR48K23, complete sequence Length = 173564 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 39647 ccgatcccgatcccgatcccg 39627 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 39642 cccgatcccgatcccgatccc 39622
>gb|AC007257.9|AC007257 Drosophila melanogaster, chromosome 2L, region 30B-, BAC clone BACR24A22, complete sequence Length = 183007 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 111149 cccgatcccgatcccgatccc 111129 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 111152 gatcccgatcccgatcccg 111134
>gb|AE003725.2| Drosophila melanogaster chromosome 3R, section 63 of 118 of the complete sequence Length = 253323 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 188372 ccgatcccgatcccgatcccg 188352 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 188367 cccgatcccgatcccgatccc 188347
>gb|AE003659.2| Drosophila melanogaster chromosome 2L, section 68 of 83 of the complete sequence Length = 260027 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 58353 ccgatcccgatcccgatcccg 58373
>gb|AE003639.3| Drosophila melanogaster chromosome 2L, section 48 of 83 of the complete sequence Length = 261775 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 184241 cccgatcccgatcccgatccc 184261
>gb|AE003625.3| Drosophila melanogaster chromosome 2L, section 34 of 83 of the complete sequence Length = 271507 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 155556 cccgatcccgatcccgatccc 155576 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 155553 gatcccgatcccgatcccg 155571
>gb|AE003771.3| Drosophila melanogaster chromosome 3R, section 109 of 118 of the complete sequence Length = 242528 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 104647 ccgatcccgatcccgatcccg 104627
>gb|AE003576.5| Drosophila melanogaster chromosome 2L, section 15 of 83 of the complete sequence Length = 289893 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 276638 cccgatcccgatcccgatccc 276618
>gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48 of 83 of the complete sequence Length = 282116 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 53012 cccgatcccgatcccgatccc 53032
>gb|AE003506.3| Drosophila melanogaster chromosome X, section 58 of 74 of the complete sequence Length = 302073 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 208987 cccgatcccgatcccgatccc 208967 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 208991 cgatcccgatcccgatcccg 208972
>gb|AE003499.5| Drosophila melanogaster chromosome X, section 51 of 74 of the complete sequence Length = 300896 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 217796 cccgatcccgatcccgatccc 217776
>gb|AE003471.3| Drosophila melanogaster chromosome 3L, section 5 of 83 of the complete sequence Length = 302131 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 268149 ccgatcccgatcccgatcccg 268129 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 268144 cccgatcccgatcccgatcc 268125
>gb|AE003453.3| Drosophila melanogaster chromosome 2R, section 61 of 73 of the complete sequence Length = 305143 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgatcc 67 ||||||||||||||||||||| Sbjct: 88797 ccccgatcccgatcccgatcc 88817
>gb|AE003444.3| Drosophila melanogaster chromosome X, section 28 of 74 of the complete sequence Length = 299633 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatccc 68 ||||||||||||||||||||| Sbjct: 214562 cccgatcccgatcccgatccc 214542 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 214565 gatcccgatcccgatcccg 214547
>gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 of 74 of the complete sequence Length = 290619 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 132524 ccgatcccgatcccgatcccg 132504 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 105538 cgatcccgatcccgatccc 105520
>gb|AC004343.1|AC004343 Drosophila melanogaster DNA sequence (P1 DS02734 (D242)), complete sequence Length = 33554 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcccg 69 ||||||||||||||||||||| Sbjct: 4712 ccgatcccgatcccgatcccg 4732 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 4717 cccgatcccgatcccgatcc 4736
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 1865973 cgatcccgatcccgatcccg 1865954
>gb|AC008140.11| Drosophila melanogaster clone BACR15J23, complete sequence Length = 140973 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 65700 cgatcccgatcccgatcccg 65681
