ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baal18j03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY107174.1| Zea mays PCO092707 mRNA sequence Length = 909 Score = 299 bits (151), Expect = 5e-78 Identities = 379/455 (83%) Strand = Plus / Plus Query: 22 gggaaggagcctgttgctctctcaattgatcagaagcctgacaggaaggatgagcgcgcg 81 ||||||||||| || | || || |||||||| ||||||||||||||||||||||||||| Sbjct: 101 gggaaggagccagtagagctgtcgattgatcacaagcctgacaggaaggatgagcgcgcg 160 Query: 82 aggattgaggctgcgggaggcaaggtcatccaatggaatggacaccgagtgtccgggata 141 ||||||||||| |||||||||||||||||||||||| || | | || ||||| ||| Sbjct: 161 aggattgaggccctgggaggcaaggtcatccaatggaacggctatagggtctccggtata 220 Query: 142 cttgctatgtcacgatccattggtgaccgatacttgaagccatacatcattccaaaacca 201 |||||||||||| |||| ||||| |||||||| ||||| |||| | |||||||||||||| Sbjct: 221 cttgctatgtcaagatcgattggggaccgatatttgaaaccattcgtcattccaaaacca 280 Query: 202 gaagttacagttgttcctcgggcaaaagatgatgattgtctcattctggcaagcgacggg 261 ||||| || ||||||||| |||| |||||||| || || |||||||| ||||| || ||| Sbjct: 281 gaagtcaccgttgttcctagggcgaaagatgacgactgcctcattcttgcaagtgatggg 340 Query: 262 ctttgggacgtcgtgtcgaatgaagaggcgtgtaaggttgcacgtcggcaaatccagcag 321 || ||||| || ||||||||||||||||| || || | ||| |||||||| ||||||| | Sbjct: 341 ctgtgggatgtagtgtcgaatgaagaggcatgcaaagctgcgcgtcggcagatccagctg 400 Query: 322 tggcacaagaacaacagcgttacaacatcatcgtcagatggaggcgatggatccaccgat 381 ||||||||||||||| | || ||| |||||| || || | || |||| ||||| ||| Sbjct: 401 tggcacaagaacaacggtgtcacatcatcattgtgtgacgagggtgatgaatccaatgat 460 Query: 382 cctgccgcgcaggcagctgctgactatctcgtgaggctggcgctgaagaaaggaagccag 441 ||||| || || || |||||||| ||||| ||||||| || |||||||| || | | || Sbjct: 461 cctgctgcacaagctgctgctgattatcttatgaggctcgcactgaagaagggtaccgag 520 Query: 442 gataacatcactgtaattgtggtcgacttgaaacc 476 || || |||||||| |||||||| ||||||||||| Sbjct: 521 gacaatatcactgtcattgtggttgacttgaaacc 555
>ref|XM_475780.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1164 Score = 295 bits (149), Expect = 8e-77 Identities = 392/473 (82%) Strand = Plus / Plus Query: 4 cgcatcgtgctctcgcgcgggaaggagcctgttgctctctcaattgatcagaagcctgac 63 ||||||||||||| |||||||||||||| || || | ||||||||||| ||||||||| Sbjct: 664 cgcatcgtgctctgccgcgggaaggagcccgtagccttgtcaattgatcacaagcctgac 723 Query: 64 aggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtcatccaatggaatgga 123 |||||||||||||| || |||||||| || ||||||||||||||||||||||||||| Sbjct: 724 aggaaggatgagcgggcaaggattgaagcccagggaggcaaggtcatccaatggaatggt 783 Query: 124 caccgagtgtccgggatacttgctatgtcacgatccattggtgaccgatacttgaagcca 183 |||| |||||||| |||||||||||||| ||||| || ||||| || || |||| ||| Sbjct: 784 taccgggtgtccggtatacttgctatgtcccgatcaatcggtgatcgctatctgaaacca 843 Query: 184 tacatcattccaaaaccagaagttacagttgttcctcgggcaaaagatgatgattgtctc 243 | ||||||||||||| ||||||| || ||||| ||||| || |||||||| ||||| Sbjct: 844 tttgtcattccaaaaccggaagttatggtcgttccacgggcgaaggatgatgactgtctt 903 Query: 244 attctggcaagcgacgggctttgggacgtcgtgtcgaatgaagaggcgtgtaaggttgca 303 ||||| |||||||| ||||| ||||| || ||||| ||||||||||| || || || ||| Sbjct: 904 attctagcaagcgatgggctgtgggatgttgtgtcaaatgaagaggcatgcaaagtcgca 963 Query: 304 cgtcggcaaatccagcagtggcacaagaacaacagcgttacaacatcatcgtcagatgga 363 || || || |||| | ||||||||||||||| ||| | || || ||| ||| |||| Sbjct: 964 cgccgacagatccttctgtggcacaagaacaatggcgctgcatcaccattgtctgatgag 1023 Query: 364 ggcgatggatccaccgatcctgccgcgcaggcagctgctgactatctcgtgaggctggcg 423 || || ||||||||||| ||||| || || |||||||| || ||||| |||| || || Sbjct: 1024 ggtgaaggatccaccgaccctgctgcccaagcagctgccgattatctgatgagactcgct 1083 Query: 424 ctgaagaaaggaagccaggataacatcactgtaattgtggtcgacttgaaacc 476 ||||||||||| ||| |||||||||||||||| ||||| |||||||||||||| Sbjct: 1084 ctgaagaaaggcagcgaggataacatcactgtcattgttgtcgacttgaaacc 1136
