Clone Information

BLAST Search Result

Clone Name	baal16n13
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY107218.1\| Zea mays PCO140184 mRNA sequence	76	9e-11
2	gb\|AY137517.1\| Hordeum vulgare subsp. vulgare hypersensitive-ind...	62	1e-06
3	emb\|AL662938.3\|OSJN00138 Oryza sativa genomic DNA, chromosome 4,...	60	6e-06
4	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
5	dbj\|AK061664.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
6	emb\|AL512542.2\| Oryza sativa genomic DNA, chromosome 4, BAC clon...	60	6e-06
7	emb\|AL606629.3\|OSJN00061 Oryza sativa genomic DNA, chromosome 4,...	60	6e-06
8	dbj\|AB001883.1\| Oryza sativa (japonica cultivar-group) mRNA for ...	60	6e-06
9	ref\|XM_473004.1\| Oryza sativa (japonica cultivar-group), predic...	54	3e-04
10	gb\|AC091046.2\|AC091046 Homo sapiens chromosome 15 clone RP11-123...	50	0.005
11	gb\|AC152976.1\| Mus musculus BAC RP23-103K17 (Roswell Park Cance...	48	0.021
12	gb\|AC102668.12\| Mus musculus chromosome 6, clone RP23-296I18, co...	48	0.021
13	gb\|AY821714.1\| Peridictyon sanctum beta amylase gene, partial cd...	46	0.084
14	ref\|XM_466630.1\| Oryza sativa (japonica cultivar-group), mRNA	46	0.084
15	ref\|XM_506858.1\| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.084
16	gb\|AC158966.5\| Mus musculus chromosome 1, clone RP23-382I8, comp...	46	0.084
17	gb\|AC109305.6\| Mus musculus chromosome 1, clone RP24-350F5, comp...	46	0.084
18	gb\|AC102420.10\| Mus musculus chromosome 8, clone RP24-553O21, co...	46	0.084
19	gb\|AC161206.10\| Mus musculus chromosome 15, clone RP24-299A13, c...	46	0.084
20	gb\|AC141566.4\| Mus musculus BAC clone RP23-89G14 from chromosome...	46	0.084
21	gb\|AC126442.4\| Mus musculus BAC clone RP23-453M12 from chromosom...	46	0.084
22	gb\|AC121575.4\| Mus musculus BAC clone RP23-241P4 from 1, complet...	46	0.084
23	gb\|AC166996.1\| Mus musculus BAC clone RP23-268E1 from chromosome...	46	0.084
24	gb\|AC137546.33\| Medicago truncatula clone mth2-24g3, complete se...	46	0.084
25	emb\|AL096861.9\|HSDJ824H1 Human DNA sequence from clone RP5-824H1...	46	0.084
26	emb\|CR407559.8\| Zebrafish DNA sequence from clone CH211-283G2 in...	46	0.084
27	gb\|AC116715.22\| Mus musculus chromosome 5, clone RP23-129N14, co...	46	0.084
28	emb\|AL732631.4\| Mouse DNA sequence from clone RP23-345P19 on chr...	46	0.084
29	ref\|NM_167461.1\| Drosophila melanogaster Platelet-activating fac...	46	0.084
30	ref\|NM_080350.3\| Drosophila melanogaster Platelet-activating fac...	46	0.084
31	gb\|AC016573.7\| Homo sapiens chromosome 5 clone CTB-32H22, comple...	46	0.084
32	gb\|AY069389.1\| Drosophila melanogaster LD09790 full length cDNA	46	0.084
33	gb\|AC092401.1\|AC092401 Drosophila melanogaster, chromosome X, re...	46	0.084
34	gb\|AC013431.9\|AC013431 Drosophila melanogaster, chromosome X, re...	46	0.084
35	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
36	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
37	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
38	gb\|AC026369.21\|AC026369 Homo sapiens 12 BAC RP11-598F7 (Roswell ...	46	0.084
39	gb\|AC101696.14\| Mus musculus chromosome 1, clone RP23-238M18, co...	46	0.084
40	dbj\|AP003309.3\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
41	dbj\|AP003560.2\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
42	gb\|AC106731.3\| Homo sapiens chromosome 5 clone CTD-2216D16, comp...	46	0.084
43	dbj\|AP005755.2\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
44	dbj\|AP006438.3\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
45	dbj\|AP004111.3\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.084
46	dbj\|AK104293.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.084
47	dbj\|AK061044.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.084
48	gb\|AE003500.4\| Drosophila melanogaster chromosome X, section 52 ...	46	0.084
49	gb\|AC104225.18\| Mus musculus chromosome 15, clone RP23-74H8, com...	46	0.084
50	gb\|AF098069.1\|AF098069 Drosophila melanogaster platelet-activati...	46	0.084
51	emb\|CR974457.17\| Mouse DNA sequence from clone RP23-319E15 on ch...	46	0.084
52	emb\|AL590988.11\| Mouse DNA sequence from clone RP23-46C18 on chr...	46	0.084
53	gb\|AC111089.27\| Mus musculus chromosome 5, clone RP23-156F20, co...	46	0.084
54	gb\|AC131189.3\| Mus musculus BAC clone RP24-330P2 from 8, complet...	46	0.084