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 ccgatcccgatcccggcgag 74 |||||||||||||||||||| Sbjct: 2029127 ccgatcccgatcccggcgag 2029146
>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23, complete sequence Length = 191765 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatc 66 |||||||||||||||||||| Sbjct: 185031 ccccgatcccgatcccgatc 185012
>gb|AC093104.2| Drosophila melanogaster clone BACR38O04, complete sequence Length = 167107 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 63591 cgatcccgatcccgatcccg 63610
>gb|AC009219.7| Drosophila melanogaster clone BACR32N16, complete sequence Length = 159007 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 41764 cgatcccgatcccgatcccg 41783
>gb|AC093956.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1263_E10, complete sequence Length = 116469 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatc 66 |||||||||||||||||||| Sbjct: 22520 ccccgatcccgatcccgatc 22501
>ref|XM_956732.1| Neurospora crassa OR74A hypothetical protein (NCU05260.1) partial mRNA Length = 3240 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 atcccgatcccgatcccggc 71 |||||||||||||||||||| Sbjct: 2880 atcccgatcccgatcccggc 2861
>ref|XM_324616.1| Neurospora crassa OR74A hypothetical protein (NCU05260.1) partial mRNA Length = 3240 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 atcccgatcccgatcccggc 71 |||||||||||||||||||| Sbjct: 2880 atcccgatcccgatcccggc 2861
>emb|BX071482.1|CNS09RBI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 517 caacccgcaggtgttcttcgacat 494
>emb|BX058895.1|CNS09HLV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 533 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 531 caacccgcaggtgttcttcgacat 508
>emb|BX052328.1|CNS09CJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 525 caacccgcaggtgttcttcgacat 502
>emb|BX052327.1|CNS09CJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 516 caacccgcaggtgttcttcgacat 539
>emb|BX041735.1|CNS094D7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 730 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 492 caacccgcaggtgttcttcgacat 515
>emb|BX021728.1|CNS08OXG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 713 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 524 caacccgcaggtgttcttcgacat 501
>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome Length = 3665893 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 2142684 cgatcccgatcccgatcccg 2142665
>gb|AC009372.6| Drosophila melanogaster 3L BAC RP98-48N4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175095 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 90030 cccgatcccgatcccgatcc 90011 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 90033 gatcccgatcccgatcccg 90015
>ref|NM_079419.2| Drosophila melanogaster ftz transcription factor 1 CG4059-RB, transcript variant B (ftz-f1), mRNA Length = 3916 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 893 cccgatcccgatcccgatcc 874 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 896 gatcccgatcccgatcccg 878
>gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, complete cds Length = 873 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 ggccgcatcgtgatggagct 149 |||||||||||||||||||| Sbjct: 120 ggccgcatcgtgatggagct 139
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 392141 cgatcccgatcccgatcccg 392160 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 85 aacccgaaggtgttcttcgacat 107 ||||| ||||||||||||||||| Sbjct: 22508912 aaccccaaggtgttcttcgacat 22508934 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 392145 cccgatcccgatcccgatc 392163
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatc 66 |||||||||||||||||||| Sbjct: 27310063 ccccgatcccgatcccgatc 27310044 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcc 67 ||||||||||||||||||| Sbjct: 23488577 ccgatcccgatcccgatcc 23488559
>dbj|AP006061.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0414D03 Length = 169823 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 140740 cgatcccgatcccgatcccg 140759 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 140744 cccgatcccgatcccgatc 140762
>dbj|AP005909.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0006G10 Length = 156293 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 16501 cgatcccgatcccgatcccg 16520 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 16505 cccgatcccgatcccgatc 16523