>gb|AY105241.1| Zea mays PCO129205 mRNA sequence Length = 718 Score = 176 bits (89), Expect = 5e-41 Identities = 233/281 (82%) Strand = Plus / Plus Query: 56 agcctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtcatccaat 115 ||||||||||||||||||| || |||||||||||||| ||| || ||||||||||||| Sbjct: 37 agcctgacaggaaggatgaacgagcgaggattgaggccctggggggaaaggtcatccaat 96 Query: 116 ggaatggacaccgagtgtccgggatacttgctatgtcacgatccattggtgaccgatact 175 ||||||| |||| || ||||| ||||||||||||||| |||| ||||| ||||| || Sbjct: 97 ggaatggctaccgggtctccggtatacttgctatgtcaagatcgattggggaccggtatc 156 Query: 176 tgaagccatacatcattccaaaaccagaagttacagttgttcctcgggcaaaagatgatg 235 ||||||| | | || ||||||||||||| || || || ||||| |||| |||||||| | Sbjct: 157 tgaagccgttcgtcgttccaaaaccagaggtcacggtggttcccagggcgaaagatgacg 216 Query: 236 attgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatgaagaggcgtgta 295 | |||||||| || |||||||| ||||| ||||| || ||| |||| || |||||||| | Sbjct: 217 actgtctcatcctcgcaagcgatgggctgtgggatgtggtgacgaacgaggaggcgtgca 276 Query: 296 aggttgcacgtcggcaaatccagcagtggcacaagaacaac 336 | | ||| || ||||||||||| |||||||||||||||| Sbjct: 277 aagctgcgcgccggcaaatccaagtgtggcacaagaacaac 317
>gb|AC119291.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052K01, complete sequence Length = 144395 Score = 161 bits (81), Expect = 3e-36 Identities = 237/289 (82%) Strand = Plus / Minus Query: 188 tcattccaaaaccagaagttacagttgttcctcgggcaaaagatgatgattgtctcattc 247 ||||||||||||| ||||||| || ||||| ||||| || |||||||| ||||| |||| Sbjct: 12469 tcattccaaaaccggaagttatggtcgttccacgggcgaaggatgatgactgtcttattc 12410 Query: 248 tggcaagcgacgggctttgggacgtcgtgtcgaatgaagaggcgtgtaaggttgcacgtc 307 | |||||||| ||||| ||||| || ||||| ||||||||||| || || || ||||| | Sbjct: 12409 tagcaagcgatgggctgtgggatgttgtgtcaaatgaagaggcatgcaaagtcgcacgcc 12350 Query: 308 ggcaaatccagcagtggcacaagaacaacagcgttacaacatcatcgtcagatggaggcg 367 | || |||| | ||||||||||||||| ||| | || || ||| ||| |||| || | Sbjct: 12349 gacagatccttctgtggcacaagaacaatggcgctgcatcaccattgtctgatgagggtg 12290 Query: 368 atggatccaccgatcctgccgcgcaggcagctgctgactatctcgtgaggctggcgctga 427 | ||||||||||| ||||| || || |||||||| || ||||| |||| || || |||| Sbjct: 12289 aaggatccaccgaccctgctgcccaagcagctgccgattatctgatgagactcgctctga 12230 Query: 428 agaaaggaagccaggataacatcactgtaattgtggtcgacttgaaacc 476 ||||||| ||| |||||||||||||||| ||||| |||||||||||||| Sbjct: 12229 agaaaggcagcgaggataacatcactgtcattgttgtcgacttgaaacc 12181 Score = 117 bits (59), Expect = 4e-23 Identities = 92/103 (89%) Strand = Plus / Minus Query: 56 agcctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtcatccaat 115 |||||||||||||||||||||| || |||||||| || |||||||||||||||||||| Sbjct: 13592 agcctgacaggaaggatgagcgggcaaggattgaagcccagggaggcaaggtcatccaat 13533 Query: 116 ggaatggacaccgagtgtccgggatacttgctatgtcacgatc 158 ||||||| |||| |||||||| |||||||||||||| ||||| Sbjct: 13532 ggaatggttaccgggtgtccggtatacttgctatgtcccgatc 13490 Score = 44.1 bits (22), Expect = 0.46 Identities = 43/50 (86%) Strand = Plus / Minus Query: 4 cgcatcgtgctctcgcgcgggaaggagcctgttgctctctcaattgatca 53 ||||||||||||| |||||||||||||| || || | ||||||||||| Sbjct: 13734 cgcatcgtgctctgccgcgggaaggagcccgtagccttgtcaattgatca 13685