55	gb\|AF050157.1\|MMHC135G15 Mus musculus major histocompatibility l...	46	0.084
56	gb\|AC146603.3\| Mus musculus BAC clone RP23-304P17 from 8, comple...	46	0.084
57	dbj\|AB001885.1\| Oryza sativa (japonica cultivar-group) mRNA for ...	46	0.084
58	gb\|AC111115.13\| Mus musculus chromosome 5, clone RP23-213H20, co...	44	0.33
59	gb\|AC124664.14\| Mus musculus chromosome 1, clone RP23-103B18, co...	44	0.33
60	gb\|AC166491.8\| Mus musculus chromosome 15, clone RP24-380A15, co...	44	0.33
61	gb\|AC155264.2\| Mus musculus BAC clone RP23-281B4 from chromosome...	44	0.33
62	gb\|AC132830.12\| Mus musculus chromosome 1, clone RP24-566B6, com...	44	0.33
63	ref\|XM_475286.1\| Oryza sativa (japonica cultivar-group), predic...	44	0.33
64	ref\|XM_474689.1\| Oryza sativa (japonica cultivar-group), predic...	44	0.33
65	ref\|NM_189498.1\| Oryza sativa (japonica cultivar-group), predic...	44	0.33
66	gb\|AC115868.12\| Mus musculus chromosome 7, clone RP24-329F21, co...	44	0.33
67	gb\|AC138278.9\| Mus musculus chromosome 8, clone RP23-378E4, comp...	44	0.33
68	gb\|AC145809.3\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.33
69	gb\|AC097087.13\| Rattus norvegicus BAC CH230-140P4 (Children's H...	44	0.33
70	gb\|AC105769.2\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.33
71	ref\|NG_000008.6\| Homo sapiens cytochrome P450, family 2, subfami...	44	0.33
72	gb\|AC161595.3\| Mus musculus BAC clone RP23-471H21 from chromosom...	44	0.33
73	gb\|AC114634.14\| Mus musculus chromosome 8, clone RP24-116E2, com...	44	0.33
74	gb\|AC133098.7\| Mus musculus BAC clone RP23-336L12 from chromosom...	44	0.33
75	gb\|AC141563.3\| Mus musculus BAC clone RP23-410M22 from chromosom...	44	0.33
76	gb\|AC139750.3\| Mus musculus BAC clone RP24-444K8 from chromosome...	44	0.33
77	emb\|CT010493.12\| Mouse DNA sequence from clone RP23-140P6 on chr...	44	0.33
78	emb\|CR626933.1\| Triticum turgidum	44	0.33
79	emb\|CR626929.1\| Triticum aestivum	44	0.33
80	emb\|BX927257.11\| Zebrafish DNA sequence from clone CH211-122I22 ...	44	0.33
81	gb\|AC138288.13\| Mus musculus chromosome 9, clone RP23-464K22, co...	44	0.33
82	gb\|AC127575.4\| Mus musculus BAC clone RP24-240L12 from chromosom...	44	0.33
83	gb\|AC116596.3\| Mus musculus BAC clone RP24-335P21 from chromosom...	44	0.33
84	gb\|AC121789.2\| Mus musculus BAC clone RP23-398C14 from 1, comple...	44	0.33
85	gb\|AC110422.3\| Mus musculus BAC clone RP24-198G12 from 2, comple...	44	0.33
86	gb\|AF264711.1\|AF264710S2 Rattus norvegicus 6-phosphofructo-1-kin...	44	0.33
87	gb\|AC102527.6\| Mus musculus chromosome 8, clone RP23-29G4, compl...	44	0.33
88	gb\|AC134528.6\| Mus musculus BAC clone RP24-502G8 from chromosome...	44	0.33
89	gb\|AC161049.2\| Mus musculus BAC clone RP24-94D6 from chromosome ...	44	0.33
90	emb\|AL732479.6\| Human DNA sequence from clone RP11-351D13 on chr...	44	0.33
91	emb\|AL645568.9\| Human DNA sequence from clone RP11-296O14 on chr...	44	0.33
92	emb\|AL357518.15\| Human DNA sequence from clone RP11-679B17 on ch...	44	0.33
93	gb\|AC091518.22\| Mus musculus strain 129/SvJ clone mgs1-257j2 map...	44	0.33
94	emb\|AL133230.25\| Human DNA sequence from clone RP4-530I15 on chr...	44	0.33
95	gb\|AC166325.1\| Mus musculus BAC clone RP24-421O23 from chromosom...	44	0.33
96	gb\|AC161576.7\| Mus musculus chromosome 8, clone RP24-315L4, comp...	44	0.33
97	gb\|AC154394.6\| Mus musculus chromosome 18, clone RP23-315M1, com...	44	0.33
98	emb\|AL645912.18\| Mouse DNA sequence from clone RP23-134G19 on ch...	44	0.33
99	gb\|AC120393.16\| Mus musculus chromosome 7, clone RP24-312B12, co...	44	0.33
100	gb\|AC108508.2\| Genomic sequence for Mus musculus, clone RP23-437...	44	0.33
101	emb\|CR855308.6\| Zebrafish DNA sequence from clone DKEY-71K24, co...	44	0.33
102	gb\|AC091694.9\| Mus musculus Strain C57BL6/J chromosome 11 BAC, R...	44	0.33
103	emb\|BX323991.10\| Zebrafish DNA sequence from clone CH211-66H3 in...	44	0.33
104	emb\|BX294106.10\| Zebrafish DNA sequence from clone DKEY-211F4 in...	44	0.33
105	gb\|AC112912.4\| Homo sapiens 3 BAC RP11-634L24 (Roswell Park Canc...	44	0.33
106	gb\|AF372495.1\|AF372495S1 Homo sapiens cytochrome P450 2f1 (CYP2F...	44	0.33
107	emb\|BX511164.11\| Zebrafish DNA sequence from clone DKEY-63J1 in ...	44	0.33
108	gb\|AC160639.2\| Mus musculus BAC clone RP23-103I12 from chromosom...	44	0.33
