ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal19f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL731717.11| Mouse DNA sequence from clone RP23-92C4 on chro... 42 1.4
2ref|NM_105539.2| Arabidopsis thaliana DNA binding / transcriptio... 40 5.7
3ref|NM_001037165.1| Homo sapiens forkhead box K1 (FOXK1), mRNA 40 5.7
4gb|AC146162.2| Pan troglodytes BAC clone RP43-23P8 from 7, compl... 40 5.7
5gb|AC092610.1| Homo sapiens BAC clone RP11-160E17 from 7, comple... 40 5.7
6gb|AC145939.3| Pan troglodytes BAC clone RP43-18N13 from 7, comp... 40 5.7
7emb|CR956629.5| Pig DNA sequence from clone PigE-42A23 on chromo... 40 5.7
8emb|AL606753.12| Human DNA sequence from clone RP11-2P2 on chrom... 40 5.7
9emb|AL590362.12| Human DNA sequence from clone RP11-214G2 on chr... 40 5.7
10gb|AY091241.1| Arabidopsis thaliana unknown protein (At1g68670) ... 40 5.7
11gb|AY063886.1| Arabidopsis thaliana unknown protein (At1g68670) ... 40 5.7
12gb|AC062004.5| Homo sapiens chromosome 8, clone RP11-325O20, com... 40 5.7
13gb|AY087993.1| Arabidopsis thaliana clone 40196 mRNA, complete s... 40 5.7
14gb|AY259595.1| Cyclanorbis elegans R35 neural transmitter gene, ... 40 5.7
15gb|AY259594.1| Cyclanorbis senegalensis R35 neural transmitter g... 40 5.7
16gb|AY259593.1| Lissemys punctata R35 neural transmitter gene, in... 40 5.7
17gb|AY259592.1| Lissemys scutata R35 neural transmitter gene, int... 40 5.7
18gb|AC008075.2|F24J5 Arabidopsis thaliana chromosome 1 BAC F24J5 ... 40 5.7
19gb|AC146130.4| Pan troglodytes BAC clone RP43-4F10 from chromoso... 40 5.7
20emb|AL390254.6|CNS06C7M Human chromosome 14 DNA sequence BAC R-9... 40 5.7

>emb|AL731717.11| Mouse DNA sequence from clone RP23-92C4 on chromosome X, complete
             sequence
          Length = 234900

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 322   tttgctctcctggcagtttga 342
             |||||||||||||||||||||
Sbjct: 23825 tttgctctcctggcagtttga 23845



to top

>ref|NM_105539.2| Arabidopsis thaliana DNA binding / transcription factor AT1G68670
           mRNA, complete cds
          Length = 1528

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 ggttgcaaatcagtctccaa 195
           ||||||||||||||||||||
Sbjct: 762 ggttgcaaatcagtctccaa 743



to top

>ref|NM_001037165.1| Homo sapiens forkhead box K1 (FOXK1), mRNA
          Length = 11191

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 286  agaggaggtggtgccgaggg 305
            ||||||||||||||||||||
Sbjct: 2483 agaggaggtggtgccgaggg 2464



to top

>gb|AC146162.2| Pan troglodytes BAC clone RP43-23P8 from 7, complete sequence
          Length = 183434

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   agaggaggtggtgccgaggg 305
             ||||||||||||||||||||
Sbjct: 56126 agaggaggtggtgccgaggg 56107



to top

>gb|AC092610.1| Homo sapiens BAC clone RP11-160E17 from 7, complete sequence
          Length = 162018

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   agaggaggtggtgccgaggg 305
             ||||||||||||||||||||
Sbjct: 17892 agaggaggtggtgccgaggg 17873



to top

>gb|AC145939.3| Pan troglodytes BAC clone RP43-18N13 from 7, complete sequence
          Length = 187077

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 286    agaggaggtggtgccgaggg 305
              ||||||||||||||||||||
Sbjct: 130952 agaggaggtggtgccgaggg 130971



to top

>emb|CR956629.5| Pig DNA sequence from clone PigE-42A23 on chromosome 7, complete
             sequence
          Length = 156529