>ref|XM_318916.2| Anopheles gambiae str. PEST ENSANGP00000015053 (ENSANGG00000012564), partial mRNA Length = 1005 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 caacccgaaggtgttcttcgacat 107 ||||||| |||||||||||||||| Sbjct: 516 caacccgcaggtgttcttcgacat 539
>dbj|AK099747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091N20, full insert sequence Length = 1227 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatc 66 |||||||||||||||||||| Sbjct: 110 ccccgatcccgatcccgatc 91
>dbj|AK103396.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033127N02, full insert sequence Length = 1252 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatc 66 |||||||||||||||||||| Sbjct: 134 ccccgatcccgatcccgatc 115
>dbj|AK101606.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033051M14, full insert sequence Length = 1236 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgatc 66 |||||||||||||||||||| Sbjct: 119 ccccgatcccgatcccgatc 100
>dbj|AK064099.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-100-H10, full insert sequence Length = 1429 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 925 cgatcccgatcccgatcccg 906 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 921 cccgatcccgatcccgatc 903
>gb|AC157488.1| Medicago truncatula chromosome 2 BAC clone mte1-33n12, complete sequence Length = 93219 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 tcccgatcccgatcccggcg 72 |||||||||||||||||||| Sbjct: 20571 tcccgatcccgatcccggcg 20590
>gb|AE003688.3| Drosophila melanogaster chromosome 3R, section 26 of 118 of the complete sequence Length = 225594 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 174392 cgatcccgatcccgatcccg 174411
>gb|AE003839.4| Drosophila melanogaster chromosome 2R, section 11 of 73 of the complete sequence Length = 254177 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 252283 cgatcccgatcccgatcccg 252302
>gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66 of 83 of the complete sequence Length = 294542 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 171979 cccgatcccgatcccgatcc 171998 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 171976 gatcccgatcccgatcccg 171994
>gb|AC005473.1|AC005473 Drosophila melanogaster, chromosome 2R, region 44A3-44A4, P1 clone DS02142, complete sequence Length = 76743 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatcccg 69 |||||||||||||||||||| Sbjct: 70761 cgatcccgatcccgatcccg 70742
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 116 gcggcgccccggccggccgcatcg 139 ||||||| |||||||||||||||| Sbjct: 724868 gcggcgcgccggccggccgcatcg 724845
>gb|M63711.1|DROFTZF1A D.melanogaster FTZ-F1 mRNA, complete cds Length = 3281 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcc 67 |||||||||||||||||||| Sbjct: 899 cccgatcccgatcccgatcc 880 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 902 gatcccgatcccgatcccg 884
>ref|XM_467142.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1654 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 91 cgatcccgatcccgatccc 109
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 102 cgacatgacggtgggcggcgccc 124 ||||||||| ||||||||||||| Sbjct: 1328823 cgacatgaccgtgggcggcgccc 1328801
>gb|AF019413.1|HSMHCT8S22 Homo sapiens HLA class III region containing tenascin X (tenascin-X) gene, partial cds; cytochrome P450 21-hydroxylase (CYP21B), complement component C4 (C4B) G11, helicase (SKI2W), RD, complement factor B (Bf), and complement component C2 (C2) genes, complete cds Length = 109646 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 70917 cgatcccgatcccgatccc 70899
>gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosome 17, complete sequence Length = 207685 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 10393 gatcccgatcccgatcccg 10411
>gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete sequence Length = 151609 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 49 ccgatcccgatcccgatcc 67 ||||||||||||||||||| Sbjct: 34992 ccgatcccgatcccgatcc 35010
>gb|AC007578.6| Drosophila melanogaster clone BACR09A11, complete sequence Length = 170684 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 18719 cgatcccgatcccgatccc 18701
>ref|XM_323882.1| Neurospora crassa OR74A predicted protein (NCU04530.1) partial mRNA Length = 138 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||| |||||| Sbjct: 97 cccgatcccgatcccggtcccgg 119
>ref|XM_960520.1| Neurospora crassa OR74A hypothetical protein (NCU02931.1) partial mRNA Length = 1980 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 1856 gatcccgatcccgatcccg 1838