109	emb\|BX682531.11\| Zebrafish DNA sequence from clone CH211-12C17 i...	44	0.33
110	gb\|AC154257.2\| Mus musculus BAC clone RP24-211E15 from chromosom...	44	0.33
111	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
112	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
113	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
114	gb\|AC084214.19\|AC084214 Mus musculus X BAC RP23-382J5 (Roswell P...	44	0.33
115	emb\|BX248130.8\| Zebrafish DNA sequence from clone CH211-236E5 in...	44	0.33
116	gb\|DQ004742.1\| Bos taurus isolate UoG-BovSAGE-UK3L aromatase cyt...	44	0.33
117	gb\|AC157998.2\| Mus musculus BAC clone RP23-27L18 from chromosome...	44	0.33
118	gb\|AC008537.5\|AC008537 Homo sapiens chromosome 19 clone CTC-490E...	44	0.33
119	dbj\|AP003627.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
120	dbj\|AP003228.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
121	gb\|AC134575.3\| Mus musculus BAC clone RP24-67I21 from chromosome...	44	0.33
122	dbj\|AP005805.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
123	dbj\|AP004739.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
124	dbj\|AP005611.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
125	dbj\|AP005469.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.33
126	gb\|AC149294.8\| Mus musculus chromosome 15, clone RP24-389G21, co...	44	0.33
127	dbj\|AK100045.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.33
128	gb\|AC154752.2\| Mus musculus BAC clone RP24-402K18 from 16, compl...	44	0.33
129	gb\|AC119196.12\| Mus musculus chromosome 7, clone RP24-179I13, co...	44	0.33
130	dbj\|AK067175.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.33
131	gb\|AC107746.9\| Mus musculus chromosome 1, clone RP23-311K2, comp...	44	0.33
132	emb\|AL844840.8\| Mouse DNA sequence from clone RP23-337P9 on chro...	44	0.33
133	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.33
134	emb\|AL662994.3\|OSJN00192 Oryza sativa genomic DNA, chromosome 4,...	44	0.33
135	emb\|AL929465.6\| Mouse DNA sequence from clone RP23-395N7 on chro...	44	0.33
136	gb\|AC139159.3\| Mus musculus BAC clone RP23-119I13 from 8, comple...	44	0.33
137	emb\|AL928589.11\| Mouse DNA sequence from clone RP23-350C1 on chr...	44	0.33
138	emb\|CT027693.11\| Mouse DNA sequence from clone RP24-120H1 on chr...	44	0.33
139	emb\|AL928992.7\| Mouse DNA sequence from clone RP23-208O9 on chro...	44	0.33
140	emb\|AL683809.7\| Mouse DNA sequence from clone RP23-440B21 on chr...	44	0.33
141	emb\|AL773590.8\| Mouse DNA sequence from clone RP23-181A13 on chr...	44	0.33
142	emb\|AL627077.14\| Mouse DNA sequence from clone RP23-384D6 on chr...	44	0.33
143	emb\|AL645542.13\| Mouse DNA sequence from clone RP23-468A19 on ch...	44	0.33
144	emb\|AL606987.11\| Mouse DNA sequence from clone RP23-383I4 on chr...	44	0.33
145	emb\|AL606919.12\| Mouse DNA sequence from clone RP23-264F10 on ch...	44	0.33
146	gb\|AC152500.7\| Mus musculus BAC clone RP24-555P14 from chromosom...	44	0.33
147	dbj\|AB036794.1\| Drosophila melanogaster genomic DNA, chromosome ...	44	0.33
148	emb\|AL807392.7\| Mouse DNA sequence from clone RP23-104D24 on chr...	44	0.33
149	emb\|AL731727.18\| Mouse DNA sequence from clone RP23-147K15 on ch...	44	0.33
150	gb\|AC115058.17\| Mus musculus chromosome 5, clone RP24-381E3, com...	42	1.3
151	gb\|AC099645.11\| Mus musculus chromosome 15, clone RP23-426G4, co...	42	1.3
152	gb\|AC125018.15\| Mus musculus chromosome 7, clone RP24-158A20, co...	42	1.3
153	gb\|AC153645.4\| Mus musculus BAC clone RP24-534E8 from chromosome...	42	1.3
154	gb\|AC165289.2\| Mus musculus BAC clone RP23-467L11 from chromosom...	42	1.3
155	gb\|AC164119.4\| Mus musculus BAC clone RP24-288I15 from chromosom...	42	1.3
156	gb\|AC159998.6\| Mus musculus BAC clone RP24-576J22 from chromosom...	42	1.3
157	gb\|AC135667.5\| Mus musculus BAC clone RP24-536G18 from chromosom...	42	1.3
158	gb\|AC099884.12\| Mus musculus chromosome 15, clone RP23-11F24, co...	42	1.3
159	gb\|AC138680.7\| Mus musculus chromosome 1, clone RP23-373D7, comp...	42	1.3
160	gb\|AC116792.17\| Mus musculus chromosome 6, clone RP24-304O23, co...	42	1.3
161	gb\|AC102081.15\| Mus musculus chromosome 18, clone RP23-43H5, com...	42	1.3
162	gb\|AC161269.4\| Mus musculus BAC clone RP23-120K16 from chromosom...	42	1.3
163	gb\|AC168269.3\| Mus musculus BAC clone RP23-193M17 from chromosom...	42	1.3
