ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal19m12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_483749.1| Oryza sativa (japonica cultivar-group), mRNA 430 e-117
2dbj|AK111654.1| Oryza sativa (japonica cultivar-group) cDNA clon... 430 e-117
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 143 8e-31
4dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic D... 143 8e-31
5ref|NM_114328.3| Arabidopsis thaliana peptidyl-prolyl cis-trans ... 68 4e-08
6gb|BT008382.1| Arabidopsis thaliana At3g44600 gene, complete cds 68 4e-08
7gb|AY062653.1| Arabidopsis thaliana putative protein (At3g44600;... 68 4e-08
8gb|AC152984.2| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cance... 50 0.009
9emb|AL353818.1|ATF14L2 Arabidopsis thaliana DNA chromosome 3, BA... 48 0.034
10dbj|AP005251.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.034
11ref|NM_060977.2| Caenorhabditis elegans Y87G2A.6 (cyclophilin) m... 46 0.14
12emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, compl... 46 0.14
13ref|XM_720009.1| Plasmodium yoelii yoelii str. 17XNL O-sialoglyc... 44 0.54
14emb|AL445666.9| Human DNA sequence from clone RP11-262H5 on chro... 44 0.54
15emb|AL357079.24| Human DNA sequence from clone RP11-7O11 on chro... 44 0.54
16emb|AL669869.10| Mouse DNA sequence from clone RP23-198E14 on ch... 44 0.54
17emb|CR933731.5| Mouse DNA sequence from clone DN-160I24 on chrom... 44 0.54
18gb|AC005038.5|AC005038 Homo sapiens BAC clone RP11-486I22 from 1... 44 0.54
19gb|AF118076.1|AF118076 Homo sapiens PRO1779 mRNA, complete cds 44 0.54
20gb|AC026239.4|AC026239 Homo sapiens chromosome 7 clone RP11-335B... 44 0.54
21gb|AC009365.9|AC009365 Homo sapiens chromosome 7 clone RP11-355K... 44 0.54
22gb|BC108409.1| Mus musculus cDNA clone IMAGE:30137739, containin... 42 2.1
23ref|XM_472555.1| Oryza sativa (japonica cultivar-group), predic... 42 2.1
24ref|NM_007753.1| Mus musculus carboxypeptidase A3, mast cell (Cp... 42 2.1
25gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 2.1
26ref|XM_748535.1| Aspergillus fumigatus Af293 hypothetical protei... 42 2.1
27ref|XM_748536.1| Aspergillus fumigatus Af293 bZIP transcription ... 42 2.1
28gb|AC125112.3| Mus musculus BAC clone RP24-239I23 from chromosom... 42 2.1
29emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clon... 42 2.1
30ref|XM_739626.1| Plasmodium chabaudi chabaudi hypothetical prote... 42 2.1
31ref|XM_670850.1| Plasmodium berghei strain ANKA hypothetical pro... 42 2.1
32emb|AL390068.13| Human DNA sequence from clone RP13-185D13 on ch... 42 2.1
33gb|AC115802.10| Mus musculus, clone RP23-408J7, complete sequence 42 2.1
34gb|AC158132.6| Mus musculus chromosome 1, clone RP23-11K8, compl... 42 2.1
35emb|CR391929.9| Zebrafish DNA sequence from clone DKEYP-86B5, co... 42 2.1
36emb|BX682552.9| Zebrafish DNA sequence from clone DKEY-120C6 in ... 42 2.1
37gb|AC068496.7| Mus musculus chromosome 3 clone RP23-75F13 clone ... 42 2.1
38gb|AC092747.10| Homo sapiens 12p BAC RP11-582E3 (Roswell Park Ca... 42 2.1
39dbj|AK088906.1| Mus musculus 2 days neonate thymus thymic cells ... 42 2.1
40dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
41dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
42gb|AC158937.4| Mus musculus chromosome 3, clone RP23-290L18, com... 42 2.1
43gb|AC138303.4| Mus musculus BAC clone RP23-43G12 from chromosome... 42 2.1
44gb|AC087220.9| Oryza sativa chromosome 3 BAC OSJNBb0097F01 genom... 42 2.1
45ref|NM_001009222.1| Felis catus mannosidase, alpha, class 2B, me... 42 2.1
46gb|AC153981.5| Mus musculus 10 BAC RP24-112H16 (Roswell Park Can... 42 2.1
47dbj|AK069367.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
48emb|BX511094.6| Zebrafish DNA sequence from clone CH211-137G12 i... 42 2.1
49emb|BX544878.7| Mouse DNA sequence from clone RP23-203A24 on chr... 42 2.1
50gb|AF010191.1| Felis catus lysosomal alpha-mannosidase (MAN B) m... 42 2.1
51gb|AC073883.34| Mus musculus strain C57BL/6J chromosome 3 clone ... 42 2.1
52emb|AL669961.8| Mouse DNA sequence from clone RP23-43M17 on chro... 42 2.1
53gb|J05118.1|MUSCARA Mouse mast cell carboxypeptidase A mRNA, com... 42 2.1
54ref|NM_124509.3| Arabidopsis thaliana nucleic acid binding AT5G5... 40 8.4
55ref|NM_001036978.1| Arabidopsis thaliana nucleic acid binding AT... 40 8.4
56ref|NM_180838.1| Arabidopsis thaliana nucleic acid binding AT5G5... 40 8.4
57gb|AC159290.2| Mus musculus BAC clone RP23-291I2 from chromosome... 40 8.4
58ref|XM_450031.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.4
59gb|AC161218.10| Mus musculus chromosome 7, clone RP24-161J8, com... 40 8.4
60gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases ... 40 8.4
61gb|AC102430.9| Mus musculus chromosome 14, clone RP24-103F5, com... 40 8.4
62gb|AC109186.7| Mus musculus chromosome 5, clone RP24-351E22, com... 40 8.4
63gb|AC103621.6| Mus musculus chromosome 5, clone RP24-230J14, com... 40 8.4
64gb|AC165240.6| Mus musculus chromosome 5, clone RP24-174P7, comp... 40 8.4
65gb|AC132278.3| Mus musculus BAC clone RP24-346C20 from chromosom... 40 8.4
66gb|AC112155.3| Mus musculus BAC clone RP24-100G17 from chromosom... 40 8.4
67ref|XM_953746.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.4
68ref|XM_957116.1| Neurospora crassa OR74A PROTEIN UVS-2 (NCU05210... 40 8.4
69ref|XM_324566.1| Neurospora crassa OR74A PROTEIN UVS-2 (NCU05210... 40 8.4
70ref|XM_331292.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.4
71gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome... 40 8.4
72gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosom... 40 8.4
73gb|AC140314.2| Mus musculus BAC clone RP23-395L3 from chromosome... 40 8.4
74gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 40 8.4
75gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome... 40 8.4
76gb|U00038.2| Caenorhabditis elegans cosmid T21D11, complete sequ... 40 8.4
77gb|AC164091.3| Mus musculus BAC clone RP23-97M20 from chromosome... 40 8.4
78gb|AC135671.3| Mus musculus BAC clone RP23-440D14 from chromosom... 40 8.4
79gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, com... 40 8.4
80gb|AC126670.4| Mus musculus BAC clone RP24-469G14 from chromosom... 40 8.4
81gb|DQ483781.1| Gymnogyps californianus clone 204F microsatellite... 40 8.4
82gb|DQ483638.1| Gymnogyps californianus clone 61F microsatellite ... 40 8.4
83gb|DQ483465.1| Gymnogyps californianus clone 24D microsatellite ... 40 8.4
84ref|XM_533358.2| PREDICTED: Canis familiaris similar to formin-l... 40 8.4
85gb|AC122043.4| Mus musculus BAC clone RP24-448C16 from chromosom... 40 8.4
86emb|Z82083.1|CEZK1010 Caenorhabditis elegans Cosmid ZK1010, comp... 40 8.4
87ref|XM_814671.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 8.4
88gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, comple... 40 8.4
89gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, comple... 40 8.4
90gb|AC124190.4| Mus musculus BAC clone RP23-267M9 from 3, complet... 40 8.4
91gb|AC118928.13| Mus musculus chromosome 16, clone RP23-416J10, c... 40 8.4
92ref|XM_547531.2| PREDICTED: Canis familiaris similar to nestin (... 40 8.4
93gb|AC098710.2| Mus musculus BAC clone RP23-1L15 from 5, complete... 40 8.4
94emb|CR682616.2|CNS0FPNO Tetraodon nigroviridis full-length cDNA 40 8.4
95gb|AC101723.9| Mus musculus chromosome 17, clone RP23-316J7, com... 40 8.4
96gb|AC160978.4| Mus musculus BAC clone RP23-426B17 from chromosom... 40 8.4
97gb|AC090008.14| Mus muclulus Strain C57BL6/J chromosome 2 BAC, R... 40 8.4
98emb|BX664735.7| Human DNA sequence from clone RP11-665E4 on chro... 40 8.4
99emb|BX664726.5| Human DNA sequence from clone RP11-95H8 on chrom... 40 8.4
100emb|AL445584.16| Human DNA sequence from clone RP11-366N18 on ch... 40 8.4
101emb|AL445309.13| Human DNA sequence from clone RP11-506K6 on chr... 40 8.4
102gb|AC111321.8| Rattus norvegicus 4 BAC CH230-241A9 (Children's H... 40 8.4
103emb|AL139230.25| Human DNA sequence from clone RP11-182M20 on ch... 40 8.4
104emb|AL136358.13| Human DNA sequence from clone RP11-183L8 on chr... 40 8.4
105emb|AL035703.21|HS61A9 Human DNA sequence from clone RP1-61A9 on... 40 8.4
106gb|AY142629.1| Arabidopsis thaliana unknown protein (At5g51300) ... 40 8.4
107gb|AF370132.1| Arabidopsis thaliana unknown protein (At5g51300) ... 40 8.4
108gb|AC122210.5| Mus musculus BAC clone RP23-96G7 from chromosome ... 40 8.4
109emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genom... 40 8.4
110emb|BX572096.1| Prochlorococcus marinus MIT9313 complete genome;... 40 8.4
111gb|AC159974.7| Mus musculus chromosome 1, clone RP24-266D16, com... 40 8.4
112emb|BX294091.1|NCB14A21 Neurospora crassa DNA linkage group V BA... 40 8.4
113emb|AL662970.2|OSJN00174 Oryza sativa genomic DNA, chromosome 4,... 40 8.4
114gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cance... 40 8.4
115gb|AF336378.1| Mus musculus Kel blood group protein (Kel), epith... 40 8.4
116gb|AC008385.7| Homo sapiens chromosome 5 clone CTC-224D3, comple... 40 8.4
117gb|AF464190.1| Petromyzon marinus homeodomain HOXW10A-like gene ... 40 8.4
118gb|AC015910.10| Homo sapiens chromosome 17, clone RP11-690G19, c... 40 8.4
119gb|AC090489.8| Genomic sequence for Mus musculus, clone RP23-104... 40 8.4
120gb|AC083795.5| Homo sapiens BAC clone RP11-255I10 from 4, comple... 40 8.4
121gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 8.4
122gb|AC092751.4| Genomic sequence for Mus musculus, clone RP23-113... 40 8.4
123gb|AC131405.5| Rattus norvegicus BAC CH230-179I7 (Children's Ho... 40 8.4
124gb|AF155773.3| Gibberella moniliformis fumonisin biosynthetic ge... 40 8.4
125gb|AC160639.2| Mus musculus BAC clone RP23-103I12 from chromosom... 40 8.4
126dbj|AK048266.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 8.4
127dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
128dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
129dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
130gb|AC126221.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.4
131gb|AC104407.3| Homo sapiens BAC clone RP11-92A5 from 4, complete... 40 8.4
132gb|AC008732.9| Homo sapiens chromosome 16 clone CTD-2519M14, com... 40 8.4
133emb|BX831033.1|CNS09YWD Arabidopsis thaliana Full-length cDNA Co... 40 8.4
134gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, comple... 40 8.4
135gb|AC154744.2| Mus musculus BAC clone RP24-394N17 from chromosom... 40 8.4
136gb|AC155247.2| Mus musculus BAC clone RP24-302C23 from chromosom... 40 8.4
137gb|AC153986.8| Mus musculus 6 BAC RP24-105F24 (Roswell Park Canc... 40 8.4
138gb|AC133183.3| Mus musculus BAC clone RP24-185O19 from chromosom... 40 8.4
139gb|AF324887.1|AF324887 Anas platyrhynchos lecithin cholesterol a... 40 8.4
140gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str... 40 8.4
141gb|AC084125.9| Homo sapiens chromosome 8, clone CTD-2517M22, com... 40 8.4
142gb|AC011507.3|AC011507 Homo sapiens chromosome 19 clone CTD-2131... 40 8.4
143dbj|AP003767.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
144dbj|AP003487.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
145dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
146dbj|AP005860.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
147dbj|AP004063.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
148dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
149emb|AL663069.10| Mouse DNA sequence from clone RP23-410P8 on chr... 40 8.4
150emb|AL732612.28| Mouse DNA sequence from clone RP23-31L20 on chr... 40 8.4
151emb|AL928619.6| Zebrafish DNA sequence from clone CH211-63I20, c... 40 8.4
152dbj|AB023044.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 8.4
153dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.4
154dbj|AK122318.1| Mus musculus mRNA for mKIAA0587 protein 40 8.4
155dbj|AK109544.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.4
156dbj|AK100974.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.4
157gb|AC154173.3| Mus musculus BAC clone RP23-3C4 from 3, complete ... 40 8.4
158emb|AL356021.4|CNS05TDB Human chromosome 14 DNA sequence BAC R-7... 40 8.4
159gb|AC114624.24| Mus musculus chromosome 5, clone RP24-106K21, co... 40 8.4
160dbj|AP001892.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.4
161dbj|AP000798.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 8.4
162dbj|AP006181.2| Homo sapiens genomic DNA, chromosome 8q24.2, clo... 40 8.4
163emb|CT030172.10| Mouse DNA sequence from clone RP23-313L22 on ch... 40 8.4
164emb|CT486001.10| Mouse DNA sequence from clone RP23-343G13 on ch... 40 8.4
165gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 8.4
166emb|BX321909.3| Mouse DNA sequence from clone RP23-443D3 on chro... 40 8.4
167emb|AL773563.12| Mouse DNA sequence from clone RP23-414L19 on ch... 40 8.4
168gb|AC135859.4| Mus musculus BAC clone RP24-151D9 from 10, comple... 40 8.4
169gb|AC134448.4| Mus musculus BAC clone RP24-186G11 from 3, comple... 40 8.4
170emb|CT010463.9| Mouse DNA sequence from clone RP23-193M19 on chr... 40 8.4
171gb|AC123062.4| Mus musculus BAC clone RP23-218A9 from 13, comple... 40 8.4
172emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chro... 40 8.4
173emb|AL591067.35| Mouse DNA sequence from clone RP23-333D2 on chr... 40 8.4
174gb|AC136424.1| Homo sapiens chromosome 5 clone CTD-2363C16, comp... 40 8.4
175emb|AL683893.26| Mouse DNA sequence from clone RP23-122N18 on ch... 40 8.4
176emb|AL844838.7| Mouse DNA sequence from clone RP23-263E15 on chr... 40 8.4
177emb|AL391261.3|CNS06C85 Human chromosome 14 DNA sequence BAC C-2... 40 8.4
178emb|X07177.1|MCISDNA Mouse cis-acting DNA element controlling ex... 40 8.4
179gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 40 8.4
180emb|AL731703.16| Mouse DNA sequence from clone RP23-100O16 on ch... 40 8.4
181gb|AC165249.2| Mus musculus BAC clone RP24-157P13 from chromosom... 40 8.4
182dbj|D11458.1|NEUUVS2 N.crassa uvs-2 gene for UVS-2 protein, comp... 40 8.4

