>gb|AY293578.1| Haloarcula sp. D1 amino acid ABC transporter ATP-binding protein
           (abc) gene, partial cds; acetyl-CoA synthetase
           (ADP-forming) alpha subunit (acdA), acetyl-CoA
           synthetase (ADP-forming) beta subunit (acdB),
           4-hydroxybenzoyl-CoA thioesterase (tie), and gentisate
           1,2-dioxygenase (gdo) genes, complete cds; and
           Leu/Ile/Val-binding protein gene, partial cds
          Length = 5709

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 42  ggccggcgtcggcgcggtggt 62
           |||||||||||||||||||||
Sbjct: 848 ggccggcgtcggcgcggtggt 868

>emb|AJ009587.2|ARU9587 Prauserella rugosa alkB gene for alkane-1 monooxygenase, partial
          Length = 3051

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 42   ggccggcgtcggcgcggtggt 62
            |||||||||||||||||||||
Sbjct: 1375 ggccggcgtcggcgcggtggt 1395

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 34      ggcgacggggccggcgtcggc 54
               |||||||||||||||||||||
Sbjct: 3793432 ggcgacggggccggcgtcggc 3793452

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 43     gccggcgtcggcgcggtggt 62
              ||||||||||||||||||||
Sbjct: 771562 gccggcgtcggcgcggtggt 771581

>gb|AY575969.1| Rhodococcus sp. T104 putative serine-threonine protein kinase, indole
            oxygenase, putative TetR-family transcriptional
            regulator, and flavin reductase-like protein genes,
            complete cds
          Length = 8842

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 39   cggggccggcgtcggcgcggtggt 62
            |||| |||||||||||||||||||
Sbjct: 2082 cgggtccggcgtcggcgcggtggt 2059

>gb|AC084536.1|CBRG26F13 Caenorhabditis briggsae cosmid G26F13, complete sequence
          Length = 44699

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   gtttgaactgtcgttttgaa 197
             ||||||||||||||||||||
Sbjct: 33862 gtttgaactgtcgttttgaa 33881

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 35      gcgacggggccggcgtcggcgcgg 58
               ||||||||||||||| ||||||||
Sbjct: 5616276 gcgacggggccggcggcggcgcgg 5616253


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,472,074
Number of Sequences: 3902068
Number of extensions: 1472074
Number of successful extensions: 31285
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31126
Number of HSP's gapped (non-prelim): 159
length of query: 241
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 219
effective length of database: 17,147,199,772
effective search space: 3755236750068
effective search space used: 3755236750068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)