>gb|AC097112.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01, complete sequence Length = 147704 Score = 161 bits (81), Expect = 3e-36 Identities = 237/289 (82%) Strand = Plus / Minus Query: 188 tcattccaaaaccagaagttacagttgttcctcgggcaaaagatgatgattgtctcattc 247 ||||||||||||| ||||||| || ||||| ||||| || |||||||| ||||| |||| Sbjct: 143685 tcattccaaaaccggaagttatggtcgttccacgggcgaaggatgatgactgtcttattc 143626 Query: 248 tggcaagcgacgggctttgggacgtcgtgtcgaatgaagaggcgtgtaaggttgcacgtc 307 | |||||||| ||||| ||||| || ||||| ||||||||||| || || || ||||| | Sbjct: 143625 tagcaagcgatgggctgtgggatgttgtgtcaaatgaagaggcatgcaaagtcgcacgcc 143566 Query: 308 ggcaaatccagcagtggcacaagaacaacagcgttacaacatcatcgtcagatggaggcg 367 | || |||| | ||||||||||||||| ||| | || || ||| ||| |||| || | Sbjct: 143565 gacagatccttctgtggcacaagaacaatggcgctgcatcaccattgtctgatgagggtg 143506 Query: 368 atggatccaccgatcctgccgcgcaggcagctgctgactatctcgtgaggctggcgctga 427 | ||||||||||| ||||| || || |||||||| || ||||| |||| || || |||| Sbjct: 143505 aaggatccaccgaccctgctgcccaagcagctgccgattatctgatgagactcgctctga 143446 Query: 428 agaaaggaagccaggataacatcactgtaattgtggtcgacttgaaacc 476 ||||||| ||| |||||||||||||||| ||||| |||||||||||||| Sbjct: 143445 agaaaggcagcgaggataacatcactgtcattgttgtcgacttgaaacc 143397 Score = 117 bits (59), Expect = 4e-23 Identities = 92/103 (89%) Strand = Plus / Minus Query: 56 agcctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtcatccaat 115 |||||||||||||||||||||| || |||||||| || |||||||||||||||||||| Sbjct: 144808 agcctgacaggaaggatgagcgggcaaggattgaagcccagggaggcaaggtcatccaat 144749 Query: 116 ggaatggacaccgagtgtccgggatacttgctatgtcacgatc 158 ||||||| |||| |||||||| |||||||||||||| ||||| Sbjct: 144748 ggaatggttaccgggtgtccggtatacttgctatgtcccgatc 144706 Score = 44.1 bits (22), Expect = 0.46 Identities = 43/50 (86%) Strand = Plus / Minus Query: 4 cgcatcgtgctctcgcgcgggaaggagcctgttgctctctcaattgatca 53 ||||||||||||| |||||||||||||| || || | ||||||||||| Sbjct: 144950 cgcatcgtgctctgccgcgggaaggagcccgtagccttgtcaattgatca 144901
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 161 bits (81), Expect = 3e-36 Identities = 237/289 (82%) Strand = Plus / Minus Query: 188 tcattccaaaaccagaagttacagttgttcctcgggcaaaagatgatgattgtctcattc 247 ||||||||||||| ||||||| || ||||| ||||| || |||||||| ||||| |||| Sbjct: 26498994 tcattccaaaaccggaagttatggtcgttccacgggcgaaggatgatgactgtcttattc 26498935 Query: 248 tggcaagcgacgggctttgggacgtcgtgtcgaatgaagaggcgtgtaaggttgcacgtc 307 | |||||||| ||||| ||||| || ||||| ||||||||||| || || || ||||| | Sbjct: 26498934 tagcaagcgatgggctgtgggatgttgtgtcaaatgaagaggcatgcaaagtcgcacgcc 26498875 Query: 308 ggcaaatccagcagtggcacaagaacaacagcgttacaacatcatcgtcagatggaggcg 367 | || |||| | ||||||||||||||| ||| | || || ||| ||| |||| || | Sbjct: 26498874 gacagatccttctgtggcacaagaacaatggcgctgcatcaccattgtctgatgagggtg 26498815 Query: 368 atggatccaccgatcctgccgcgcaggcagctgctgactatctcgtgaggctggcgctga 427 | ||||||||||| ||||| || || |||||||| || ||||| |||| || || |||| Sbjct: 26498814 aaggatccaccgaccctgctgcccaagcagctgccgattatctgatgagactcgctctga 26498755 Query: 428 