>ref|XM_483749.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2416

 Score =  430 bits (217), Expect = e-117
 Identities = 358/405 (88%)
 Strand = Plus / Plus

                                                                       
Query: 211 cccgcgccggcgcggcagcggcagaagcgccctctccagttcgagcaggctttcctcgac 270
           |||| |||| |||||| | || |||||||||| ||||||||||||||||| |||||||||
Sbjct: 244 cccgtgccgccgcggccgaggaagaagcgcccgctccagttcgagcaggccttcctcgac 303

                                                                       
Query: 271 gccctcccctccgcagccatgtacgagaagagttatatgcatagggacgtcgtcacgcac 330
           ||||| |||||||| ||||||||||||||||| ||||||||| |||| |||||||| |||
Sbjct: 304 gccctgccctccgcggccatgtacgagaagagctatatgcatcgggatgtcgtcacccac 363

                                                                       
Query: 331 gtcgccgtttctcccgctgacttcttcattaccgggagcgccgatggacatctgaaattc 390
           |||||||| ||||| ||||||| |||||| ||||||||||| ||||||||| ||||||| 
Sbjct: 364 gtcgccgtctctcctgctgactacttcatcaccgggagcgcagatggacatttgaaattt 423

                                                                       
Query: 391 tggaagaagaaacccagtggaatcgaatttgctaaacattttcggtctcatctcagtccc 450
           ||||||||||||||   ||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 424 tggaagaagaaaccagctgggatcgaatttgctaaacattttcgatctcatctcagtccc 483

                                                                       
Query: 451 atcgaaggcttagctgttagcgttgatggcttactttgctgcacgatctctaacgaccag 510
           || |||||| ||||||| || ||||||||| ||||||||||||||||||| | |||   |
Sbjct: 484 attgaaggcctagctgtgagtgttgatggcctactttgctgcacgatctccagcgattgg 543

                                                                       
Query: 511 tctgtcaagatatatgatgttgtaaactatgacatgatgttcatgatgcggctcccattt 570
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||| 
Sbjct: 544 tctgtcaagatatatgacgttgtgaattatgacatgatgttcatgatgcgtctcccattc 603

                                                        
Query: 571 gtccctggggcgattgagtgggtttatcggcagggtgatgttaaa 615
           || || || || ||||||||||||||||| || || |||||||||
Sbjct: 604 gttccgggtgcaattgagtgggtttatcgacaaggagatgttaaa 648



to top

>dbj|AK111654.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147N22, full
           insert sequence
          Length = 2416

 Score =  430 bits (217), Expect = e-117
 Identities = 358/405 (88%)
 Strand = Plus / Plus

                                                                       
Query: 211 cccgcgccggcgcggcagcggcagaagcgccctctccagttcgagcaggctttcctcgac 270
           |||| |||| |||||| | || |||||||||| ||||||||||||||||| |||||||||
Sbjct: 244 cccgtgccgccgcggccgaggaagaagcgcccgctccagttcgagcaggccttcctcgac 303