>ref|XM_951848.1| Neurospora crassa OR74A hypothetical protein (NCU04530.1) partial mRNA Length = 138 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||| |||||| Sbjct: 97 cccgatcccgatcccggtcccgg 119
>ref|XM_958777.1| Neurospora crassa OR74A hypothetical protein (NCU03062.1) partial mRNA Length = 2706 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 454 cccgatcccgatcccgatc 436
>ref|XM_959549.1| Neurospora crassa OR74A hypothetical protein (NCU07455.1) partial mRNA Length = 1284 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcc 67 ||||||||||||||||||| Sbjct: 526 ccgatcccgatcccgatcc 508
>ref|XM_327740.1| Neurospora crassa OR74A hypothetical protein (NCU07455.1) partial mRNA Length = 1284 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 ccgatcccgatcccgatcc 67 ||||||||||||||||||| Sbjct: 526 ccgatcccgatcccgatcc 508
>ref|XM_330118.1| Neurospora crassa OR74A hypothetical protein (NCU02931.1) partial mRNA Length = 1980 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 1856 gatcccgatcccgatcccg 1838
>ref|XM_330497.1| Neurospora crassa OR74A hypothetical protein (NCU03062.1) partial mRNA Length = 2706 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 454 cccgatcccgatcccgatc 436
>ref|NM_002904.5| Homo sapiens RD RNA binding protein (RDBP), mRNA Length = 1568 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 875 cgatcccgatcccgatccc 857
>gb|AC144621.3| Mus musculus BAC clone RP24-335I14 from chromosome 17, complete sequence Length = 207330 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 177360 gatcccgatcccgatcccg 177378
>gb|AF040570.3| Amycolatopsis mediterranei rifamycin biosynthetic gene cluster Length = 109528 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 117 cggcgccccggccggccgc 135 ||||||||||||||||||| Sbjct: 12110 cggcgccccggccggccgc 12128
>ref|XM_838335.1| Leishmania major strain Friedlin cystathione gamma lyase (LMJ_1252) partial mRNA Length = 1230 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 102 cgacatgacggtgggcggcgccc 124 ||||||||| ||||||||||||| Sbjct: 675 cgacatgaccgtgggcggcgccc 697
>ref|XM_384590.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG04414.1) partial mRNA Length = 1986 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 atcccgatcccgatcccgg 70 ||||||||||||||||||| Sbjct: 1461 atcccgatcccgatcccgg 1443
>gb|AY150052.1| Kandelia candel cyclophilin (Cyp1) mRNA, complete cds Length = 884 Score = 38.2 bits (19), Expect = 7.8 Identities = 58/71 (81%) Strand = Plus / Plus Query: 79 atggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatc 138 ||||||||||| | ||| | |||||||||| | || ||||| | || |||||| | ||| Sbjct: 25 atggccaaccctagggtctacttcgacatgtccgtcggcggttctcccgccggcaggatc 84 Query: 139 gtgatggagct 149 ||||||||||| Sbjct: 85 gtgatggagct 95
>ref|XM_816485.1| Trypanosoma cruzi strain CL Brener cyclophilin A (Tc00.1047053506925.300) partial mRNA Length = 534 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 83 ccaacccgaaggtgttcttcgac 105 ||||||||||||| ||||||||| Sbjct: 35 ccaacccgaaggtcttcttcgac 57
>gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-333I24, complete sequence Length = 215829 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 111 ggtgggcggcgccccggcc 129 ||||||||||||||||||| Sbjct: 56271 ggtgggcggcgccccggcc 56289
>emb|AL662849.8| Human DNA sequence from clone XXbac-116I9 on chromosome 6 contains the C2 gene for complement component 2, the Bf gene for B-factor, properdin, the RDBP gene for RD RNA-binding protein, the SKIV2L gene for superkiller viralicidic activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3 homolog Z (C. elegans), the STK19 gene for serine/threonine kinase 19, the C4A gene for complement component 4B, the 3' end of the CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 and four CpG islands, complete sequence Length = 88459 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 40793 cgatcccgatcccgatccc 40811
>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the NEU1 gene for sialidase 1 (lysosomal sialidase), the C6orf29 gene for chromosome 6 open reading frame 29, the BAT8 gene for HLA-B associated transcript 8, a novel transcript DAQB-331I12.5, the ZBTB12 gene (previously C6orf46) for zinc finger and BTB domain containing 12, the C2 gene for complement component 2, the Bf gene for B-factor, properdin, the RDBP gene for RD RNA binding protein, the SKIV2L gene for superkiller viralicidic activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3 homolog Z (C. elegans), the STK19 gene for serine/threonine kinase 19, the 5' end of the C4A gene for complement component 4A and 8 CpG isalnds, complete sequence Length = 153464 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 108754 cgatcccgatcccgatccc 108772
