>emb|AL159974.21| Human DNA sequence from clone RP11-255E21 on chromosome 13 Contains the
3' end of the C13orf10 gene for chromosome 13 open reading
frame 10, complete sequence
Length = 165326
Score = 42.1 bits (21), Expect = 1.7
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 340 actcccttatttccactgccaaacc 364
||||||||| |||||||||||||||
Sbjct: 75148 actcccttaattccactgccaaacc 75172
>emb|AL512593.9| Human DNA sequence from clone RP11-508N12 on chromosome 9 Contains two
novel genes, the gene for a novel zinc finger protein
(FLJ14960, KIAA1803), a ribosomal protein L7a (RPL7A)
pseudogene and the 3' end of a novel gene, complete
sequence
Length = 148816
Score = 40.1 bits (20), Expect = 6.9
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 224 tgaggcccttactttgatca 243
||||||||||||||||||||
Sbjct: 36960 tgaggcccttactttgatca 36941
>emb|AL645973.8| Mouse DNA sequence from clone RP23-287B6 on chromosome 11 Contains a
pseudogene similar to part of ribosomal protein S2 (Rps2),
a mitchondrial ribosomal protein S7 (Rpms7, MRP-S7)
(Mrps7) pseudogene, a pseudogene similar to part of a
novel protein, a novel gene and a eukaryotic translation
initiation factor pseudogene, complete sequence
Length = 196006
Score = 40.1 bits (20), Expect = 6.9
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 213 aaagttttgcctgaggccct 232
||||||||||||||||||||
Sbjct: 46195 aaagttttgcctgaggccct 46176
>dbj|AP002358.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-1036E20, complete
sequences
Length = 190904
Score = 40.1 bits (20), Expect = 6.9
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 455 tgcatcaactattgaaatgcttaa 478
||||||||||||||||||| ||||
Sbjct: 133062 tgcatcaactattgaaatgattaa 133085
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,524,566
Number of Sequences: 3902068
Number of extensions: 4524566
Number of successful extensions: 73658
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73445
Number of HSP's gapped (non-prelim): 192
length of query: 509
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 487
effective length of database: 17,147,199,772
effective search space: 8350686288964
effective search space used: 8350686288964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)