                                                                       
Query: 271 gccctcccctccgcagccatgtacgagaagagttatatgcatagggacgtcgtcacgcac 330
           ||||| |||||||| ||||||||||||||||| ||||||||| |||| |||||||| |||
Sbjct: 304 gccctgccctccgcggccatgtacgagaagagctatatgcatcgggatgtcgtcacccac 363

                                                                       
Query: 331 gtcgccgtttctcccgctgacttcttcattaccgggagcgccgatggacatctgaaattc 390
           |||||||| ||||| ||||||| |||||| ||||||||||| ||||||||| ||||||| 
Sbjct: 364 gtcgccgtctctcctgctgactacttcatcaccgggagcgcagatggacatttgaaattt 423

                                                                       
Query: 391 tggaagaagaaacccagtggaatcgaatttgctaaacattttcggtctcatctcagtccc 450
           ||||||||||||||   ||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 424 tggaagaagaaaccagctgggatcgaatttgctaaacattttcgatctcatctcagtccc 483

                                                                       
Query: 451 atcgaaggcttagctgttagcgttgatggcttactttgctgcacgatctctaacgaccag 510
           || |||||| ||||||| || ||||||||| ||||||||||||||||||| | |||   |
Sbjct: 484 attgaaggcctagctgtgagtgttgatggcctactttgctgcacgatctccagcgattgg 543

                                                                       
Query: 511 tctgtcaagatatatgatgttgtaaactatgacatgatgttcatgatgcggctcccattt 570
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||| 
Sbjct: 544 tctgtcaagatatatgacgttgtgaattatgacatgatgttcatgatgcgtctcccattc 603

                                                        
Query: 571 gtccctggggcgattgagtgggtttatcggcagggtgatgttaaa 615
           || || || || ||||||||||||||||| || || |||||||||
Sbjct: 604 gttccgggtgcaattgagtgggtttatcgacaaggagatgttaaa 648



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  143 bits (72), Expect = 8e-31
 Identities = 126/144 (87%)
 Strand = Plus / Plus

                                                                            
Query: 472      gttgatggcttactttgctgcacgatctctaacgaccagtctgtcaagatatatgatgtt 531
                ||||||||| ||||||||||||||||||| | |||   |||||||||||||||||| |||
Sbjct: 27887199 gttgatggcctactttgctgcacgatctccagcgattggtctgtcaagatatatgacgtt 27887258

                                                                            
Query: 532      gtaaactatgacatgatgttcatgatgcggctcccatttgtccctggggcgattgagtgg 591
                || || ||||||||||||||||||||||| |||||||| || || || || |||||||||
Sbjct: 27887259 gtgaattatgacatgatgttcatgatgcgtctcccattcgttccgggtgcaattgagtgg 27887318

                                        
Query: 592      gtttatcggcagggtgatgttaaa 615
                |||||||| || || |||||||||
Sbjct: 27887319 gtttatcgacaaggagatgttaaa 27887342



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Plus

                                                                            
Query: 376      ggacatctgaaattctggaagaagaaacccagtggaatcgaatttgctaaacattttcgg 435
                |||||| ||||||| ||||||||||||||   ||| ||||||||||||||||||||||| 
Sbjct: 27886941 ggacatttgaaattttggaagaagaaaccagctgggatcgaatttgctaaacattttcga 27887000

                                                
Query: 436      tctcatctcagtcccatcgaaggcttagctgt 467
                ||||||||||||||||| |||||| |||||||
Sbjct: 27887001 tctcatctcagtcccattgaaggcctagctgt 27887032



 Score =  101 bits (51), Expect = 3e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                            
Query: 291      gtacgagaagagttatatgcatagggacgtcgtcacgcacgtcgccgtttctcccgctga 350
                |||||||||||| ||||||||| |||| |||||||| ||||||||||| ||||| |||||
Sbjct: 27886533 gtacgagaagagctatatgcatcgggatgtcgtcacccacgtcgccgtctctcctgctga 27886592

                                           
Query: 351      cttcttcattaccgggagcgccgatgg 377
                || |||||| ||||||||||| |||||
Sbjct: 27886593 ctacttcatcaccgggagcgcagatgg 27886619



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                            
Query: 211      cccgcgccggcgcggcagcggcagaagcgccctctccagttcgagcaggctttcctcgac 270
                |||| |||| |||||| | || |||||||||| ||||||||||||||||| |||||||||
Sbjct: 27886367 cccgtgccgccgcggccgaggaagaagcgcccgctccagttcgagcaggccttcctcgac 27886426

                                      
Query: 271      gccctcccctccgcagccatgt 292
                ||||| |||||||| |||||||
Sbjct: 27886427 gccctgccctccgcggccatgt 27886448



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 259      gctttcctcgacgccctcccctcc 282
                ||||||||||||||||||||||||
Sbjct: 27623416 gctttcctcgacgccctcccctcc 27623393



to top

>dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1150_A11
          Length = 142010

 Score =  143 bits (72), Expect = 8e-31
 Identities = 126/144 (87%)
 Strand = Plus / Plus

                                                                         
Query: 472   gttgatggcttactttgctgcacgatctctaacgaccagtctgtcaagatatatgatgtt 531
             ||||||||| ||||||||||||||||||| | |||   |||||||||||||||||| |||
Sbjct: 95277 gttgatggcctactttgctgcacgatctccagcgattggtctgtcaagatatatgacgtt 95336

                                                                         
Query: 532   gtaaactatgacatgatgttcatgatgcggctcccatttgtccctggggcgattgagtgg 591
             || || ||||||||||||||||||||||| |||||||| || || || || |||||||||
Sbjct: 95337 gtgaattatgacatgatgttcatgatgcgtctcccattcgttccgggtgcaattgagtgg 95396

                                     
Query: 592   gtttatcggcagggtgatgttaaa 615
             |||||||| || || |||||||||
Sbjct: 95397 gtttatcgacaaggagatgttaaa 95420



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Plus

                                                                         
Query: 376   ggacatctgaaattctggaagaagaaacccagtggaatcgaatttgctaaacattttcgg 435
             |||||| ||||||| ||||||||||||||   ||| ||||||||||||||||||||||| 
Sbjct: 95019 ggacatttgaaattttggaagaagaaaccagctgggatcgaatttgctaaacattttcga 95078

                                             
Query: 436   tctcatctcagtcccatcgaaggcttagctgt 467
             ||||||||||||||||| |||||| |||||||
Sbjct: 95079 tctcatctcagtcccattgaaggcctagctgt 95110



 Score =  101 bits (51), Expect = 3e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                         
Query: 291   gtacgagaagagttatatgcatagggacgtcgtcacgcacgtcgccgtttctcccgctga 350
             |||||||||||| ||||||||| |||| |||||||| ||||||||||| ||||| |||||
Sbjct: 94611 gtacgagaagagctatatgcatcgggatgtcgtcacccacgtcgccgtctctcctgctga 94670

                                        
Query: 351   cttcttcattaccgggagcgccgatgg 377
             || |||||| ||||||||||| |||||
Sbjct: 94671 ctacttcatcaccgggagcgcagatgg 94697



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 73/82 (89%)
 Strand = Plus / Plus

                                                                         
Query: 211   cccgcgccggcgcggcagcggcagaagcgccctctccagttcgagcaggctttcctcgac 270
             |||| |||| |||||| | || |||||||||| ||||||||||||||||| |||||||||
Sbjct: 94445 cccgtgccgccgcggccgaggaagaagcgcccgctccagttcgagcaggccttcctcgac 94504

                                   
Query: 271   gccctcccctccgcagccatgt 292
             ||||| |||||||| |||||||
Sbjct: 94505 gccctgccctccgcggccatgt 94526



to top

>ref|NM_114328.3| Arabidopsis thaliana peptidyl-prolyl cis-trans isomerase AT3G44600
           mRNA, complete cds
          Length = 2390

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 112/138 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcgaatttgctaaacattttcggtctcatctcagtcccatcgaaggcttagctgttagc 471
           ||||| |||||||| ||||| || || |||||| |||| || |||||  |||| ||||||
Sbjct: 368 atcgagtttgctaagcatttccgctcccatctcggtccaattgaaggtctagcggttagc 427

                                                                       
Query: 472 gttgatggcttactttgctgcacgatctctaacgaccagtctgtcaagatatatgatgtt 531
            ||||||| || |||||||| || ||||| || || ||  |||| || ||||||||||||
Sbjct: 428 attgatggtttgctttgctgtacaatctcaaatgatcatgctgttaaaatatatgatgtt 487

                             
Query: 532 gtaaactatgacatgatg 549
           || ||||| || ||||||
Sbjct: 488 gtcaactacgatatgatg 505



to top

>gb|BT008382.1| Arabidopsis thaliana At3g44600 gene, complete cds
          Length = 1896

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 112/138 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcgaatttgctaaacattttcggtctcatctcagtcccatcgaaggcttagctgttagc 471
           ||||| |||||||| ||||| || || |||||| |||| || |||||  |||| ||||||
Sbjct: 307 atcgagtttgctaagcatttccgctcccatctcggtccaattgaaggtctagcggttagc 366

                                                                       
Query: 472 gttgatggcttactttgctgcacgatctctaacgaccagtctgtcaagatatatgatgtt 531
            ||||||| || |||||||| || ||||| || || ||  |||| || ||||||||||||
Sbjct: 367 attgatggtttgctttgctgtacaatctcaaatgatcatgctgttaaaatatatgatgtt 426

                             
Query: 532 gtaaactatgacatgatg 549
           || ||||| || ||||||
Sbjct: 427 gtcaactacgatatgatg 444



to top

>gb|AY062653.1| Arabidopsis thaliana putative protein (At3g44600; F14L2_150) mRNA,
           complete cds
          Length = 2224