agaaaggaagccaggataacatcactgtaattgtggtcgacttgaaacc 476 ||||||| ||| |||||||||||||||| ||||| |||||||||||||| Sbjct: 26498754 agaaaggcagcgaggataacatcactgtcattgttgtcgacttgaaacc 26498706 Score = 117 bits (59), Expect = 4e-23 Identities = 92/103 (89%) Strand = Plus / Minus Query: 56 agcctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtcatccaat 115 |||||||||||||||||||||| || |||||||| || |||||||||||||||||||| Sbjct: 26500117 agcctgacaggaaggatgagcgggcaaggattgaagcccagggaggcaaggtcatccaat 26500058 Query: 116 ggaatggacaccgagtgtccgggatacttgctatgtcacgatc 158 ||||||| |||| |||||||| |||||||||||||| ||||| Sbjct: 26500057 ggaatggttaccgggtgtccggtatacttgctatgtcccgatc 26500015 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 78 cgcgaggattgaggctgcgggaggcaaggtcatccaatggaatgg 122 ||||||||||||||| ||| |||||||| |||||||||||||| Sbjct: 29320169 cgcgaggattgaggcgctgggtggcaaggttatccaatggaatgg 29320125 Score = 44.1 bits (22), Expect = 0.46 Identities = 43/50 (86%) Strand = Plus / Minus Query: 4 cgcatcgtgctctcgcgcgggaaggagcctgttgctctctcaattgatca 53 ||||||||||||| |||||||||||||| || || | ||||||||||| Sbjct: 26500259 cgcatcgtgctctgccgcgggaaggagcccgtagccttgtcaattgatca 26500210 Score = 40.1 bits (20), Expect = 7.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ctggcaagcgacgggctttgggacgtcgtgtc 278 ||||| ||||||||||| |||||||| ||||| Sbjct: 28303869 ctggcgagcgacgggctgtgggacgtggtgtc 28303838
>gb|BT018289.1| Zea mays clone EL01T0205D02.c mRNA sequence Length = 1539 Score = 157 bits (79), Expect = 4e-35 Identities = 229/279 (82%) Strand = Plus / Plus Query: 58 cctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtcatccaatgg 117 ||||||||||||||||| || |||| ||||||||| ||| || ||||||||||||||| Sbjct: 709 cctgacaggaaggatgaacgagcgacgattgaggccctggggggaaaggtcatccaatgg 768 Query: 118 aatggacaccgagtgtccgggatacttgctatgtcacgatccattggtgaccgatacttg 177 |||| |||| || ||||| ||||||||||||||| |||| ||||| ||||| || || Sbjct: 769 tatggctaccgggtctccggtatacttgctatgtcaagatcgattggggaccggtatctg 828 Query: 178 aagccatacatcattccaaaaccagaagttacagttgttcctcgggcaaaagatgatgat 237 ||||| | | | |||||||||||||| || || || ||||| |||| |||||||| || Sbjct: 829 aagccgttcgtgattccaaaaccagaggtcacggtcgttcccagggcgaaagatgacgac 888 Query: 238 tgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatgaagaggcgtgtaag 297 |||||||| || |||||||| ||||| ||||| || ||| |||| |||||||| || || Sbjct: 889 tgtctcatcctcgcaagcgatgggctgtgggatgtggtgacgaacgaagaggcatgcaaa 948 Query: 298 gttgcacgtcggcaaatccagcagtggcacaagaacaac 336 | ||| || ||||||||||| |||||||||||||||| Sbjct: 949 gctgcgcgccggcaaatccaagtgtggcacaagaacaac 987
>gb|BT017295.1| Zea mays clone EL01N0315F01.c mRNA sequence Length = 1444 Score = 58.0 bits (29), Expect = 3e-05 Identities = 188/241 (78%) Strand = Plus / Plus Query: 49 gatcagaagcctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtc 108 ||||| || ||| ||||| |||||||| || ||||||||||| | ||| ||||||||| Sbjct: 746 gatcataaacctaacagggaggatgagtatgcaaggattgaggcagagggtggcaaggtc 805 Query: 109 atccaatggaatggacaccgagtgtccgggatacttgctatgtcacgatccattggtgac 168 || |||||||| || | ||||| | ||| | ||||| ||||| ||||| ||||||||| Sbjct: 806 atacaatggaacggttatcgagttttcggtgttcttgcaatgtcgcgatcaattggtgac 865 Query: 169 cgatacttgaagccatacatcattccaaaaccagaagttacagttgttcctcgggcaaaa 228 |||| ||||||||| || |||||| ||||| || ||| | ||||| ||||| || Sbjct: 866 agatatctgaagccatggataattccagtcccagaggtaacaatagttccgcgggctaag 925 Query: 229 gatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatgaagag 288 ||||| || || || ||||| || || ||||| || ||||| || |||| ||||||||| Sbjct: 926 gatgacgagtgccttattcttgccagtgacggcctctgggatgtaatgtcaaatgaagag 985 Query: 289 g 289 | Sbjct: 986 g 986
