>gb|AC169376.2| Sorghum bicolor clone SB_BBc0046M17, complete sequence
          Length = 127914

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 13    atgagggccgagctggacgccgtcatacagcccacgtccatccaggc 59
             |||||| |||| |||||| || |||| ||||||||||||||||||||
Sbjct: 12333 atgaggtccgacctggactccatcatccagcccacgtccatccaggc 12379

>gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence
          Length = 257036

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   agtcctgatgcttaattatg 194
             ||||||||||||||||||||
Sbjct: 85077 agtcctgatgcttaattatg 85058

>emb|AL359914.14| Human DNA sequence from clone RP11-637B23 on chromosome X Contains a H3
              histone, family 3B (H3F3B) pseudogene, the BMP15 gene for
              bone morphogenetic protein 15, and a high-mobility group
              box 1 (HMGB1) pseudogene, complete sequence
          Length = 125495

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    ccagctgacaggcagaataa 254
              ||||||||||||||||||||
Sbjct: 124788 ccagctgacaggcagaataa 124807

>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29
          Length = 303550

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     gggccgagctggacgccgtc 36
              ||||||||||||||||||||
Sbjct: 184942 gggccgagctggacgccgtc 184961

>gb|AC068629.35| Homo sapiens 12 BAC RP11-162A11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191117

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     atacagcccacgtccatcca 56
              ||||||||||||||||||||
Sbjct: 114392 atacagcccacgtccatcca 114411

>gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosome 12, complete sequence
          Length = 156014

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    agtcctgatgcttaattatg 194
              ||||||||||||||||||||
Sbjct: 115212 agtcctgatgcttaattatg 115193

>dbj|AK043962.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830060H14
           product:unclassifiable, full insert sequence
          Length = 1586

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 175 agtcctgatgcttaattatg 194
           ||||||||||||||||||||
Sbjct: 662 agtcctgatgcttaattatg 681

>gb|AC114488.3| Homo sapiens chromosome 1 clone RP11-73M7, complete sequence
          Length = 184854

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     atacagcccacgtccatcca 56
              ||||||||||||||||||||
Sbjct: 142403 atacagcccacgtccatcca 142422


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,885,678
Number of Sequences: 3902068
Number of extensions: 1885678
Number of successful extensions: 26082
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26070
Number of HSP's gapped (non-prelim): 12
length of query: 285
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 263
effective length of database: 17,147,199,772
effective search space: 4509713540036
effective search space used: 4509713540036
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)