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 112/138 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcgaatttgctaaacattttcggtctcatctcagtcccatcgaaggcttagctgttagc 471
           ||||| |||||||| ||||| || || |||||| |||| || |||||  |||| ||||||
Sbjct: 368 atcgagtttgctaagcatttccgctcccatctcggtccaattgaaggtctagcggttagc 427

                                                                       
Query: 472 gttgatggcttactttgctgcacgatctctaacgaccagtctgtcaagatatatgatgtt 531
            ||||||| || |||||||| || ||||| || || ||  |||| || ||||||||||||
Sbjct: 428 attgatggtttgctttgctgtacaatctcaaatgatcatgctgttaaaatatatgatgtt 487

                             
Query: 532 gtaaactatgacatgatg 549
           || ||||| || ||||||
Sbjct: 488 gtcaactacgatatgatg 505



to top

>gb|AC152984.2| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 185001

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 418    tttgctaaacattttcggtctcatc 442
              |||||||||||||||||||||||||
Sbjct: 121257 tttgctaaacattttcggtctcatc 121233



to top

>emb|AL353818.1|ATF14L2 Arabidopsis thaliana DNA chromosome 3, BAC clone F14L2
          Length = 107027

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 466   gttagcgttgatggcttactttgctgcacgatctctaacgaccagtctgtcaagatatat 525
             |||||| ||||||| || |||||||| || ||||| || || ||  |||| || ||||||
Sbjct: 99715 gttagcattgatggtttgctttgctgtacaatctcaaatgatcatgctgttaaaatatat 99656

                                     
Query: 526   gatgttgtaaactatgacatgatg 549
             |||||||| ||||| || ||||||
Sbjct: 99655 gatgttgtcaactacgatatgatg 99632



to top

>dbj|AP005251.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0011H15
          Length = 130146

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 259   gctttcctcgacgccctcccctcc 282
             ||||||||||||||||||||||||
Sbjct: 20760 gctttcctcgacgccctcccctcc 20737



to top

>ref|NM_060977.2| Caenorhabditis elegans Y87G2A.6 (cyclophilin) mRNA, complete cds
          Length = 2144

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 367 agcgccgatggacatctgaaattctggaagaagaa 401
           |||| ||||||||| |||||||||||||| |||||
Sbjct: 241 agcgtcgatggacacctgaaattctggaaaaagaa 275



to top

>emb|AL110500.1|CEY87G2A Caenorhabditis elegans YAC Y87G2A, complete sequence
          Length = 123091

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 367   agcgccgatggacatctgaaattctggaagaagaa 401
             |||| ||||||||| |||||||||||||| |||||
Sbjct: 81040 agcgtcgatggacacctgaaattctggaaaaagaa 81006



to top

>ref|XM_720009.1| Plasmodium yoelii yoelii str. 17XNL O-sialoglycoprotease (PY00526)
            partial mRNA
          Length = 1806

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 520  atatatgatgttgtaaactatgacat 545
            ||||||||||||||||||||| ||||
Sbjct: 1504 atatatgatgttgtaaactataacat 1479



to top

>emb|AL445666.9| Human DNA sequence from clone RP11-262H5 on chromosome 1 Contains the
            3' end of the CENPF gene for centromere protein F
            350/400ka (mitosin), complete sequence
          Length = 65748

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 171  gcagcaggaggaggagggggaa 192
            ||||||||||||||||||||||
Sbjct: 2186 gcagcaggaggaggagggggaa 2165



to top

>emb|AL357079.24| Human DNA sequence from clone RP11-7O11 on chromosome 1, complete
             sequence
          Length = 106769

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 173   agcaggaggaggagggggaaga 194
             ||||||||||||||||||||||
Sbjct: 26714 agcaggaggaggagggggaaga 26693



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 173   agcaggaggaggagggggaaga 194
             ||||||||||||||||||||||
Sbjct: 26585 agcaggaggaggagggggaaga 26564



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 173   agcaggaggaggagggggaaga 194
             ||||||||||||||||||||||
Sbjct: 26514 agcaggaggaggagggggaaga 26493



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 173   agcaggaggaggagggggaaga 194
             ||||||||||||||||||||||
Sbjct: 26008 agcaggaggaggagggggaaga 25987



to top

>emb|AL669869.10| Mouse DNA sequence from clone RP23-198E14 on chromosome 11 Contains the
              3' end of the Mgl2 gene for macrophage galactose
              N-acetyl-galactosamine specific lectin 2, the Mgl1 gene for
              macrophage galactose N-acetyl-galactosamine specific lectin
              1, the gene for a novel RNA polymerase Rpb1 C-terminal
              repeat domain containing protein, three novel genes, the
              Bcl6b gene for B-cell CLL/lymphoma 6 member B, the Alox12
              gene for arachidonate 12-lipoxygenase and four CpG islands,
              complete sequence
          Length = 174390

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 173    agcaggaggaggagggggaaga 194
              ||||||||||||||||||||||
Sbjct: 113642 agcaggaggaggagggggaaga 113621



to top

>emb|CR933731.5| Mouse DNA sequence from clone DN-160I24 on chromosome 11, complete
             sequence
          Length = 212982

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 173   agcaggaggaggagggggaaga 194
             ||||||||||||||||||||||
Sbjct: 93670 agcaggaggaggagggggaaga 93649



to top

>gb|AC005038.5|AC005038 Homo sapiens BAC clone RP11-486I22 from 1, complete sequence
          Length = 190744

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 173    agcaggaggaggagggggaaga 194
              ||||||||||||||||||||||
Sbjct: 184824 agcaggaggaggagggggaaga 184845



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 173    agcaggaggaggagggggaaga 194
              ||||||||||||||||||||||
Sbjct: 184318 agcaggaggaggagggggaaga 184339



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 173    agcaggaggaggagggggaaga 194
              ||||||||||||||||||||||
Sbjct: 184247 agcaggaggaggagggggaaga 184268



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 173    agcaggaggaggagggggaaga 194
              ||||||||||||||||||||||
Sbjct: 184118 agcaggaggaggagggggaaga 184139



to top

>gb|AF118076.1|AF118076 Homo sapiens PRO1779 mRNA, complete cds
          Length = 2114

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 171  gcagcaggaggaggagggggaa 192
            ||||||||||||||||||||||
Sbjct: 1789 gcagcaggaggaggagggggaa 1768



to top

>gb|AC026239.4|AC026239 Homo sapiens chromosome 7 clone RP11-335B7, complete sequence
          Length = 153619

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 174   gcaggaggaggagggggaagaa 195
             ||||||||||||||||||||||
Sbjct: 55248 gcaggaggaggagggggaagaa 55269



to top

>gb|AC009365.9|AC009365 Homo sapiens chromosome 7 clone RP11-355K3, complete sequence
          Length = 222794

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 174  gcaggaggaggagggggaagaa 195
            ||||||||||||||||||||||
Sbjct: 6159 gcaggaggaggagggggaagaa 6180



to top

>gb|BC108409.1| Mus musculus cDNA clone IMAGE:30137739, containing frame-shift errors
          Length = 1509

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 387  attctggaagaagaaacccag 407
            |||||||||||||||||||||
Sbjct: 1174 attctggaagaagaaacccag 1154



to top

>ref|XM_472555.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1344

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 171 gcagcaggaggaggaggggga 191
           |||||||||||||||||||||
Sbjct: 46  gcagcaggaggaggaggggga 26



to top

>ref|NM_007753.1| Mus musculus carboxypeptidase A3, mast cell (Cpa3), mRNA
          Length = 1442

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 387  attctggaagaagaaacccag 407
            |||||||||||||||||||||
Sbjct: 1180 attctggaagaagaaacccag 1160



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 213      cgcgccggcgcggcagcggca 233
                |||||||||||||||||||||
Sbjct: 14454471 cgcgccggcgcggcagcggca 14454451



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 219     ggcgcggcagcggcagaagc 238
               ||||||||||||||||||||
Sbjct: 9307870 ggcgcggcagcggcagaagc 9307889



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 176     aggaggaggagggggaagaa 195
               ||||||||||||||||||||
Sbjct: 3942464 aggaggaggagggggaagaa 3942445



to top

>ref|XM_748535.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g10135)
           partial mRNA
          Length = 534

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 167 tggtgcagcaggaggaggagg 187
           |||||||||||||||||||||
Sbjct: 247 tggtgcagcaggaggaggagg 227



to top

>ref|XM_748536.1| Aspergillus fumigatus Af293 bZIP transcription factor (Afu5g10130)
           partial mRNA
          Length = 486

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 167 tggtgcagcaggaggaggagg 187
           |||||||||||||||||||||
Sbjct: 257 tggtgcagcaggaggaggagg 277



to top

>gb|AC125112.3| Mus musculus BAC clone RP24-239I23 from chromosome 2, complete sequence
          Length = 149339

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 171   gcagcaggaggaggagggggaagaa 195
             ||||||||||||||||| |||||||
Sbjct: 30137 gcagcaggaggaggaggaggaagaa 30161



to top

>emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084A10,
              complete sequence
          Length = 144811

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 171    gcagcaggaggaggaggggga 191
              |||||||||||||||||||||
Sbjct: 123030 gcagcaggaggaggaggggga 123050



to top

>ref|XM_739626.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000645.02.0)
            partial mRNA
          Length = 1659

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 520  atatatgatgttgtaaactat 540
            |||||||||||||||||||||
Sbjct: 1357 atatatgatgttgtaaactat 1337



to top

>ref|XM_670850.1| Plasmodium berghei strain ANKA hypothetical protein (PB000774.03.0)
            partial mRNA
          Length = 1743