164	gb\|AC123720.32\| Mus musculus chromosome 10, clone RP23-413G8, co...	42	1.3
165	ref\|NM_187882.1\| Oryza sativa (japonica cultivar-group), Ozsa832...	42	1.3
166	gb\|AC123060.4\| Mus musculus chromosome 6 clone RP23-214M22, comp...	42	1.3
167	gb\|AC114537.6\| Mus musculus chromosome 15, clone RP23-51A16, com...	42	1.3
168	gb\|AC154301.2\| Mus musculus BAC clone RP23-392P5 from chromosome...	42	1.3
169	gb\|AC132350.4\| Mus musculus BAC clone RP24-95A6 from chromosome ...	42	1.3
170	gb\|AC151980.3\| Mus musculus BAC clone RP24-83M3 from chromosome ...	42	1.3
171	gb\|AC139574.4\| Mus musculus BAC clone RP23-477I8 from chromosome...	42	1.3
172	gb\|AC165236.5\| Mus musculus chromosome 5, clone RP23-348C18, com...	42	1.3
173	gb\|AC167202.8\| Mus musculus BAC RP24-243A15 (Roswell Park Cance...	42	1.3
174	gb\|AC105995.9\| Mus musculus chromosome 5, clone RP24-168A7, comp...	42	1.3
175	gb\|AC160028.9\| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can...	42	1.3
176	gb\|AE001375.1\| Plasmodium falciparum 3D7 chromosome 2 section 12...	42	1.3
177	gb\|AC101738.16\| Mus musculus chromosome 1, clone RP23-472N5, com...	42	1.3
178	gb\|AC157938.9\| Mus musculus chromosome 5, clone RP23-307P18, com...	42	1.3
179	gb\|AC123646.8\| Mus musculus chromosome 19, clone RP23-104P24, co...	42	1.3
180	gb\|AC128597.3\| Rattus norvegicus BAC CH230-62C6 (Children's Hos...	42	1.3
181	gb\|AC160993.5\| Mus musculus BAC clone RP23-159D11 from chromosom...	42	1.3
182	gb\|AC168064.3\| Mus musculus BAC clone RP23-182K16 from chromosom...	42	1.3
183	gb\|AC159247.2\| Mus musculus BAC clone RP24-249C9 from chromosome...	42	1.3
184	gb\|AC158943.9\| Mus musculus chromosome 1, clone RP24-272N10, com...	42	1.3
185	gb\|AC110895.14\| Mus musculus chromosome 1, clone RP24-159G18, co...	42	1.3
186	gb\|AC138341.9\| Mus musculus chromosome 5, clone RP23-37N15, comp...	42	1.3
187	gb\|AC120875.12\| Mus musculus chromosome 1, clone RP23-317M5, com...	42	1.3
188	gb\|AC007418.9\| Drosophila melanogaster clone BACR16P22, complete...	42	1.3
189	gb\|AC124127.12\| Mus musculus chromosome 19, clone RP23-150N4, co...	42	1.3
190	gb\|AC110499.19\| Mus musculus chromosome 1, clone RP23-202J6, com...	42	1.3
191	gb\|AC009208.6\| Drosophila melanogaster clone BACR31I21, complete...	42	1.3
192	gb\|AC111060.5\| Mus musculus chromosome 1, clone RP24-121I5, comp...	42	1.3
193	gb\|AC138766.20\| Mus musculus chromosome 5, clone RP23-444J3, com...	42	1.3
194	gb\|AC109140.6\| Mus musculus chromosome 5, clone RP23-153N23, com...	42	1.3
195	gb\|AC139107.3\| Mus musculus BAC clone RP23-430L2 from chromosome...	42	1.3
196	gb\|AC185523.2\| Pan troglodytes chromosome X clone PTB-124O20 map...	42	1.3
197	gb\|AC108821.6\| Mus musculus chromosome 15, clone RP23-61D6, comp...	42	1.3
198	gb\|AC099174.7\| Rattus norvegicus 4 BAC CH230-98I1 (Children's Ho...	42	1.3
199	gb\|AC123610.10\| Mus musculus chromosome 9, clone RP23-343M15, co...	42	1.3
200	gb\|AC131728.4\| Mus musculus BAC clone RP23-122G5 from chromosome...	42	1.3
201	gb\|AC134530.3\| Mus musculus BAC clone RP24-507K16 from chromosom...	42	1.3
202	gb\|AC131798.3\| Mus musculus BAC clone RP24-497K17 from chromosom...	42	1.3
203	gb\|AC134569.4\| Mus musculus BAC clone RP24-240H21 from chromosom...	42	1.3
204	gb\|AC101757.12\| Mus musculus chromosome 8, clone RP24-545I11, co...	42	1.3
205	gb\|AC146424.3\| Pan troglodytes BAC clone RP43-26H22 from 7, comp...	42	1.3
206	gb\|AC146126.3\| Pan troglodytes BAC clone RP43-23E20 from 7, comp...	42	1.3
207	gb\|AC137558.3\| Mus musculus BAC clone RP23-16I17 from chromosome...	42	1.3
208	gb\|AC147045.2\| Mus musculus BAC clone RP23-100E5 from chromosome...	42	1.3
209	gb\|AC124561.3\| Mus musculus BAC clone RP23-169G13 from chromosom...	42	1.3
210	gb\|AC117949.5\| Mus musculus BAC clone RP23-197M6 from chromosome...	42	1.3
211	gb\|AC147020.2\| Mus musculus BAC clone RP23-267A11 from chromosom...	42	1.3
212	gb\|AC132307.5\| Mus musculus BAC clone RP24-291H9 from chromosome...	42	1.3
213	gb\|AC125322.4\| Mus musculus BAC clone RP23-407J24 from chromosom...	42	1.3
214	gb\|AC135108.3\| Mus musculus BAC clone RP24-538P2 from chromosome...	42	1.3
215	gb\|AC145557.3\| Mus musculus BAC clone RP23-313I19 from chromosom...	42	1.3
216	gb\|AC145775.2\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.3