>ref|NG_000013.2| Homo sapiens MHC class III complement gene cluster, monomodular haplotype (MCGC@) on chromosome 6 Length = 180017 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 141288 cgatcccgatcccgatccc 141270
>emb|BX005143.8| Human DNA sequence from clone DASS-107J21 on chromosome 6, complete sequence Length = 51842 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 40747 cgatcccgatcccgatccc 40765
>emb|AL161896.16| Human DNA sequence from clone RP11-261P24 on chromosome 13 Contains part of the FARP1 gene for (chondrocyte-derived) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 and a novel gene, complete sequence Length = 96183 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||| |||||||||||| Sbjct: 96017 cccgatcccggtcccgatcccgg 96039
>emb|AL137249.29| Human DNA sequence from clone RP11-111L24 on chromosome 13q31.3-32.3 Contains the 3' end of the FARP1 gene for (chondrocyte-derived) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1, a novel gene and the 3' end of the STK24 gene for serine/threonine kinase 24, complete sequence Length = 106578 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||| |||||||||||| Sbjct: 1834 cccgatcccggtcccgatcccgg 1856
>emb|AL939126.1|SCO939126 Streptomyces coelicolor A3(2) complete genome; segment 23/29 Length = 295150 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 108 gacggtgggcggcgccccg 126 ||||||||||||||||||| Sbjct: 17460 gacggtgggcggcgccccg 17442
>emb|AL939106.1|SCO939106 Streptomyces coelicolor A3(2) complete genome; segment 3/29 Length = 314100 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 106 atgacggtgggcggcgccc 124 ||||||||||||||||||| Sbjct: 7185 atgacggtgggcggcgccc 7167
>emb|AL645922.11| Human DNA sequence from clone XXbac-116M5 on chromosome 6 contains the C2 gene for complement component 2 (C2, CO2), the Bf gene for B-factor, properdin (Bf, GBG, CFAB, PBF2), the RDBP gene for RD RNA-binding protein (RDBP, RD, RDP, D6S45, NELF-E), the SKIV2L gene for superkiller viralicidic activity 2-like (S. cerevisiae) (SKIV2L, HLP, SKI2, DDX13, SKI2W, SKIV2), the DOM3Z gene for dom-3 homolog Z (C. elegans) (DOM3Z, NG6, DOM3L), the STK19 gene for serine/threonine kinase 19 (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1), the C4A gene for complement component 4A (C4A, C4S, CO4), a cytochrome P450, subfamily XXIA (steroid 21-hydroxylase), polypeptide 1 pseudogene (CYP21A1P), a tenascin XA pseudogene (TNXA, XA, XB, TNX, HXBL, D6S103E), a serine/threonine kinase 19 (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1) pseudogene, the C4B gene for complement component 4B (C4B, C4F, CO4), the CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21A2, CAH1, CPS1, CA21H, CYP21, CYP21B, P450c21B), the 3' end of the TNXB gene for tenascin XB (TNXB, XB, TNX, XBS, HXBL, TENX, TNXB1, TNXB2, TNXBS) and four CpG islands, complete sequence Length = 180559 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 50892 cgatcccgatcccgatccc 50910
>emb|AL009188.1|DMC165H7 Drosophila melanogaster cosmid clone 165H7 Length = 34159 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||| ||||||||||||||| Sbjct: 1720 cccgatctcgatcccgatcccgg 1698
>emb|CR759782.7| Human DNA sequence from clone DAMC-178C20 on chromosome 6, complete sequence Length = 79825 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 52400 cgatcccgatcccgatccc 52418
>emb|CR788238.10| Human DNA sequence from clone DAMC-45E14 on chromosome 6, complete sequence Length = 108340 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 17194 cgatcccgatcccgatccc 17176
>emb|CR388219.12| Human DNA sequence from clone DADB-122G4 on chromosome 6, complete sequence Length = 71590 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 69348 cgatcccgatcccgatccc 69366
>gb|BC053101.1| Mus musculus nuclear pore membrane protein 121, mRNA (cDNA clone MGC:62505 IMAGE:6405486), complete cds Length = 4887 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 111 ggtgggcggcgccccggcc 129 ||||||||||||||||||| Sbjct: 484 ggtgggcggcgccccggcc 466