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 520  atatatgatgttgtaaactat 540
            |||||||||||||||||||||
Sbjct: 1441 atatatgatgttgtaaactat 1421



to top

>emb|AL390068.13| Human DNA sequence from clone RP13-185D13 on chromosome X, complete
             sequence
          Length = 97681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 174   gcaggaggaggagggggaaga 194
             |||||||||||||||||||||
Sbjct: 92464 gcaggaggaggagggggaaga 92484



to top

>gb|AC115802.10| Mus musculus, clone RP23-408J7, complete sequence
          Length = 185710

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 171    gcagcaggaggaggagggggaagaa 195
              ||||||||||||||||| |||||||
Sbjct: 150249 gcagcaggaggaggaggaggaagaa 150273



to top

>gb|AC158132.6| Mus musculus chromosome 1, clone RP23-11K8, complete sequence
          Length = 231218

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 171    gcagcaggaggaggaggggga 191
              |||||||||||||||||||||
Sbjct: 119539 gcagcaggaggaggaggggga 119519



to top

>emb|CR391929.9| Zebrafish DNA sequence from clone DKEYP-86B5, complete sequence
          Length = 223724

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 171    gcagcaggaggaggaggggga 191
              |||||||||||||||||||||
Sbjct: 156865 gcagcaggaggaggaggggga 156885



to top

>emb|BX682552.9| Zebrafish DNA sequence from clone DKEY-120C6 in linkage group 3, complete
              sequence
          Length = 228044

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 171    gcagcaggaggaggaggggga 191
              |||||||||||||||||||||
Sbjct: 122223 gcagcaggaggaggaggggga 122243



to top

>gb|AC068496.7| Mus musculus chromosome 3 clone RP23-75F13 clone RP23-75F13, complete
             sequence
          Length = 136268

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 387   attctggaagaagaaacccag 407
             |||||||||||||||||||||
Sbjct: 97547 attctggaagaagaaacccag 97567



to top

>gb|AC092747.10| Homo sapiens 12p BAC RP11-582E3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 162400

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 171    gcagcaggaggaggagggggaagaa 195
              ||||||||||||||||| |||||||
Sbjct: 112873 gcagcaggaggaggaggaggaagaa 112897



to top

>dbj|AK088906.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430030O10
            product:carboxypeptidase A3, mast cell, full insert
            sequence
          Length = 1453

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 387  attctggaagaagaaacccag 407
            |||||||||||||||||||||
Sbjct: 1185 attctggaagaagaaacccag 1165



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 171      gcagcaggaggaggaggggga 191
                |||||||||||||||||||||
Sbjct: 21473280 gcagcaggaggaggaggggga 21473300



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 171      gcagcaggaggaggaggggg 190
                ||||||||||||||||||||
Sbjct: 31488910 gcagcaggaggaggaggggg 31488891



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 213      cgcgccggcgcggcagcggca 233
                |||||||||||||||||||||
Sbjct: 14449446 cgcgccggcgcggcagcggca 14449426



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 219     ggcgcggcagcggcagaagc 238
               ||||||||||||||||||||
Sbjct: 9305703 ggcgcggcagcggcagaagc 9305722



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 176     aggaggaggagggggaagaa 195
               ||||||||||||||||||||
Sbjct: 3942575 aggaggaggagggggaagaa 3942556



to top

>gb|AC158937.4| Mus musculus chromosome 3, clone RP23-290L18, complete sequence
          Length = 196087

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 387   attctggaagaagaaacccag 407
             |||||||||||||||||||||
Sbjct: 72854 attctggaagaagaaacccag 72834



to top

>gb|AC138303.4| Mus musculus BAC clone RP23-43G12 from chromosome 12, complete sequence
          Length = 207693

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 176    aggaggaggagggggaagaac 196
              |||||||||||||||||||||
Sbjct: 101851 aggaggaggagggggaagaac 101871



to top

>gb|AC087220.9| Oryza sativa chromosome 3 BAC OSJNBb0097F01 genomic sequence, complete
             sequence
          Length = 135594

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 213   cgcgccggcgcggcagcggca 233
             |||||||||||||||||||||
Sbjct: 86910 cgcgccggcgcggcagcggca 86930



to top

>ref|NM_001009222.1| Felis catus mannosidase, alpha, class 2B, member 1 (MAN2B1), mRNA
          Length = 3227

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 171  gcagcaggaggaggaggggga 191
            |||||||||||||||||||||
Sbjct: 3109 gcagcaggaggaggaggggga 3089



to top

>gb|AC153981.5| Mus musculus 10 BAC RP24-112H16 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 177129

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 505   gaccagtctgtcaagatatat 525
             |||||||||||||||||||||
Sbjct: 74244 gaccagtctgtcaagatatat 74224



to top

>dbj|AK069367.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023012O03, full
           insert sequence
          Length = 1645

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 171 gcagcaggaggaggaggggga 191
           |||||||||||||||||||||
Sbjct: 107 gcagcaggaggaggaggggga 87



to top

>emb|BX511094.6| Zebrafish DNA sequence from clone CH211-137G12 in linkage group 19,
             complete sequence
          Length = 154360

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 171   gcagcaggaggaggaggggga 191
             |||||||||||||||||||||
Sbjct: 44676 gcagcaggaggaggaggggga 44696



to top

>emb|BX544878.7| Mouse DNA sequence from clone RP23-203A24 on chromosome 2, complete
             sequence
          Length = 59823

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 171   gcagcaggaggaggagggggaagaa 195
             ||||||||||||||||| |||||||
Sbjct: 30055 gcagcaggaggaggaggaggaagaa 30031



to top

>gb|AF010191.1| Felis catus lysosomal alpha-mannosidase (MAN B) mRNA, complete cds
          Length = 3227

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 171  gcagcaggaggaggaggggga 191
            |||||||||||||||||||||
Sbjct: 3109 gcagcaggaggaggaggggga 3089



to top

>gb|AC073883.34| Mus musculus strain C57BL/6J chromosome 3 clone rp23-71e13, complete
              sequence
          Length = 213482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 387    attctggaagaagaaacccag 407
              |||||||||||||||||||||
Sbjct: 172049 attctggaagaagaaacccag 172069



to top

>emb|AL669961.8| Mouse DNA sequence from clone RP23-43M17 on chromosome 2, complete
              sequence
          Length = 202937

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 171    gcagcaggaggaggaggggga 191
              |||||||||||||||||||||
Sbjct: 102553 gcagcaggaggaggaggggga 102573



to top

>gb|J05118.1|MUSCARA Mouse mast cell carboxypeptidase A mRNA, complete cds
          Length = 1442

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 387  attctggaagaagaaacccag 407
            |||||||||||||||||||||
Sbjct: 1180 attctggaagaagaaacccag 1160



to top

>ref|NM_124509.3| Arabidopsis thaliana nucleic acid binding AT5G51300 transcript
            variant AT5G51300.2 mRNA, complete cds
          Length = 2557

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  caggaggaggagggggaaga 194
            ||||||||||||||||||||
Sbjct: 1871 caggaggaggagggggaaga 1852



to top

>ref|NM_001036978.1| Arabidopsis thaliana nucleic acid binding AT5G51300 transcript
            variant AT5G51300.3 mRNA, complete cds
          Length = 2658

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  caggaggaggagggggaaga 194
            ||||||||||||||||||||
Sbjct: 1902 caggaggaggagggggaaga 1883



to top

>ref|NM_180838.1| Arabidopsis thaliana nucleic acid binding AT5G51300 transcript
            variant AT5G51300.1 mRNA, complete cds
          Length = 2857

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  caggaggaggagggggaaga 194
            ||||||||||||||||||||
Sbjct: 1906 caggaggaggagggggaaga 1887



to top

>gb|AC159290.2| Mus musculus BAC clone RP23-291I2 from chromosome 13, complete sequence
          Length = 231853

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 162556 aggaggaggagggggaagaa 162575



to top

>ref|XM_450031.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4040

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 171 gcagcaggaggaggagggggaaga 194
           ||||||||||||||||| ||||||
Sbjct: 410 gcagcaggaggaggaggaggaaga 433



to top

>gb|AC161218.10| Mus musculus chromosome 7, clone RP24-161J8, complete sequence
          Length = 181156

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 38297 aggaggaggagggggaagaa 38278



to top

>gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases 501860 to 700960 (section 3 of 3)
              of the complete sequence
          Length = 199101

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    gaggagggggaagaactgat 200
              ||||||||||||||||||||
Sbjct: 173936 gaggagggggaagaactgat 173917



to top

>gb|AC102430.9| Mus musculus chromosome 14, clone RP24-103F5, complete sequence
          Length = 153864

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 110938 aggaggaggagggggaagaa 110919



to top

>gb|AC109186.7| Mus musculus chromosome 5, clone RP24-351E22, complete sequence
          Length = 174202

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 171    gcagcaggaggaggagggggaaga 194
              ||||||||||||||||| ||||||
Sbjct: 170604 gcagcaggaggaggaggaggaaga 170581



to top

>gb|AC103621.6| Mus musculus chromosome 5, clone RP24-230J14, complete sequence
          Length = 169247

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 42385 aggaggaggagggggaagaa 42366



to top

>gb|AC165240.6| Mus musculus chromosome 5, clone RP24-174P7, complete sequence
          Length = 196437

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   gcagcaggaggaggaggggg 190
             ||||||||||||||||||||
Sbjct: 68276 gcagcaggaggaggaggggg 68295



to top

>gb|AC132278.3| Mus musculus BAC clone RP24-346C20 from chromosome 8, complete sequence
          Length = 154524