217	gb\|AC113262.29\| Mus musculus strain 129/Sv clone ct7-518k21 map ...	42	1.3
218	gb\|AC137979.6\| Mus musculus chromosome 5, clone RP24-92M6, compl...	42	1.3
219	gb\|AC068661.5\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	1.3
220	gb\|AC157771.8\| Mus musculus chromosome 1, clone RP24-287N8, comp...	42	1.3
221	gb\|AC158608.10\| Mus musculus 10 BAC RP24-405N1 (Roswell Park Can...	42	1.3
222	gb\|AC153970.4\| Mus musculus 10 BAC RP24-116A15 (Roswell Park Can...	42	1.3
223	gb\|AC139553.5\| Mus musculus chromosome 19, clone RP24-386E18, co...	42	1.3
224	gb\|AC154422.2\| Mus musculus BAC clone RP24-218O2 from chromosome...	42	1.3
225	gb\|AC154910.3\| Mus musculus BAC clone RP23-70L9 from chromosome ...	42	1.3
226	gb\|AC164103.5\| Mus musculus BAC clone RP23-427D2 from chromosome...	42	1.3
227	gb\|AC124226.12\| Mus musculus chromosome 15, clone RP23-94G21, co...	42	1.3
228	gb\|AC160114.2\| Mus musculus BAC clone RP24-70J8 from chromosome ...	42	1.3
229	gb\|AC153919.8\| Mus musculus 10 BAC RP23-91E23 (Roswell Park Canc...	42	1.3
230	gb\|AC140477.2\| Mus musculus BAC clone RP24-132G6 from chromosome...	42	1.3
231	gb\|AC121849.3\| Mus musculus BAC clone RP24-90K18 from chromosome...	42	1.3
232	gb\|AC125291.3\| Drosophila melanogaster X BAC CH221-17A11 (CHORI ...	42	1.3
233	gb\|AC119853.9\| Mus musculus chromosome 16, clone RP23-231E23, co...	42	1.3
234	gb\|AC094950.6\| Rattus norvegicus 14 BAC CH230-6H12 (Children's H...	42	1.3
235	gb\|AC124168.3\| Mus musculus BAC clone RP23-143G9 from chromosome...	42	1.3
236	gb\|AC123941.3\| Mus musculus BAC clone RP23-458G24 from chromosom...	42	1.3
237	gb\|AC140109.4\| Mus musculus BAC clone RP24-156A17 from chromosom...	42	1.3
238	gb\|AC136018.5\| Mus musculus BAC clone RP24-125E6 from chromosome...	42	1.3
239	gb\|AC135110.3\| Mus musculus BAC clone RP23-392G14 from chromosom...	42	1.3
240	gb\|AC132093.3\| Mus musculus BAC clone RP24-506H13 from chromosom...	42	1.3
241	gb\|AC124547.4\| Mus musculus BAC clone RP23-274I8 from chromosome...	42	1.3
242	emb\|CR450685.13\| Zebrafish DNA sequence from clone DKEY-83K24 in...	42	1.3
243	emb\|AJ566457.1\|TCA566457 Theobroma cacao microsatellite, clone m...	42	1.3
244	emb\|CR626875.10\| Zebrafish DNA sequence from clone DKEY-31J4 in ...	42	1.3
245	emb\|CT010430.6\| Mouse DNA sequence from clone RP23-335P18 on chr...	42	1.3
246	gb\|AC107664.8\| Mus musculus chromosome 17, clone RP23-103F2, com...	42	1.3
247	emb\|CR954970.9\| Mouse DNA sequence from clone RP23-402J24 on chr...	42	1.3
248	emb\|AL669948.8\| Mouse DNA sequence from clone RP23-248K2 on chro...	42	1.3
249	gb\|AC134452.4\| Mus musculus BAC clone RP24-252M6 from chromosome...	42	1.3
250	gb\|AC127564.4\| Mus musculus BAC clone RP24-290E2 from chromosome...	42	1.3
251	gb\|AC121975.3\| Mus musculus BAC clone RP24-286J21 from chromosom...	42	1.3
252	gb\|AC140248.3\| Mus musculus BAC clone RP24-285L8 from chromosome...	42	1.3
253	gb\|AC130550.4\| Mus musculus BAC clone RP24-463N15 from chromosom...	42	1.3
254	gb\|AC129018.4\| Mus musculus BAC clone RP24-463L19 from chromosom...	42	1.3
255	gb\|AC121909.3\| Mus musculus BAC clone RP24-179L9 from chromosome...	42	1.3
256	gb\|AC132269.3\| Mus musculus BAC clone RP24-409M22 from chromosom...	42	1.3
257	gb\|AC132268.3\| Mus musculus BAC clone RP24-399H6 from chromosome...	42	1.3
258	gb\|AC123803.4\| Mus musculus BAC clone RP24-492I15 from chromosom...	42	1.3
259	gb\|AC127368.3\| Mus musculus BAC clone RP23-22J14 from chromosome...	42	1.3
260	gb\|AC122199.4\| Mus musculus BAC clone RP23-57C9 from chromosome ...	42	1.3
261	gb\|AC115293.5\| Mus musculus BAC clone RP23-92N2 from chromosome ...	42	1.3
262	gb\|AC140375.2\| Mus musculus BAC clone RP23-183J2 from chromosome...	42	1.3
263	gb\|AC126942.4\| Mus musculus BAC clone RP23-174P9 from chromosome...	42	1.3
264	gb\|AC124550.4\| Mus musculus BAC clone RP23-211F21 from chromosom...	42	1.3
265	gb\|AC131109.3\| Mus musculus BAC clone RP23-362M7 from chromosome...	42	1.3
266	gb\|AC140332.3\| Mus musculus BAC clone RP23-408K9 from chromosome...	42	1.3
267	gb\|AC125533.4\| Mus musculus BAC clone RP23-451C1 from chromosome...	42	1.3
268	gb\|U91324.1\|HUU91324 Homo sapiens Chromosome 16 BAC clone CIT987...	42	1.3
269	gb\|AC109172.11\| Mus musculus chromosome 14, clone RP23-279B8, co...	42	1.3
270	gb\|AC129204.4\| Mus musculus BAC clone RP24-230P5 from chromosome...	42	1.3