>gb|AC010066.9| Drosophila melanogaster 3L BAC RPCI98-25O1 (Roswell Park Cancer Institute Drosophila BAC library) complete sequence Length = 176056 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||||| |||| Sbjct: 132150 cccgatcccgatcccgatgccgg 132172
>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167097 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 95069 gatcccgatcccgatcccg 95051
>gb|AC093454.3| Drosophila melanogaster 3L BAC RP98-23K2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 168479 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||||| |||| Sbjct: 138193 cccgatcccgatcccgatgccgg 138171
>gb|AF516680.1| Mus musculus nuclear pore membrane glycoprotein 121 kD (Pom121) mRNA, complete cds Length = 5541 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 111 ggtgggcggcgccccggcc 129 ||||||||||||||||||| Sbjct: 472 ggtgggcggcgccccggcc 454
>gb|AC023678.4| Drosophila melanogaster 3L BAC RP98-14K14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 186990 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 atcccgatcccgatcccgg 70 ||||||||||||||||||| Sbjct: 112589 atcccgatcccgatcccgg 112607
>gb|AC105774.8| Drosophila melanogaster X BAC RP98-8O5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170186 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 ||||||| ||||||||||||||| Sbjct: 43868 cccgatctcgatcccgatcccgg 43846
>gb|AY118491.1| Drosophila melanogaster LD04507 full insert cDNA Length = 3496 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 1352 gatcccgatcccgatcccg 1334
>gb|AC093437.2| Drosophila melanogaster 3L BAC RP98-5P17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 197878 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 atcccgatcccgatcccgg 70 ||||||||||||||||||| Sbjct: 106734 atcccgatcccgatcccgg 106716
>gb|AC009379.7| Drosophila melanogaster 3L BAC RP98-48M6 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175963 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 47 ccccgatcccgatcccgat 65 ||||||||||||||||||| Sbjct: 152599 ccccgatcccgatcccgat 152581
>emb|CR626781.1| full-length cDNA clone CS0DI041YD14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1229 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 721 cgatcccgatcccgatccc 703
>emb|CR625999.1| full-length cDNA clone CS0DC027YF24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1237 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 722 cgatcccgatcccgatccc 704
>gb|AC010563.6| Drosophila melanogaster 3L BAC RP98-9M20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185497 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgat 65 ||||||||||||||||||| Sbjct: 181126 ccccgatcccgatcccgat 181144
>gb|AC010057.7| Drosophila melanogaster 3L BAC RP98-26C18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 192588 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 153850 cgatcccgatcccgatccc 153868
>emb|CR620889.1| full-length cDNA clone CS0DI011YB11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1731 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 1248 cgatcccgatcccgatccc 1230
>emb|CR609166.1| full-length cDNA clone CS0DC020YO04 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1495 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 732 cgatcccgatcccgatccc 714
>emb|CR608765.1| full-length cDNA clone CS0DD001YM13 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1495 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 725 cgatcccgatcccgatccc 707
>emb|CR606109.1| full-length cDNA clone CS0DJ013YC23 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1364 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 724 cgatcccgatcccgatccc 706
>gb|AC010114.6| Drosophila melanogaster 3L BAC RP98-10P9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181726 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 127035 cccgatcccgatcccgatc 127017
>emb|CR599173.1| full-length cDNA clone CS0DJ012YB08 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1266 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 743 cgatcccgatcccgatccc 725
>tpg|BK002214.1| TPA: TPA_inf: Drosophila melanogaster HDC10917 (HDC10917) gene, complete cds Length = 1707 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgat 65 ||||||||||||||||||| Sbjct: 691 ccccgatcccgatcccgat 709
