>emb|AL663086.6| Mouse DNA sequence from clone RP23-64N1 on chromosome 11, complete
              sequence
          Length = 161810

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 68     ttcatggaatcaagcagct 86
              |||||||||||||||||||
Sbjct: 117119 ttcatggaatcaagcagct 117101

>gb|AC023131.8| Homo sapiens BAC clone RP11-418O6 from 2, complete sequence
          Length = 45414

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 56   aactttgggcagttcatggaatc 78
            ||||||||| |||||||||||||
Sbjct: 7184 aactttgggtagttcatggaatc 7162

>gb|AC084030.5| Homo sapiens BAC clone RP11-205L13 from 2, complete sequence
          Length = 100731

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 61    tgggcagttcatggaatca 79
             |||||||||||||||||||
Sbjct: 17122 tgggcagttcatggaatca 17140

>emb|BX950227.8| Zebrafish DNA sequence from clone CH211-101N17 in linkage group 19,
             complete sequence
          Length = 67817

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    aagcagcttgtattcattt 97
             |||||||||||||||||||
Sbjct: 14749 aagcagcttgtattcattt 14767

>emb|AL133477.16| Human DNA sequence from clone RP11-172F4 on chromosome 9q22.2-31.1
             Contains the 3' end of the CDC14B gene for the CDC14 cell
             division cycle 14 homolog B (S. cerevisiae) the HABP4 gene
             for hyaluronan binding protein 4, the gene for a novel
             protein similar to a zinc finger protein, TINP1
             pseudogene, a novel gene and three CpG islands, complete
             sequence
          Length = 139118

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 71    atggaatcaagcagcttgtattc 93
             ||||||||| |||||||||||||
Sbjct: 49129 atggaatcatgcagcttgtattc 49107

>emb|BX511074.10| Zebrafish DNA sequence from clone CH211-123D3 in linkage group 19,
             complete sequence
          Length = 87054

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    aagcagcttgtattcattt 97
             |||||||||||||||||||
Sbjct: 14738 aagcagcttgtattcattt 14756


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 599,003
Number of Sequences: 3902068
Number of extensions: 599003
Number of successful extensions: 41717
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41710
Number of HSP's gapped (non-prelim): 7
length of query: 119
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 98
effective length of database: 17,151,101,840
effective search space: 1680807980320
effective search space used: 1680807980320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)