>gb|AY104084.1| Zea mays PCO105468 mRNA sequence Length = 1247 Score = 58.0 bits (29), Expect = 3e-05 Identities = 188/241 (78%) Strand = Plus / Plus Query: 49 gatcagaagcctgacaggaaggatgagcgcgcgaggattgaggctgcgggaggcaaggtc 108 ||||| || ||| ||||| |||||||| || ||||||||||| | ||| ||||||||| Sbjct: 441 gatcataaacctaacagggaggatgagtatgcaaggattgaggcagagggtggcaaggtc 500 Query: 109 atccaatggaatggacaccgagtgtccgggatacttgctatgtcacgatccattggtgac 168 || |||||||| || | ||||| | ||| | ||||| ||||| ||||| ||||||||| Sbjct: 501 atacaatggaacggttatcgagttttcggtgttcttgcaatgtcgcgatcaattggtgac 560 Query: 169 cgatacttgaagccatacatcattccaaaaccagaagttacagttgttcctcgggcaaaa 228 |||| ||||||||| || |||||| ||||| || ||| | ||||| ||||| || Sbjct: 561 agatatctgaagccatggataattccagtcccagaggtaacaatagttccgcgggctaag 620 Query: 229 gatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatgaagag 288 ||||| || || || ||||| || || ||||| || ||||| || |||| ||||||||| Sbjct: 621 gatgacgagtgccttattcttgccagtgacggcctctgggatgtaatgtcaaatgaagag 680 Query: 289 g 289 | Sbjct: 681 g 681
>ref|XM_476022.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1338 Score = 56.0 bits (28), Expect = 1e-04 Identities = 166/212 (78%) Strand = Plus / Plus Query: 78 cgcgaggattgaggctgcgggaggcaaggtcatccaatggaatggacaccgagtgtccgg 137 ||||||||||||||| ||| |||||||| |||||||||||||| | ||||| ||| Sbjct: 906 cgcgaggattgaggcgctgggtggcaaggttatccaatggaatggttatcgagttctcgg 965 Query: 138 gatacttgctatgtcacgatccattggtgaccgatacttgaagccatacatcattccaaa 197 | ||||| ||||| ||||| || || ||| |||| |||||||||| || || || Sbjct: 966 tgttcttgccatgtcgcgatcaatcggggacaaatacctgaagccatatataatcccggt 1025 Query: 198 accagaagttacagttgttcctcgggcaaaagatgatgattgtctcattctggcaagcga 257 || || || |||||||| |||| |||||||| |||||||| || ||||| ||||| || Sbjct: 1026 ccctgaggtcacagttgtcgctcgtgcaaaagacgatgattgccttattcttgcaagtga 1085 Query: 258 cgggctttgggacgtcgtgtcgaatgaagagg 289 || |||||||| || ||||||| ||||||| Sbjct: 1086 tggcctttgggatgtaatgtcgaacgaagagg 1117
>dbj|AK104323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G08, full insert sequence Length = 1916 Score = 56.0 bits (28), Expect = 1e-04 Identities = 166/212 (78%) Strand = Plus / Plus Query: 78 cgcgaggattgaggctgcgggaggcaaggtcatccaatggaatggacaccgagtgtccgg 137 ||||||||||||||| ||| |||||||| |||||||||||||| | ||||| ||| Sbjct: 1286 cgcgaggattgaggcgctgggtggcaaggttatccaatggaatggttatcgagttctcgg 1345 Query: 138 gatacttgctatgtcacgatccattggtgaccgatacttgaagccatacatcattccaaa 197 | ||||| ||||| ||||| || || ||| |||| |||||||||| || || || Sbjct: 1346 tgttcttgccatgtcgcgatcaatcggggacaaatacctgaagccatatataatcccggt 1405 Query: 198 accagaagttacagttgttcctcgggcaaaagatgatgattgtctcattctggcaagcga 257 || || || |||||||| |||| |||||||| |||||||| || ||||| ||||| || Sbjct: 1406 ccctgaggtcacagttgtcgctcgtgcaaaagacgatgattgccttattcttgcaagtga 1465 Query: 258 cgggctttgggacgtcgtgtcgaatgaagagg 289 || |||||||| || ||||||| ||||||| Sbjct: 1466 tggcctttgggatgtaatgtcgaacgaagagg 1497