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 90848 aggaggaggagggggaagaa 90867



to top

>gb|AC112155.3| Mus musculus BAC clone RP24-100G17 from chromosome 16, complete
             sequence
          Length = 169864

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 97253 aggaggaggagggggaagaa 97272



to top

>ref|XM_953746.1| Neurospora crassa OR74A hypothetical protein (NCU08901.1) partial
            mRNA
          Length = 2817

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 168  ggtgcagcaggaggaggagg 187
            ||||||||||||||||||||
Sbjct: 2382 ggtgcagcaggaggaggagg 2363



to top

>ref|XM_957116.1| Neurospora crassa OR74A PROTEIN UVS-2 (NCU05210.1) partial mRNA
          Length = 1575

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 171  gcagcaggaggaggaggggg 190
            ||||||||||||||||||||
Sbjct: 1042 gcagcaggaggaggaggggg 1061



to top

>ref|XM_324566.1| Neurospora crassa OR74A PROTEIN UVS-2 (NCU05210.1) partial mRNA
          Length = 1575

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 171  gcagcaggaggaggaggggg 190
            ||||||||||||||||||||
Sbjct: 1042 gcagcaggaggaggaggggg 1061



to top

>ref|XM_331292.1| Neurospora crassa OR74A hypothetical protein (NCU08901.1) partial
            mRNA
          Length = 2817

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 168  ggtgcagcaggaggaggagg 187
            ||||||||||||||||||||
Sbjct: 2382 ggtgcagcaggaggaggagg 2363



to top

>gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome 13, complete sequence
          Length = 218640

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 160881 aggaggaggagggggaagaa 160900



to top

>gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosome 9, complete sequence
          Length = 158741

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 94985 aggaggaggagggggaagaa 94966



to top

>gb|AC140314.2| Mus musculus BAC clone RP23-395L3 from chromosome 12, complete sequence
          Length = 191322

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 32075 aggaggaggagggggaagaa 32056



to top

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 256     caggctttcctcgacgccct 275
               ||||||||||||||||||||
Sbjct: 1937885 caggctttcctcgacgccct 1937866



to top

>gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome 14, complete sequence
          Length = 236917

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 85027 aggaggaggagggggaagaa 85046



to top

>gb|U00038.2| Caenorhabditis elegans cosmid T21D11, complete sequence
          Length = 19024

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 416  aatttgctaaacattttcgg 435
            ||||||||||||||||||||
Sbjct: 8002 aatttgctaaacattttcgg 8021



to top

>gb|AC164091.3| Mus musculus BAC clone RP23-97M20 from chromosome 3, complete
            sequence
          Length = 218807

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 3941 aggaggaggagggggaagaa 3922



to top

>gb|AC135671.3| Mus musculus BAC clone RP23-440D14 from chromosome 17, complete sequence
          Length = 188307

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 116909 aggaggaggagggggaagaa 116890



to top

>gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, complete sequence
          Length = 204437

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   gaggagggggaagaactgat 200
             ||||||||||||||||||||
Sbjct: 76099 gaggagggggaagaactgat 76080



to top

>gb|AC126670.4| Mus musculus BAC clone RP24-469G14 from chromosome 1, complete sequence
          Length = 200595

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 181729 aggaggaggagggggaagaa 181748



to top

>gb|DQ483781.1| Gymnogyps californianus clone 204F microsatellite sequence
          Length = 583

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 aggaggaggagggggaagaa 195
           ||||||||||||||||||||
Sbjct: 152 aggaggaggagggggaagaa 171



to top

>gb|DQ483638.1| Gymnogyps californianus clone 61F microsatellite sequence
          Length = 450

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 aggaggaggagggggaagaa 195
           ||||||||||||||||||||
Sbjct: 419 aggaggaggagggggaagaa 438



to top

>gb|DQ483465.1| Gymnogyps californianus clone 24D microsatellite sequence
          Length = 368

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 aggaggaggagggggaagaa 195
           ||||||||||||||||||||
Sbjct: 136 aggaggaggagggggaagaa 155



to top

>ref|XM_533358.2| PREDICTED: Canis familiaris similar to formin-like 2 isoform B
            (LOC476151), mRNA
          Length = 3469

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 168  ggtgcagcaggaggaggaggggga 191
            ||||||| ||||||||||||||||
Sbjct: 1865 ggtgcagaaggaggaggaggggga 1842



to top

>gb|AC122043.4| Mus musculus BAC clone RP24-448C16 from chromosome 5, complete sequence
          Length = 187106

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 94609 aggaggaggagggggaagaa 94590



to top

>emb|Z82083.1|CEZK1010 Caenorhabditis elegans Cosmid ZK1010, complete sequence
          Length = 33511

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 7499 aggaggaggagggggaagaa 7480



to top

>ref|XM_814671.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506825.219) partial mRNA
          Length = 2100

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 434  ggtctcatctcagtcccatc 453
            ||||||||||||||||||||
Sbjct: 1581 ggtctcatctcagtcccatc 1600



to top

>gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, complete sequence
          Length = 203739

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 48099 aggaggaggagggggaagaa 48118



to top

>gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, complete sequence
          Length = 200727

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   cagcaggaggaggaggggga 191
             ||||||||||||||||||||
Sbjct: 64651 cagcaggaggaggaggggga 64632



to top

>gb|AC124190.4| Mus musculus BAC clone RP23-267M9 from 3, complete sequence
          Length = 167681

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 171    gcagcaggaggaggagggggaaga 194
              ||||||||||||||||| ||||||
Sbjct: 148588 gcagcaggaggaggaggaggaaga 148611



to top

>gb|AC118928.13| Mus musculus chromosome 16, clone RP23-416J10, complete sequence
          Length = 238516

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 98851 aggaggaggagggggaagaa 98870



to top

>ref|XM_547531.2| PREDICTED: Canis familiaris similar to nestin (LOC490410), mRNA
          Length = 5163

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 4460 aggaggaggagggggaagaa 4479



to top

>gb|AC098710.2| Mus musculus BAC clone RP23-1L15 from 5, complete sequence
          Length = 213811

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   gcagcaggaggaggagggggaaga 194
             ||||||||||||||||| ||||||
Sbjct: 97435 gcagcaggaggaggaggaggaaga 97458



to top

>emb|CR682616.2|CNS0FPNO Tetraodon nigroviridis full-length cDNA
          Length = 1099

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 171 gcagcaggaggaggaggggg 190
           ||||||||||||||||||||
Sbjct: 732 gcagcaggaggaggaggggg 751



to top

>gb|AC101723.9| Mus musculus chromosome 17, clone RP23-316J7, complete sequence
          Length = 181452

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 60448 aggaggaggagggggaagaa 60429



to top

>gb|AC160978.4| Mus musculus BAC clone RP23-426B17 from chromosome 13, complete sequence
          Length = 197652

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    cagcaggaggaggaggggga 191
              ||||||||||||||||||||
Sbjct: 185956 cagcaggaggaggaggggga 185937



to top

>gb|AC090008.14| Mus muclulus Strain C57BL6/J chromosome 2 BAC, RP23-163H21, Complete
              Sequence, complete sequence
          Length = 196733

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 171    gcagcaggaggaggagggggaaga 194
              ||||||||||||||||| ||||||
Sbjct: 141797 gcagcaggaggaggaggaggaaga 141774



to top

>emb|BX664735.7| Human DNA sequence from clone RP11-665E4 on chromosome 9 Contains the
             5' end of the gene for a novel protein similar to
             contactin associated protein-like 3 (CNTNAP3) and a CpG
             island, complete sequence
          Length = 187005

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 168   ggtgcagcaggaggaggaggggga 191
             |||||||||||||| |||||||||
Sbjct: 82371 ggtgcagcaggagggggaggggga 82394



to top

>emb|BX664726.5| Human DNA sequence from clone RP11-95H8 on chromosome 9 Contains a
             pseudogene similar to part of  6-pyruvoyltetrahydropterin
             synthase (PTS), a novel gene similar to c9orf36, two novel
             genes and a novel pseudogene, complete sequence
          Length = 144571

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 168   ggtgcagcaggaggaggaggggga 191
             |||||||||||||| |||||||||
Sbjct: 89955 ggtgcagcaggagggggaggggga 89978



to top

>emb|AL445584.16| Human DNA sequence from clone RP11-366N18 on chromosome 9 Contains the
             gene for a novel protein similar to chromosome 9 open
             reading frame 36 (C9orf36), a 6-pyruvoyltetrahydropterin
             synthase (PTS) pseudogene and a CpG island, complete
             sequence
          Length = 184313

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 168   ggtgcagcaggaggaggaggggga 191
             |||||||||||||| |||||||||
Sbjct: 27799 ggtgcagcaggagggggaggggga 27776



to top

>emb|AL445309.13| Human DNA sequence from clone RP11-506K6 on chromosome 6 Contains the
              gene for a novel protein similar to tubulin beta
              polypeptide TUBB, a novel gene, the 3' end of the gene for
              the possible ortholog of rat ion transporter protein
              (NRITP) and five CpG islands, complete sequence
          Length = 136587

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 112880 aggaggaggagggggaagaa 112899



to top

>gb|AC111321.8| Rattus norvegicus 4 BAC CH230-241A9 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 227849

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 10296 aggaggaggagggggaagaa 10277



to top

>emb|AL139230.25| Human DNA sequence from clone RP11-182M20 on chromosome 13 Contains the
             5' end of the TBC1D4 gene for TBC1 domain family, member 4
             (KIAA0603), a novel gene and a CpG island, complete
             sequence
          Length = 133362