271	gb\|AC123926.4\| Mus musculus BAC clone RP24-326N11 from chromosom...	42	1.3
272	gb\|AC124403.3\| Mus musculus BAC clone RP24-369I6 from chromosome...	42	1.3
273	gb\|AC122490.3\| Mus musculus BAC clone RP24-388D8 from chromosome...	42	1.3
274	gb\|AC124385.3\| Mus musculus BAC clone RP24-421A2 from chromosome...	42	1.3
275	gb\|AC129291.4\| Mus musculus BAC clone RP24-491O22 from chromosom...	42	1.3
276	gb\|AC122800.3\| Mus musculus BAC clone RP23-451G9 from chromosome...	42	1.3
277	gb\|AC128698.4\| Mus musculus BAC clone RP24-127J4 from chromosome...	42	1.3
278	gb\|AC127282.3\| Mus musculus BAC clone RP23-318O24 from chromosom...	42	1.3
279	gb\|AC123857.4\| Mus musculus BAC clone RP23-344L21 from chromosom...	42	1.3
280	gb\|AC121888.3\| Mus musculus BAC clone RP24-142M5 from chromosome...	42	1.3
281	gb\|AC124690.4\| Mus musculus BAC clone RP24-157B13 from chromosom...	42	1.3
282	gb\|AC126249.4\| Mus musculus BAC clone RP23-412I9 from chromosome...	42	1.3
283	gb\|AC121793.3\| Mus musculus BAC clone RP23-407B23 from chromosom...	42	1.3
284	gb\|AC124720.3\| Mus musculus BAC clone RP23-387F14 from chromosom...	42	1.3
285	gb\|AC122916.4\| Mus musculus BAC clone RP23-28F1 from 5, complete...	42	1.3
286	gb\|AC123555.4\| Mus musculus BAC clone RP23-139L20 from 1, comple...	42	1.3
287	gb\|AC122873.5\| Mus musculus BAC clone RP23-110K10 from 8, comple...	42	1.3
288	gb\|AC132133.1\| Mus musculus BAC clone RP23-242A12 from 17, compl...	42	1.3
289	gb\|AC129180.3\| Mus musculus BAC clone RP23-304I16 from 18, compl...	42	1.3
290	gb\|AC122898.4\| Mus musculus BAC clone RP23-71K9 from 1, complete...	42	1.3
291	gb\|AC122875.2\| Mus musculus BAC clone RP23-113B22 from 5, comple...	42	1.3
292	gb\|AC116592.5\| Mus musculus BAC clone RP24-90K3 from 2, complete...	42	1.3
293	gb\|AC121865.2\| Mus musculus BAC clone RP24-112O1 from 8, complet...	42	1.3
294	gb\|AC098715.3\| Mus musculus BAC clone RP23-2D23 from 7, complete...	42	1.3
295	gb\|AC084390.1\| Mus musculus BAC clone RP23-285H9 from 1, complet...	42	1.3
296	emb\|CR717880.3\|CNS0GGV2 Tetraodon nigroviridis full-length cDNA	42	1.3
297	gb\|AC117596.6\| Mus musculus chromosome 6, clone RP23-392K24, com...	42	1.3
298	gb\|AC079113.4\| Homo sapiens BAC clone RP11-81E15 from 7, complet...	42	1.3
299	gb\|AC073125.5\| Homo sapiens BAC clone RP11-636L15 from 7, comple...	42	1.3
300	gb\|AC004949.1\| Homo sapiens PAC clone RP5-1008N9 from 7, complet...	42	1.3
301	gb\|AC116766.9\| Mus musculus chromosome 18, clone RP23-395B17, co...	42	1.3
302	gb\|AC108838.20\| Mus musculus chromosome 18, clone RP23-326N14, c...	42	1.3
303	gb\|AC113097.11\| Mus musculus chromosome 18, clone RP23-314E8, co...	42	1.3
304	gb\|AC109166.10\| Mus musculus chromosome 7, clone RP23-310P1, com...	42	1.3
305	gb\|AC163993.3\| Mus musculus chromosome 19, clone RP24-78O14, com...	42	1.3
306	gb\|AC145771.1\| Pan troglodytes BAC clone RP43-14A5 from 7, compl...	42	1.3
307	gb\|AC102637.7\| Mus musculus chromosome 6, clone RP23-216B9, comp...	42	1.3
308	gb\|AC098684.13\| Mus musculus strain 129/Sv clone ct7-391l15 map ...	42	1.3
309	emb\|CR936416.6\| Zebrafish DNA sequence from clone DKEY-271F3 in ...	42	1.3
310	gb\|AC163665.4\| Mus musculus BAC clone RP23-325J23 from chromosom...	42	1.3
311	gb\|AC124360.5\| Mus musculus BAC clone RP24-502M22 from chromosom...	42	1.3
312	gb\|AC118590.11\| Mus musculus chromosome 15, clone RP24-506N7, co...	42	1.3
313	emb\|Z99916.1\|HS221G9 Human DNA sequence from clone CTA-221G9 on ...	42	1.3
314	emb\|AL929403.9\| Human DNA sequence from clone RP13-438O9 on chro...	42	1.3
315	emb\|AL731574.10\| Human DNA sequence from clone RP11-56I23 on chr...	42	1.3
316	emb\|AL589203.1\| Human DNA sequence from clone RP11-391F23 on chr...	42	1.3
317	emb\|AL390788.15\| Human DNA sequence from clone RP11-384P5 on chr...	42	1.3
318	gb\|AC121327.3\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.3
319	gb\|AE014816.1\| Plasmodium falciparum 3D7 chromosome 14 section 1...	42	1.3
320	gb\|AE014838.1\| Plasmodium falciparum 3D7 chromosome 11 section 3...	42	1.3
321	emb\|AL355333.18\| Human DNA sequence from clone RP11-575N15 on ch...	42	1.3
322	gb\|AC111653.8\| Rattus norvegicus 2 BAC CH230-108E11 (Children's ...	42	1.3
323	emb\|AL354857.13\| Human DNA sequence from clone RP11-346N8 on chr...	42	1.3