>dbj|AK070388.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023054G02, full insert sequence Length = 2179 Score = 56.0 bits (28), Expect = 1e-04 Identities = 166/212 (78%) Strand = Plus / Plus Query: 78 cgcgaggattgaggctgcgggaggcaaggtcatccaatggaatggacaccgagtgtccgg 137 ||||||||||||||| ||| |||||||| |||||||||||||| | ||||| ||| Sbjct: 1319 cgcgaggattgaggcgctgggtggcaaggttatccaatggaatggttatcgagttctcgg 1378 Query: 138 gatacttgctatgtcacgatccattggtgaccgatacttgaagccatacatcattccaaa 197 | ||||| ||||| ||||| || || ||| |||| |||||||||| || || || Sbjct: 1379 tgttcttgccatgtcgcgatcaatcggggacaaatacctgaagccatatataatcccggt 1438 Query: 198 accagaagttacagttgttcctcgggcaaaagatgatgattgtctcattctggcaagcga 257 || || || |||||||| |||| |||||||| |||||||| || ||||| ||||| || Sbjct: 1439 ccctgaggtcacagttgtcgctcgtgcaaaagacgatgattgccttattcttgcaagtga 1498 Query: 258 cgggctttgggacgtcgtgtcgaatgaagagg 289 || |||||||| || ||||||| ||||||| Sbjct: 1499 tggcctttgggatgtaatgtcgaacgaagagg 1530
>dbj|AK067627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013113I18, full insert sequence Length = 2169 Score = 56.0 bits (28), Expect = 1e-04 Identities = 166/212 (78%) Strand = Plus / Plus Query: 78 cgcgaggattgaggctgcgggaggcaaggtcatccaatggaatggacaccgagtgtccgg 137 ||||||||||||||| ||| |||||||| |||||||||||||| | ||||| ||| Sbjct: 1326 cgcgaggattgaggcgctgggtggcaaggttatccaatggaatggttatcgagttctcgg 1385 Query: 138 gatacttgctatgtcacgatccattggtgaccgatacttgaagccatacatcattccaaa 197 | ||||| ||||| ||||| || || ||| |||| |||||||||| || || || Sbjct: 1386 tgttcttgccatgtcgcgatcaatcggggacaaatacctgaagccatatataatcccggt 1445 Query: 198 accagaagttacagttgttcctcgggcaaaagatgatgattgtctcattctggcaagcga 257 || || || |||||||| |||| |||||||| |||||||| || ||||| ||||| || Sbjct: 1446 ccctgaggtcacagttgtcgctcgtgcaaaagacgatgattgccttattcttgcaagtga 1505 Query: 258 cgggctttgggacgtcgtgtcgaatgaagagg 289 || |||||||| || ||||||| ||||||| Sbjct: 1506 tggcctttgggatgtaatgtcgaacgaagagg 1537
>gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08, complete sequence Length = 142196 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 78 cgcgaggattgaggctgcgggaggcaaggtcatccaatggaatgg 122 ||||||||||||||| ||| |||||||| |||||||||||||| Sbjct: 98826 cgcgaggattgaggcgctgggtggcaaggttatccaatggaatgg 98782
>ref|NM_118741.2| Arabidopsis thaliana ABI1 (ABA INSENSITIVE 1); calcium ion binding / protein phosphatase type 2C AT4G26080 (ABI1) mRNA, complete cds Length = 2031 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1464 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1523 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1524 agaagcgtgt 1533
>ref|NM_190586.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1218 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 247 ctggcaagcgacgggctttgggacgtcgtg 276 ||||| ||||||||||| |||||||||||| Sbjct: 919 ctggccagcgacgggctatgggacgtcgtg 948
>gb|AY142623.1| Arabidopsis thaliana phosphatase ABI1 (At4g26080) mRNA, complete cds Length = 1336 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1008 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1067 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1068 agaagcgtgt 1077
>emb|X77116.1|ATMRABI1 A.thaliana mRNA for ABI1 protein Length = 1981 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1439 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1498 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1499 agaagcgtgt 1508
