| Clone Name | baal19h03 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_468587.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 157 bits (79), Expect = 2e-35 Identities = 139/159 (87%) Strand = Plus / Plus Query: 1 ctctcccgcttcccggactccggcaacttccgcggcctcgccttcgtcaccttcgagtca 60 ||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 310 ctctctcgcttcccggactccggcaacttccgcggcctcgcgttcgtctccttcgagtca 369 Query: 61 gatgaagttgccctgaaatctctggagcttgatggatacaaaattggtaacaggtttatg 120 | || || | |||| ||||| |||||||| |||| ||||||||| |||||||||||| Sbjct: 370 aacgaggtggtaatgaagtctcttgagcttgacggattcaaaattggcaacaggtttatg 429 Query: 121 agggttgaaagatgcaggattactgctagctcgaagagg 159 || ||||||||||||||| | ||||| ||||||||||| Sbjct: 430 agagttgaaagatgcaggttggctgctggctcgaagagg 468
>dbj|AK066740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013082B19, full insert sequence Length = 1092 Score = 157 bits (79), Expect = 2e-35 Identities = 139/159 (87%) Strand = Plus / Plus Query: 1 ctctcccgcttcccggactccggcaacttccgcggcctcgccttcgtcaccttcgagtca 60 ||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 446 ctctctcgcttcccggactccggcaacttccgcggcctcgcgttcgtctccttcgagtca 505 Query: 61 gatgaagttgccctgaaatctctggagcttgatggatacaaaattggtaacaggtttatg 120 | || || | |||| ||||| |||||||| |||| ||||||||| |||||||||||| Sbjct: 506 aacgaggtggtaatgaagtctcttgagcttgacggattcaaaattggcaacaggtttatg 565 Query: 121 agggttgaaagatgcaggattactgctagctcgaagagg 159 || ||||||||||||||| | ||||| ||||||||||| Sbjct: 566 agagttgaaagatgcaggttggctgctggctcgaagagg 604
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Plus Query: 1 ctctcccgcttcccggactccggcaacttccgcggcctcgccttcgtcaccttcgag 57 ||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||| Sbjct: 1302677 ctctctcgcttcccggactccggcaacttccgcggcctcgcgttcgtctccttcgag 1302733 Score = 61.9 bits (31), Expect = 1e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 109 aacaggtttatgagggttgaaagatgcaggattactgctagctcgaagagg 159 |||||||||||||| ||||||||||||||| | ||||| ||||||||||| Sbjct: 1303461 aacaggtttatgagagttgaaagatgcaggttggctgctggctcgaagagg 1303511
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Plus Query: 1 ctctcccgcttcccggactccggcaacttccgcggcctcgccttcgtcaccttcgag 57 ||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||| Sbjct: 1302675 ctctctcgcttcccggactccggcaacttccgcggcctcgcgttcgtctccttcgag 1302731 Score = 61.9 bits (31), Expect = 1e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 109 aacaggtttatgagggttgaaagatgcaggattactgctagctcgaagagg 159 |||||||||||||| ||||||||||||||| | ||||| ||||||||||| Sbjct: 1303459 aacaggtttatgagagttgaaagatgcaggttggctgctggctcgaagagg 1303509
>gb|AC098695.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1126B12, complete sequence Length = 146241 Score = 89.7 bits (45), Expect = 5e-15 Identities = 54/57 (94%) Strand = Plus / Plus Query: 1 ctctcccgcttcccggactccggcaacttccgcggcctcgccttcgtcaccttcgag 57 ||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||| Sbjct: 107579 ctctctcgcttcccggactccggcaacttccgcggcctcgcgttcgtctccttcgag 107635 Score = 61.9 bits (31), Expect = 1e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 109 aacaggtttatgagggttgaaagatgcaggattactgctagctcgaagagg 159 |||||||||||||| ||||||||||||||| | ||||| ||||||||||| Sbjct: 108363 aacaggtttatgagagttgaaagatgcaggttggctgctggctcgaagagg 108413
>gb|BT018692.1| Zea mays clone EL01N0512E07.d mRNA sequence Length = 1700 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Plus Query: 202 ggctgcctctcggcttatgtcggcaatctctcatggaacatcagtgagaaggatttgaga 261 |||||||||||||||||||| || ||||||| ||||||| ||| ||| || || ||| || Sbjct: 79 ggctgcctctcggcttatgttggtaatctcttatggaacgtcattgaaaatgacttgcga 138 Query: 262 gatttcttca 271 |||||||||| Sbjct: 139 gatttcttca 148