324	gb\|AC124926.7\| Rattus norvegicus X BAC CH230-155H3 (Children's H...	42	1.3
325	gb\|AC129225.2\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.3
326	emb\|AL139141.23\| Human DNA sequence from clone RP5-1180C10 on ch...	42	1.3
327	gb\|AC091503.2\| Rattus norvegicus strain Brown Norway clone RP31-...	42	1.3
328	gb\|AC087722.2\| Rattus norvegicus strain Brown Norway clone RP31-...	42	1.3
329	gb\|AC138378.7\| Mus musculus chromosome 19, clone RP24-265D22, co...	42	1.3
330	emb\|AL033376.17\|HS278N12 Human DNA sequence from clone RP1-278N1...	42	1.3
331	gb\|AC124918.5\| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hos...	42	1.3
332	emb\|AL022722.1\|HS354N19 Human DNA sequence from clone RP3-354N19...	42	1.3
333	emb\|CR788255.6\| Zebrafish DNA sequence from clone DKEY-9C18 in l...	42	1.3
334	gb\|AC024073.7\| Homo sapiens chromosome 10 clone RP11-394D15, com...	42	1.3
335	gb\|AC104890.16\| Mus musculus chromosome 1, clone RP23-260J11, co...	42	1.3
336	gb\|AC162299.6\| Mus musculus chromosome 1, clone RP24-320H7, comp...	42	1.3
337	gb\|AC161605.7\| Mus musculus BAC clone RP23-230N15 from chromosom...	42	1.3
338	gb\|AC153495.10\| Mus musculus 10 BAC RP23-468D5 (Roswell Park Can...	42	1.3
339	gb\|AC159291.3\| Mus musculus BAC clone RP23-287P9 from chromosome...	42	1.3
340	gb\|AC158773.6\| Mus musculus chromosome 1, clone RP23-324F10, com...	42	1.3
341	emb\|AL929358.1\|PFA929358 Plasmodium falciparum strain 3D7, chrom...	42	1.3
342	emb\|AL606829.13\| Mouse DNA sequence from clone RP23-10M12 on chr...	42	1.3
343	gb\|AC164573.5\| Mus musculus 10 BAC RP24-221D13 (Roswell Park Can...	42	1.3
344	emb\|AL606520.16\| Mouse DNA sequence from clone RP23-280G18 on ch...	42	1.3
345	emb\|BX957307.12\| Zebrafish DNA sequence from clone CH211-117E20 ...	42	1.3
346	emb\|AL731714.9\| Mouse DNA sequence from clone RP23-117H24 on chr...	42	1.3
347	emb\|AL732397.5\| Mouse DNA sequence from clone RP23-469O11 on chr...	42	1.3
348	emb\|AL662786.5\| Mouse DNA sequence from clone RP23-340O10 on chr...	42	1.3
349	emb\|AL805932.4\| Mouse DNA sequence from clone RP23-41H11 on chro...	42	1.3
350	emb\|AL645985.30\| Mouse DNA sequence from clone DN-240H8 on chrom...	42	1.3
351	emb\|BX548042.7\| Zebrafish DNA sequence from clone DKEY-146L4 in ...	42	1.3
352	gb\|AC163642.3\| Mus musculus BAC clone RP24-456N17 from chromosom...	42	1.3
353	gb\|AC161583.2\| Mus musculus BAC clone RP24-566C13 from chromosom...	42	1.3
354	gb\|AY208121.1\| Sus scrofa myostatin gene, complete cds	42	1.3
355	gb\|AC083806.16\| Homo sapiens 12q BAC RP11-240G22 (Roswell Park C...	42	1.3
356	emb\|BX914204.20\| Zebrafish DNA sequence from clone CH211-113E18 ...	42	1.3
357	gb\|AC023709.4\| Drosophila melanogaster X BAC RP98-10I17 (Roswell...	42	1.3
358	gb\|AC146694.12\| Pan troglodytes clone rp43-178l17, complete sequ...	42	1.3
359	gb\|AC104018.3\| Homo sapiens chromosome 8, clone RP11-354A14, com...	42	1.3
360	gb\|AC104810.5\| Homo sapiens BAC clone RP11-641D2 from 4, complet...	42	1.3
361	emb\|BX936456.6\| Zebrafish DNA sequence from clone DKEY-266J9 in ...	42	1.3
362	gb\|AC105123.4\| Homo sapiens chromosome 15, clone RP11-94B17, com...	42	1.3
363	gb\|AC055777.12\| Mus musculus chromosome 10, clone RP23-56K17, co...	42	1.3
364	gb\|AC093521.3\| Homo sapiens chromosome 5 clone RP11-152P24, comp...	42	1.3
365	gb\|AC027671.9\| Homo sapiens chromosome 10 clone RP11-183F21, com...	42	1.3
366	dbj\|AB219074.1\| Sorghum bicolor SbPCL1 mRNA, partial cds	42	1.3
367	gb\|AC104816.4\| Homo sapiens BAC clone RP11-690I4 from 4, complet...	42	1.3
368	gb\|AC110081.3\| Homo sapiens BAC clone RP11-453M2 from 4, complet...	42	1.3
369	dbj\|AK145473.1\| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	42	1.3
370	gb\|AC084200.22\| Homo sapiens 12q BAC RP11-654D12 (Roswell Park C...	42	1.3
371	gb\|AC093788.3\| Homo sapiens BAC clone RP11-218F10 from 4, comple...	42	1.3
372	gb\|AC098567.4\| Genomic sequence for Mus musculus, clone RP23-198...	42	1.3
373	dbj\|AK166562.1\| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN fu...	42	1.3
374	gb\|AC019235.6\| Homo sapiens BAC clone RP11-665C14 from 4, comple...	42	1.3
375	gb\|AC161266.2\| Mus musculus BAC clone RP23-231B13 from chromosom...	42	1.3
376	gb\|AC155709.5\| Mus musculus 10 BAC RP24-200F4 (Roswell Park Canc...	42	1.3
377	gb\|AC159542.8\| Mus musculus 10 BAC RP23-137B10 (Roswell Park Can...	42	1.3