>emb|X78886.1|ATABI1G A.thaliana (Landsberg erecta) ABI1 gene Length = 2244 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1701 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1760 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1761 agaagcgtgt 1770
>gb|AY035073.1| Arabidopsis thaliana putative protein phosphatase ABI1 (At4g26080) mRNA, complete cds Length = 1735 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1151 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1210 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1211 agaagcgtgt 1220
>emb|AL161564.2|ATCHRIV64 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 64 Length = 196286 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Minus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 108991 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 108932 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 108931 agaagcgtgt 108922
>emb|AL049483.1|ATF20B18 Arabidopsis thaliana DNA chromosome 4, BAC clone F20B18 (ESSA project) Length = 104738 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Minus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 58306 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 58247 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 58246 agaagcgtgt 58237
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 247 ctggcaagcgacgggctttgggacgtcgtg 276 ||||| ||||||||||| |||||||||||| Sbjct: 36338805 ctggccagcgacgggctatgggacgtcgtg 36338834
>emb|BX828393.1|CNS0A2I6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH83ZH06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1838 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1432 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1491 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1492 agaagcgtgt 1501
>emb|BX826530.1|CNS0A2ID Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB35ZG06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1690 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1206 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1265 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1266 agaagcgtgt 1275
>dbj|AP003251.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0446B05 Length = 149145 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 247 ctggcaagcgacgggctttgggacgtcgtg 276 ||||| ||||||||||| |||||||||||| Sbjct: 88682 ctggccagcgacgggctatgggacgtcgtg 88711
>dbj|AK071996.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F23, full insert sequence Length = 1834 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 247 ctggcaagcgacgggctttgggacgtcgtg 276 ||||| ||||||||||| |||||||||||| Sbjct: 1371 ctggccagcgacgggctatgggacgtcgtg 1400
>dbj|AK065949.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013046H22, full insert sequence Length = 1755 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 247 ctggcaagcgacgggctttgggacgtcgtg 276 ||||| ||||||||||| |||||||||||| Sbjct: 1292 ctggccagcgacgggctatgggacgtcgtg 1321
>gb|U12856.1|ATU12856 Arabidopsis thaliana Col-0 abscisic acid insensitive protein (ABI1) mRNA, complete cds Length = 2000 Score = 44.1 bits (22), Expect = 0.46 Identities = 58/70 (82%) Strand = Plus / Plus Query: 225 aaaagatgatgattgtctcattctggcaagcgacgggctttgggacgtcgtgtcgaatga 284 |||||| ||||||||||| ||| |||| || |||||| ||||||| || || || |||| Sbjct: 1439 aaaagaagatgattgtctgattttggcgagtgacggggtttgggatgtaatgacggatga 1498 Query: 285 agaggcgtgt 294 ||| |||||| Sbjct: 1499 agaagcgtgt 1508