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 36032 aggaggaggagggggaagaa 36013



to top

>emb|AL136358.13| Human DNA sequence from clone RP11-183L8 on chromosome 13 Contains the 5'
              end of the LHFP gene for lipoma HMGIC fusion partner and a
              CpG island, complete sequence
          Length = 120507

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 105199 aggaggaggagggggaagaa 105180



to top

>emb|AL035703.21|HS61A9 Human DNA sequence from clone RP1-61A9 on chromosome 1p35.2-36.13
             Contains a novel gene (KIAA0478) and the EPHA8 gene for
             ephrin receptor EphA8 precursor, complete sequence
          Length = 160705

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 15257 aggaggaggagggggaagaa 15238



to top

>gb|AY142629.1| Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds
          Length = 2446

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  caggaggaggagggggaaga 194
            ||||||||||||||||||||
Sbjct: 1867 caggaggaggagggggaaga 1848



to top

>gb|AF370132.1| Arabidopsis thaliana unknown protein (At5g51300) mRNA, complete cds
          Length = 2848

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  caggaggaggagggggaaga 194
            ||||||||||||||||||||
Sbjct: 1906 caggaggaggagggggaaga 1887



to top

>gb|AC122210.5| Mus musculus BAC clone RP23-96G7 from chromosome 10, complete sequence
          Length = 231988

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 180    ggaggagggggaagaactga 199
              ||||||||||||||||||||
Sbjct: 140723 ggaggagggggaagaactga 140742



to top

>emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genome; segment 16/16
          Length = 227214

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 252  cgagcaggctttcctcgacg 271
            ||||||||||||||||||||
Sbjct: 5883 cgagcaggctttcctcgacg 5864



to top

>emb|BX572096.1| Prochlorococcus marinus MIT9313 complete genome; segment 2/7
          Length = 349323

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 331    gtcgccgtttctcccgctga 350
              ||||||||||||||||||||
Sbjct: 304365 gtcgccgtttctcccgctga 304346



to top

>gb|AC159974.7| Mus musculus chromosome 1, clone RP24-266D16, complete sequence
          Length = 158901

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   ggaggaggagggggaagaac 196
             ||||||||||||||||||||
Sbjct: 93054 ggaggaggagggggaagaac 93035



to top

>emb|BX294091.1|NCB14A21 Neurospora crassa DNA linkage group V BAC contig B14A21
          Length = 113206

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 168   ggtgcagcaggaggaggagg 187
             ||||||||||||||||||||
Sbjct: 46536 ggtgcagcaggaggaggagg 46517



to top

>emb|AL662970.2|OSJN00174 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0058K23,
             complete sequence
          Length = 164805

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   gcagcaggaggaggaggggg 190
             ||||||||||||||||||||
Sbjct: 66593 gcagcaggaggaggaggggg 66574



to top

>gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 241211

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 116827 aggaggaggagggggaagaa 116846



to top

>gb|AF336378.1| Mus musculus Kel blood group protein (Kel), epithelial calcium channel 1
              (Ecac1), epithelial calcium channel 2 (Ecac2), and ephrin
              type A receptor (Mep) genes, complete cds; and T cell
              receptor beta chain (Tcr) gene, partial cds
          Length = 169781

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    gaggagggggaagaactgat 200
              ||||||||||||||||||||
Sbjct: 162586 gaggagggggaagaactgat 162605



to top

>gb|AC008385.7| Homo sapiens chromosome 5 clone CTC-224D3, complete sequence
          Length = 151712

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 19141 aggaggaggagggggaagaa 19122



to top

>gb|AF464190.1| Petromyzon marinus homeodomain HOXW10A-like gene and Tcl-1 like
           transposon, complete sequence
          Length = 29612

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 166 gtggtgcagcaggaggaggagggg 189
           |||||| |||||||||||||||||
Sbjct: 896 gtggtggagcaggaggaggagggg 919



to top

>gb|AC015910.10| Homo sapiens chromosome 17, clone RP11-690G19, complete sequence
          Length = 90476

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   gcagcaggaggaggaggggg 190
             ||||||||||||||||||||
Sbjct: 36889 gcagcaggaggaggaggggg 36908



to top

>gb|AC090489.8| Genomic sequence for Mus musculus, clone RP23-104O10, complete sequence
          Length = 207424

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 13442 aggaggaggagggggaagaa 13461



to top

>gb|AC083795.5| Homo sapiens BAC clone RP11-255I10 from 4, complete sequence
          Length = 185371

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 383    tgaaattctggaagaagaaa 402
              ||||||||||||||||||||
Sbjct: 133217 tgaaattctggaagaagaaa 133236



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  ggcgcggcagcggcagaagc 238
            ||||||||||||||||||||
Sbjct: 5270 ggcgcggcagcggcagaagc 5289



to top

>gb|AC092751.4| Genomic sequence for Mus musculus, clone RP23-113P18, complete sequence
          Length = 209990

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 171    gcagcaggaggaggagggggaaga 194
              ||||||||||||||||| ||||||
Sbjct: 118459 gcagcaggaggaggaggaggaaga 118482



to top

>gb|AC131405.5| Rattus norvegicus  BAC CH230-179I7 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 217197

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 17355 aggaggaggagggggaagaa 17374



to top

>gb|AF155773.3| Gibberella moniliformis fumonisin biosynthetic gene cluster, complete
             sequence
          Length = 75658

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   cgacggagatacagagcgtg 127
             ||||||||||||||||||||
Sbjct: 19163 cgacggagatacagagcgtg 19182



to top

>gb|AC160639.2| Mus musculus BAC clone RP23-103I12 from chromosome 14, complete
             sequence
          Length = 195224

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 38292 aggaggaggagggggaagaa 38273



to top

>dbj|AK048266.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130044H07 product:unclassifiable, full
           insert sequence
          Length = 2558

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 aggaggaggagggggaagaa 195
           ||||||||||||||||||||
Sbjct: 664 aggaggaggagggggaagaa 645



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 171     gcagcaggaggaggagggggaaga 194
               ||||||||||||||||| ||||||
Sbjct: 1105202 gcagcaggaggaggaggaggaaga 1105225



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 171     gcagcaggaggaggagggggaaga 194
               ||||||||||||||||| ||||||
Sbjct: 3272562 gcagcaggaggaggaggaggaaga 3272585



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 51      cgacatggcgacgacgagcgagtc 74
               ||||||||||||| ||||||||||
Sbjct: 2381323 cgacatggcgacgtcgagcgagtc 2381346



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 205      cctggccccgcgccggcgcggcagcggc 232
                |||||||| ||||||||||||| |||||
Sbjct: 23965949 cctggccctgcgccggcgcggcggcggc 23965922



to top

>gb|AC126221.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0015N19,
              complete sequence
          Length = 168430

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 148937 aggaggaggagggggaagaa 148918



to top

>gb|AC104407.3| Homo sapiens BAC clone RP11-92A5 from 4, complete sequence
          Length = 102822

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 7997 aggaggaggagggggaagaa 7978



to top

>gb|AC008732.9| Homo sapiens chromosome 16 clone CTD-2519M14, complete sequence
          Length = 185158

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 103623 aggaggaggagggggaagaa 103604



to top

>emb|BX831033.1|CNS09YWD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS51ZC01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2545

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  caggaggaggagggggaaga 194
            ||||||||||||||||||||
Sbjct: 1868 caggaggaggagggggaaga 1849



to top

>gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, complete sequence
          Length = 191827

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 168    ggtgcagcaggaggaggaggggga 191
              ||||||| ||||||||||||||||
Sbjct: 126260 ggtgcaggaggaggaggaggggga 126237



to top

>gb|AC154744.2| Mus musculus BAC clone RP24-394N17 from chromosome 12, complete sequence
          Length = 165140

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 132338 aggaggaggagggggaagaa 132319



to top

>gb|AC155247.2| Mus musculus BAC clone RP24-302C23 from chromosome 12, complete
            sequence
          Length = 144348

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 7677 aggaggaggagggggaagaa 7658



to top

>gb|AC153986.8| Mus musculus 6 BAC RP24-105F24 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 162415

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 42345 aggaggaggagggggaagaa 42326



to top

>gb|AC133183.3| Mus musculus BAC clone RP24-185O19 from chromosome 12, complete
             sequence
          Length = 182948

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   gcagcaggaggaggaggggg 190
             ||||||||||||||||||||
Sbjct: 60721 gcagcaggaggaggaggggg 60702



to top

>gb|AF324887.1|AF324887 Anas platyrhynchos lecithin cholesterol acyltransferase mRNA,
            complete cds
          Length = 1953

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 180  ggaggagggggaagaactga 199
            ||||||||||||||||||||
Sbjct: 1338 ggaggagggggaagaactga 1357



to top

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   ggcgcggcagcggcagaagc 238
             ||||||||||||||||||||
Sbjct: 48383 ggcgcggcagcggcagaagc 48364



to top

>gb|AC084125.9| Homo sapiens chromosome 8, clone CTD-2517M22, complete sequence
          Length = 197294

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 54559 aggaggaggagggggaagaa 54540



to top

>gb|AC011507.3|AC011507 Homo sapiens chromosome 19 clone CTD-2131C11, complete sequence
          Length = 129643

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   gtgcagcaggaggaggaggg 188
             ||||||||||||||||||||
Sbjct: 58501 gtgcagcaggaggaggaggg 58482



to top

>dbj|AP003767.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0036F10
          Length = 149415