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   agaaataagattgagaagaa 267
             ||||||||||||||||||||
Sbjct: 96611 agaaataagattgagaagaa 96592



to top

>emb|AL606753.12| Human DNA sequence from clone RP11-2P2 on chromosome 1 Contains the 5'
             end of the PLXNA2 gene for plexin A2 and a heterogeneous
             nuclear ribonucleoprotein D-like (HNRPDL) pseudogene,
             complete sequence
          Length = 66984

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   ctgtcagaaataagattgag 262
             ||||||||||||||||||||
Sbjct: 33814 ctgtcagaaataagattgag 33795



to top

>emb|AL590362.12| Human DNA sequence from clone RP11-214G2 on chromosome 9 Contains a CpG
             island, complete sequence
          Length = 154698

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   gtgatggttgcaaatcagtc 190
             ||||||||||||||||||||
Sbjct: 80131 gtgatggttgcaaatcagtc 80112



to top

>gb|AY091241.1| Arabidopsis thaliana unknown protein (At1g68670) mRNA, complete cds
          Length = 1096

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 ggttgcaaatcagtctccaa 195
           ||||||||||||||||||||
Sbjct: 500 ggttgcaaatcagtctccaa 481



to top

>gb|AY063886.1| Arabidopsis thaliana unknown protein (At1g68670) mRNA, complete cds
          Length = 1462

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 ggttgcaaatcagtctccaa 195
           ||||||||||||||||||||
Sbjct: 762 ggttgcaaatcagtctccaa 743



to top

>gb|AC062004.5| Homo sapiens chromosome 8, clone RP11-325O20, complete sequence
          Length = 205646

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    ttaaaagtttgaatttatat 41
             ||||||||||||||||||||
Sbjct: 43864 ttaaaagtttgaatttatat 43845



to top

>gb|AY087993.1| Arabidopsis thaliana clone 40196 mRNA, complete sequence
          Length = 1495

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 ggttgcaaatcagtctccaa 195
           ||||||||||||||||||||
Sbjct: 729 ggttgcaaatcagtctccaa 710



to top

>gb|AY259595.1| Cyclanorbis elegans R35 neural transmitter gene, intron 1
          Length = 985

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 50  tcaaacaccattgacatagagatg 73
           |||||| |||||||||||||||||
Sbjct: 663 tcaaaccccattgacatagagatg 686



to top

>gb|AY259594.1| Cyclanorbis senegalensis R35 neural transmitter gene, intron 1
          Length = 991

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 50  tcaaacaccattgacatagagatg 73
           |||||| |||||||||||||||||
Sbjct: 669 tcaaaccccattgacatagagatg 692



to top

>gb|AY259593.1| Lissemys punctata R35 neural transmitter gene, intron 1
          Length = 986

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 50  tcaaacaccattgacatagagatg 73
           |||||| |||||||||||||||||
Sbjct: 664 tcaaaccccattgacatagagatg 687



to top

>gb|AY259592.1| Lissemys scutata R35 neural transmitter gene, intron 1
          Length = 984

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 50  tcaaacaccattgacatagagatg 73
           |||||| |||||||||||||||||
Sbjct: 663 tcaaaccccattgacatagagatg 686



to top

>gb|AC008075.2|F24J5 Arabidopsis thaliana chromosome 1 BAC F24J5 sequence, complete sequence
          Length = 98942

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   ggttgcaaatcagtctccaa 195
             ||||||||||||||||||||
Sbjct: 46214 ggttgcaaatcagtctccaa 46233



to top

>gb|AC146130.4| Pan troglodytes BAC clone RP43-4F10 from chromosome 7, complete sequence
          Length = 204322

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 286    agaggaggtggtgccgaggg 305
              ||||||||||||||||||||
Sbjct: 172398 agaggaggtggtgccgaggg 172417



to top

>emb|AL390254.6|CNS06C7M Human chromosome 14 DNA sequence BAC R-991C1 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 177792

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 400   atgcatgcttattagggagc 419
             ||||||||||||||||||||
Sbjct: 25997 atgcatgcttattagggagc 26016


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,633,557
Number of Sequences: 3902068
Number of extensions: 3633557
Number of successful extensions: 65652
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65623
Number of HSP's gapped (non-prelim): 29
length of query: 424
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 402
effective length of database: 17,147,199,772
effective search space: 6893174308344
effective search space used: 6893174308344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top