>emb|AJ277743.1|FSY277743 Fagus sylvatica mRNA for ABA induced protein phosphatase 2C (PP2C), (pp2C1 gene) Length = 1385 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 250 gcaagcgacgggctttgggacgtcgtgtc 278 |||||||| |||||||||||||| ||||| Sbjct: 1093 gcaagcgatgggctttgggacgtagtgtc 1121
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 329 agaacaacagcgttacaacatcat 352 ||||| |||||||||||||||||| Sbjct: 274150 agaaccacagcgttacaacatcat 274173
>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10, complete sequence Length = 187034 Score = 40.1 bits (20), Expect = 7.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ctggcaagcgacgggctttgggacgtcgtgtc 278 ||||| ||||||||||| |||||||| ||||| Sbjct: 88111 ctggcgagcgacgggctgtgggacgtggtgtc 88080
>gb|AC134569.4| Mus musculus BAC clone RP24-240H21 from chromosome 16, complete sequence Length = 168794 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 193 ccaaaaccagaagttacagt 212 |||||||||||||||||||| Sbjct: 151413 ccaaaaccagaagttacagt 151432
>gb|AC133093.4| Mus musculus BAC clone RP23-442I18 from chromosome 8, complete sequence Length = 177876 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 tgaagaaaggaagccaggat 444 |||||||||||||||||||| Sbjct: 145104 tgaagaaaggaagccaggat 145085
>gb|AC013509.5|AC013509 Homo sapiens chromosome , clone RP11-115I9, complete sequence Length = 151544 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 423 gctgaagaaaggaagccagg 442 |||||||||||||||||||| Sbjct: 31206 gctgaagaaaggaagccagg 31187
>gb|AC011716.7|AC011716 Homo sapiens chromosome 8 clone RP11-65D13, complete sequence Length = 172327 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 423 gctgaagaaaggaagccagg 442 |||||||||||||||||||| Sbjct: 2630 gctgaagaaaggaagccagg 2649
>dbj|AK108969.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-D11, full insert sequence Length = 1347 Score = 40.1 bits (20), Expect = 7.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 247 ctggcaagcgacgggctttgggacgtcgtgtc 278 ||||| ||||||||||| |||||||| ||||| Sbjct: 967 ctggcgagcgacgggctgtgggacgtggtgtc 998
>gb|AC124180.5| Mus musculus BAC clone RP23-200I16 from 16, complete sequence Length = 199422 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 193 ccaaaaccagaagttacagt 212 |||||||||||||||||||| Sbjct: 2068 ccaaaaccagaagttacagt 2087
>gb|AC138622.4| Mus musculus BAC clone RP23-100J15 from chromosome 6, complete sequence Length = 194611 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 atcagaagcctgacaggaag 69 |||||||||||||||||||| Sbjct: 96326 atcagaagcctgacaggaag 96345 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,162,913 Number of Sequences: 3902068 Number of extensions: 4162913 Number of successful extensions: 70455 Number of sequences better than 10.0: 39 Number of HSP's better than 10.0 without gapping: 39 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 70345 Number of HSP's gapped (non-prelim): 104 length of query: 531 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 508 effective length of database: 17,143,297,704 effective search space: 8708795233632 effective search space used: 8708795233632 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