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 51    cgacatggcgacgacgagcgagtc 74
             ||||||||||||| ||||||||||
Sbjct: 12781 cgacatggcgacgtcgagcgagtc 12804



to top

>dbj|AP003487.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0007O20
          Length = 147363

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 51     cgacatggcgacgacgagcgagtc 74
              ||||||||||||| ||||||||||
Sbjct: 103124 cgacatggcgacgtcgagcgagtc 103147



to top

>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0015I14
          Length = 150650

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   gcagcaggaggaggagggggaaga 194
             ||||||||||||||||| ||||||
Sbjct: 59925 gcagcaggaggaggaggaggaaga 59948



to top

>dbj|AP005860.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OJ1134_E08
          Length = 153002

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 171    gcagcaggaggaggagggggaaga 194
              ||||||||||||||||| ||||||
Sbjct: 142895 gcagcaggaggaggaggaggaaga 142918



to top

>dbj|AP004063.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
           BAC clone:OJ1476_F05
          Length = 125426

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 205 cctggccccgcgccggcgcggcagcggc 232
           |||||||| ||||||||||||| |||||
Sbjct: 987 cctggccctgcgccggcgcggcggcggc 960



to top

>dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0496E03
          Length = 138622

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 205   cctggccccgcgccggcgcggcagcggc 232
             |||||||| ||||||||||||| |||||
Sbjct: 99913 cctggccctgcgccggcgcggcggcggc 99886



to top

>emb|AL663069.10| Mouse DNA sequence from clone RP23-410P8 on chromosome 11, complete
             sequence
          Length = 55963

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 36908 aggaggaggagggggaagaa 36927



to top

>emb|AL732612.28| Mouse DNA sequence from clone RP23-31L20 on chromosome 11, complete
             sequence
          Length = 145244

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 65179 aggaggaggagggggaagaa 65198



to top

>emb|AL928619.6| Zebrafish DNA sequence from clone CH211-63I20, complete sequence
          Length = 158847

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   gcagcaggaggaggaggggg 190
             ||||||||||||||||||||
Sbjct: 14735 gcagcaggaggaggaggggg 14716



to top

>dbj|AB023044.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD22
          Length = 87180

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   caggaggaggagggggaaga 194
             ||||||||||||||||||||
Sbjct: 84192 caggaggaggagggggaaga 84211



to top

>dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1479_B11
          Length = 105702

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 263    tcctcgacgccctcccctcc 282
              ||||||||||||||||||||
Sbjct: 105702 tcctcgacgccctcccctcc 105683



to top

>dbj|AK122318.1| Mus musculus mRNA for mKIAA0587 protein
          Length = 5723

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 4194 aggaggaggagggggaagaa 4175



to top

>dbj|AK109544.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-D08, full
            insert sequence
          Length = 2223

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 51   cgacatggcgacgacgagcgagtc 74
            ||||||||||||| ||||||||||
Sbjct: 1618 cgacatggcgacgtcgagcgagtc 1641



to top

>dbj|AK100974.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143D04, full
           insert sequence
          Length = 4039

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 171 gcagcaggaggaggagggggaaga 194
           ||||||||||||||||| ||||||
Sbjct: 410 gcagcaggaggaggaggaggaaga 433



to top

>gb|AC154173.3| Mus musculus BAC clone RP23-3C4 from 3, complete sequence
          Length = 214016

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 156135 aggaggaggagggggaagaa 156116



to top

>emb|AL356021.4|CNS05TDB Human chromosome 14 DNA sequence BAC R-783L4 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 184656

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 24741 aggaggaggagggggaagaa 24760



to top

>gb|AC114624.24| Mus musculus chromosome 5, clone RP24-106K21, complete sequence
          Length = 197077

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   gcagcaggaggaggaggggg 190
             ||||||||||||||||||||
Sbjct: 61999 gcagcaggaggaggaggggg 61980



to top

>dbj|AP001892.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-49M9, complete
            sequences
          Length = 144308

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 1321 aggaggaggagggggaagaa 1340



to top

>dbj|AP000798.4| Homo sapiens genomic DNA, chromosome 11q, clone:CMB9-43E2, complete
             sequences
          Length = 113054

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 47806 aggaggaggagggggaagaa 47825



to top

>dbj|AP006181.2| Homo sapiens genomic DNA, chromosome 8q24.2, clone: KPchr8gap10,
            complete sequence
          Length = 5070

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 1703 aggaggaggagggggaagaa 1722



to top

>emb|CT030172.10| Mouse DNA sequence from clone RP23-313L22 on chromosome 13, complete
             sequence
          Length = 228833

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 99288 aggaggaggagggggaagaa 99269



to top

>emb|CT486001.10| Mouse DNA sequence from clone RP23-343G13 on chromosome 17, complete
            sequence
          Length = 175737

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  aggaggaggagggggaagaa 195
            ||||||||||||||||||||
Sbjct: 2854 aggaggaggagggggaagaa 2835



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 54      catggcgacgacgagcgagt 73
               ||||||||||||||||||||
Sbjct: 1985262 catggcgacgacgagcgagt 1985281



to top

>emb|BX321909.3| Mouse DNA sequence from clone RP23-443D3 on chromosome 2, complete
             sequence
          Length = 82074

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 66638 aggaggaggagggggaagaa 66657



to top

>emb|AL773563.12| Mouse DNA sequence from clone RP23-414L19 on chromosome 2, complete
             sequence
          Length = 184665

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   gcagcaggaggaggagggggaaga 194
             ||||||||||||||||| ||||||
Sbjct: 73496 gcagcaggaggaggaggaggaaga 73519



to top

>gb|AC135859.4| Mus musculus BAC clone RP24-151D9 from 10, complete sequence
          Length = 182809

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 43759 aggaggaggagggggaagaa 43740



to top

>gb|AC134448.4| Mus musculus BAC clone RP24-186G11 from 3, complete sequence
          Length = 160223

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 171   gcagcaggaggaggagggggaaga 194
             ||||||||||||||||| ||||||
Sbjct: 18175 gcagcaggaggaggaggaggaaga 18198



to top

>emb|CT010463.9| Mouse DNA sequence from clone RP23-193M19 on chromosome 12, complete
              sequence
          Length = 250364

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 229035 aggaggaggagggggaagaa 229016



to top

>gb|AC123062.4| Mus musculus BAC clone RP23-218A9 from 13, complete sequence
          Length = 186601

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 56644 aggaggaggagggggaagaa 56663



to top

>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete
             sequence
          Length = 129438

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 30328 aggaggaggagggggaagaa 30347



to top

>emb|AL591067.35| Mouse DNA sequence from clone RP23-333D2 on chromosome 11, complete
              sequence
          Length = 196512

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 186863 aggaggaggagggggaagaa 186882



to top

>gb|AC136424.1| Homo sapiens chromosome 5 clone CTD-2363C16, complete sequence
          Length = 93767

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 13530 aggaggaggagggggaagaa 13549



to top

>emb|AL683893.26| Mouse DNA sequence from clone RP23-122N18 on chromosome 4, complete
             sequence
          Length = 204841

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 49128 aggaggaggagggggaagaa 49147



to top

>emb|AL844838.7| Mouse DNA sequence from clone RP23-263E15 on chromosome 2, complete
              sequence
          Length = 168977

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 255    gcaggctttcctcgacgccc 274
              ||||||||||||||||||||
Sbjct: 158641 gcaggctttcctcgacgccc 158660



to top

>emb|AL391261.3|CNS06C85 Human chromosome 14 DNA sequence BAC C-2014B16 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 162144

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aggaggaggagggggaagaa 195
             ||||||||||||||||||||
Sbjct: 43303 aggaggaggagggggaagaa 43284



to top

>emb|X07177.1|MCISDNA Mouse cis-acting DNA element controlling expression of TCR
           beta-chain
          Length = 913

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 181 gaggagggggaagaactgat 200
           ||||||||||||||||||||
Sbjct: 93  gaggagggggaagaactgat 74



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 168     ggtgcagcaggaggaggaggggga 191
               ||||||||||||| ||||||||||
Sbjct: 2104846 ggtgcagcaggagcaggaggggga 2104823



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 168     ggtgcagcaggaggaggaggggga 191
               ||||||||||||| ||||||||||
Sbjct: 2101423 ggtgcagcaggagcaggaggggga 2101400



to top

>emb|AL731703.16| Mouse DNA sequence from clone RP23-100O16 on chromosome 2, complete
             sequence
          Length = 187541

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   caggaggaggagggggaaga 194
             ||||||||||||||||||||
Sbjct: 82946 caggaggaggagggggaaga 82927



to top

>gb|AC165249.2| Mus musculus BAC clone RP24-157P13 from chromosome 12, complete sequence
          Length = 193902

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    aggaggaggagggggaagaa 195
              ||||||||||||||||||||
Sbjct: 190749 aggaggaggagggggaagaa 190730



to top

>dbj|D11458.1|NEUUVS2 N.crassa uvs-2 gene for UVS-2 protein, complete cds
          Length = 2231

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 171  gcagcaggaggaggaggggg 190
            ||||||||||||||||||||
Sbjct: 1475 gcagcaggaggaggaggggg 1494


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,599,744
Number of Sequences: 3902068
Number of extensions: 5599744
Number of successful extensions: 156891
Number of sequences better than 10.0: 182
Number of HSP's better than 10.0 without gapping: 187
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 155317
Number of HSP's gapped (non-prelim): 1569
length of query: 615
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 592
effective length of database: 17,143,297,704
effective search space: 10148832240768
effective search space used: 10148832240768
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top