>gb|AY110713.1| Zea mays CL7875_1 mRNA sequence Length = 655 Score = 60.0 bits (30), Expect = 4e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 191 agaagcccgatggctgcctctcggcttatgtcggcaatctctcatggaac 240 ||||| |||| |||||||||||||| ||||| ||||| |||||||||||| Sbjct: 602 agaagtccgaaggctgcctctcggcatatgttggcaacctctcatggaac 553
>gb|AC164954.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940128D9, complete sequence Length = 128585 Score = 42.1 bits (21), Expect = 0.96 Identities = 27/29 (93%) Strand = Plus / Plus Query: 18 ctccggcaacttccgcggcctcgccttcg 46 |||||||||||||| |||||||| ||||| Sbjct: 63500 ctccggcaacttcctcggcctcgacttcg 63528
>gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, complete sequence Length = 218156 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 tatgagggttgaaagatgca 136 |||||||||||||||||||| Sbjct: 57070 tatgagggttgaaagatgca 57089
>gb|AC147132.3| Mus musculus BAC clone RP24-189K3 from chromosome 7, complete sequence Length = 189225 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 aaattggtaacaggtttatg 120 |||||||||||||||||||| Sbjct: 91568 aaattggtaacaggtttatg 91549
>gb|AC132462.4| Mus musculus BAC clone RP23-35F22 from chromosome 7, complete sequence Length = 194641 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 38 tcgccttcgtcaccttcgag 57 |||||||||||||||||||| Sbjct: 97151 tcgccttcgtcaccttcgag 97132
>gb|AC147638.2| Mus musculus BAC clone RP23-181L5 from chromosome 7, complete sequence Length = 196114 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 aaattggtaacaggtttatg 120 |||||||||||||||||||| Sbjct: 4386 aaattggtaacaggtttatg 4367
>ref|XM_909704.2| PREDICTED: Mus musculus RIKEN cDNA 1700012H05 gene (1700012H05Rik), mRNA Length = 1612 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 tcgccttcgtcaccttcgag 57 |||||||||||||||||||| Sbjct: 492 tcgccttcgtcaccttcgag 511
>emb|AL138744.41| Human DNA sequence from clone RP13-257M1 on chromosome Xp11.23-11.4 Contains part of the UTX gene for ubiquitously transcribed tetratricopeptide repeat gene X chromosome and a CpG island, complete sequence Length = 143968 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 255 tttgagagatttcttcaaat 274 |||||||||||||||||||| Sbjct: 31412 tttgagagatttcttcaaat 31431
>ref|NM_029660.1| Mus musculus RIKEN cDNA 1700012H05 gene (1700012H05Rik), mRNA Length = 1473 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 tcgccttcgtcaccttcgag 57 |||||||||||||||||||| Sbjct: 218 tcgccttcgtcaccttcgag 237
>dbj|AK005907.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700012H05 product:TESTES SPECIFIC HETEROGENOUS NUCLEAR RIBONUCLEOPROTEIN G-T homolog [Homo sapiens], full insert sequence Length = 1473 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 tcgccttcgtcaccttcgag 57 |||||||||||||||||||| Sbjct: 218 tcgccttcgtcaccttcgag 237
>emb|Z78015.1|CER02D5 Caenorhabditis elegans Cosmid R02D5, complete sequence Length = 41076 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 agatgaagttgccctgaaat 79 |||||||||||||||||||| Sbjct: 1906 agatgaagttgccctgaaat 1887
>gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, complete sequence Length = 209693 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 tatgagggttgaaagatgca 136 |||||||||||||||||||| Sbjct: 126646 tatgagggttgaaagatgca 126627 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,471,962 Number of Sequences: 3902068 Number of extensions: 2471962 Number of successful extensions: 50050 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 50000 Number of HSP's gapped (non-prelim): 48 length of query: 291 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 269 effective length of database: 17,147,199,772 effective search space: 4612596738668 effective search space used: 4612596738668 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)