>tpg|BK003018.1| TPA: TPA_inf: Drosophila melanogaster HDC17400 (HDC17400) gene, complete cds Length = 1296 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 1221 gatcccgatcccgatcccg 1239
>tpg|BK001852.1| TPA: TPA_inf: Drosophila melanogaster HDC07816 (HDC07816) gene, complete cds Length = 2307 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 187 cgatcccgatcccgatccc 205
>emb|CR592359.1| full-length cDNA clone CS0DB004YP03 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1241 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 727 cgatcccgatcccgatccc 709
>emb|CR592086.1| full-length cDNA clone CS0DI003YD08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 886 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 541 cgatcccgatcccgatccc 523
>gb|AC091218.2| Drosophila melanogaster 3L BAC RP98-3E24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179972 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatc 66 ||||||||||||||||||| Sbjct: 15792 cccgatcccgatcccgatc 15774
>ref|NM_206382.1| Drosophila melanogaster CG5151-RB, transcript variant B (CG5151), mRNA Length = 3066 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||||| |||| Sbjct: 372 cccgatcccgatcccgatgccgg 350
>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 Length = 2505489 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 1540251 cgatcccgatcccgatccc 1540269
>ref|NM_166877.1| Drosophila melanogaster CG32811-RA (CG32811), mRNA Length = 459 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 45 cgatcccgatcccgatccc 63
>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 Length = 4170692 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 3662272 gatcccgatcccgatcccg 3662254
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 111 ggtgggcggcgccccggccggcc 133 ||||||||||| ||||||||||| Sbjct: 3664099 ggtgggcggcggcccggccggcc 3664121
>ref|NM_140587.1| Drosophila melanogaster CG5151-RA, transcript variant A (CG5151), mRNA Length = 2787 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||||| |||| Sbjct: 93 cccgatcccgatcccgatgccgg 71
>ref|NM_079860.2| Drosophila melanogaster Serotonin receptor 7 CG12073-RA (5-HT7), mRNA Length = 3478 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 gatcccgatcccgatcccg 69 ||||||||||||||||||| Sbjct: 1352 gatcccgatcccgatcccg 1334
>gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164252 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 35103 cgatcccgatcccgatccc 35085
>dbj|AK154473.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630037F14 product:Pom121 protein, full insert sequence Length = 5578 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 111 ggtgggcggcgccccggcc 129 ||||||||||||||||||| Sbjct: 509 ggtgggcggcgccccggcc 491
>ref|NG_004658.1| Homo sapiens MHC class III complement gene cluster, bimodular haplotype (MCGC2@) on chromosome 6 Length = 201523 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 27410 cgatcccgatcccgatccc 27428
>gb|AY061165.1| Drosophila melanogaster LD13176 full length cDNA Length = 2787 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 48 cccgatcccgatcccgatcccgg 70 |||||||||||||||||| |||| Sbjct: 93 cccgatcccgatcccgatgccgg 71
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 ccgatcccgatcccggcga 73 ||||||||||||||||||| Sbjct: 1199183 ccgatcccgatcccggcga 1199201
>gb|AC007575.10| Drosophila melanogaster, chromosome 3R, region 82F-83A, BAC clone BACR42H10, complete sequence Length = 181009 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 50 cgatcccgatcccgatccc 68 ||||||||||||||||||| Sbjct: 38217 cgatcccgatcccgatccc 38235
>gb|AC018490.6| Drosophila melanogaster, chromosome X, region 17E-17F, BAC clone BACR25O02, complete sequence Length = 165098 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 47 ccccgatcccgatcccgat 65 ||||||||||||||||||| Sbjct: 103568 ccccgatcccgatcccgat 103586 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 661,321 Number of Sequences: 3902068 Number of extensions: 661321 Number of successful extensions: 47181 Number of sequences better than 10.0: 307 Number of HSP's better than 10.0 without gapping: 310 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 44391 Number of HSP's gapped (non-prelim): 2634 length of query: 162 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 140 effective length of database: 17,147,199,772 effective search space: 2400607968080 effective search space used: 2400607968080 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