378	gb\|AC151895.4\| Mus musculus BAC clone RP24-323A22 from chromosom...	42	1.3
379	gb\|AC151294.3\| Mus musculus BAC clone RP23-137I7 from chromosome...	42	1.3
380	gb\|AC153363.4\| Mus musculus BAC clone RP23-5I6 from chromosome 9...	42	1.3
381	gb\|AC162947.2\| Mus musculus BAC clone RP23-12D16 from chromosome...	42	1.3
382	gb\|AC160123.2\| Mus musculus BAC clone RP23-354J5 from chromosome...	42	1.3
383	dbj\|AK170038.1\| Mus musculus NOD-derived CD11c +ve dendritic cel...	42	1.3
384	gb\|AC105151.8\| Mus musculus chromosome 1, clone RP23-28N2, compl...	42	1.3
385	gb\|AC158626.6\| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer...	42	1.3
386	dbj\|AK040567.1\| Mus musculus 0 day neonate thymus cDNA, RIKEN fu...	42	1.3
387	gb\|AC154596.2\| Mus musculus BAC clone RP23-354C17 from chromosom...	42	1.3
388	gb\|AC155313.2\| Mus musculus BAC clone RP23-349D10 from chromosom...	42	1.3
389	gb\|AC154569.2\| Mus musculus BAC clone RP23-385I2 from chromosome...	42	1.3
390	gb\|AC161370.3\| Mus musculus BAC clone RP23-437J23 from chromosom...	42	1.3
391	gb\|AC154473.2\| Mus musculus BAC clone RP24-120O11 from chromosom...	42	1.3
392	gb\|AC159243.2\| Mus musculus BAC clone RP24-274F15 from chromosom...	42	1.3
393	gb\|AC144908.17\| Mus musculus chromosome 5, clone RP23-102O19, co...	42	1.3
394	gb\|AC153372.5\| Mus musculus 6 BAC RP23-358G19 (Roswell Park Canc...	42	1.3
395	dbj\|AK079495.1\| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	42	1.3
396	gb\|U37715.1\|DFU37715 Dictyocaulus filaria internal transcribed s...	42	1.3
397	emb\|BX322616.8\| Zebrafish DNA sequence from clone DKEY-21K24 in ...	42	1.3
398	dbj\|AK086276.1\| Mus musculus 15 days embryo head cDNA, RIKEN ful...	42	1.3
399	gb\|AC157773.6\| Mus musculus chromosome 8, clone RP24-161L20, com...	42	1.3
400	gb\|AC153507.11\| Mus musculus 10 BAC RP23-411J14 (Roswell Park Ca...	42	1.3
401	gb\|AC158661.7\| Mus musculus 6 BAC RP23-31E23 (Roswell Park Cance...	42	1.3
402	gb\|AC155329.7\| Mus musculus 6 BAC RP24-183K24 (Roswell Park Canc...	42	1.3
403	emb\|BX511232.6\| Zebrafish DNA sequence from clone CH211-11K18 in...	42	1.3
404	gb\|AC013751.6\|AC013751 Homo sapiens chromosome , clone RP11-298P...	42	1.3
405	emb\|BX255960.14\| Zebrafish DNA sequence from clone DKEY-265E17 i...	42	1.3
406	emb\|AL953856.8\| Zebrafish DNA sequence from clone DKEY-43F9 in l...	42	1.3
407	emb\|BX248233.7\| Zebrafish DNA sequence from clone CH211-125N11 i...	42	1.3
408	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
409	gb\|AC008344.2\|AC008344 Drosophila melanogaster, chromosome 2R, r...	42	1.3
410	gb\|AC008096.3\|AC008096 Drosophila melanogaster, chromosome 2R, r...	42	1.3
411	emb\|BX120015.12\| Zebrafish DNA sequence from clone RP71-3A8 in l...	42	1.3
412	gb\|AC093591.3\| Homo sapiens BAC clone RP11-50D9 from 4, complete...	42	1.3
413	gb\|AC007464.4\| Homo sapiens BAC clone RP11-542B5 from 2, complet...	42	1.3
414	gb\|AC153515.8\| Mus musculus 10 BAC RP23-425D13 (Roswell Park Can...	42	1.3
415	gb\|AC155640.5\| Mus musculus 10 BAC RP24-87H21 (Roswell Park Canc...	42	1.3
416	gb\|AC153912.8\| Mus musculus 10 BAC RP23-331E5 (Roswell Park Canc...	42	1.3
417	gb\|AC147289.3\| Pan troglodytes BAC clone RP43-75A12 from chromos...	42	1.3
418	gb\|AC154340.3\| Mus musculus BAC clone RP23-238B22 from chromosom...	42	1.3
419	gb\|AC154659.2\| Mus musculus BAC clone RP24-269K6 from chromosome...	42	1.3
420	gb\|AC107675.13\| Mus musculus chromosome 1, clone RP24-471N7, com...	42	1.3
421	gb\|AC157813.6\| Mus musculus chromosome 1, clone RP24-70I14, comp...	42	1.3
422	dbj\|AB162342.1\| Oncorhynchus mykiss genes, MHC class I a region,...	42	1.3
423	gb\|AC156029.2\| Mus musculus BAC clone RP23-42O8 from chromosome ...	42	1.3
424	gb\|AC123530.4\| Mus musculus BAC clone RP24-194D2 from chromosome...	42	1.3
425	gb\|AC153613.9\| Mus musculus 10 BAC RP23-23C9 (Roswell Park Cance...	42	1.3
426	gb\|AC113303.16\| Mus musculus chromosome 5, clone RP23-431E5, com...	42	1.3
427	gb\|AC007682.3\| Homo sapiens BAC clone RP11-391D19 from 2, comple...	42	1.3
428	gb\|AC093570.30\| Mus musculus strain C57BL/6J chromosome 5 clone ...	42	1.3
429	gb\|AC023881.6\| Homo sapiens BAC clone RP11-108C2 from 2, complet...	42	1.3
430	gb\|AC068274.5\| Homo sapiens BAC clone RP11-119B15 from 2, comple...	42	1.3
431	gb\|AC103817.6\| Homo sapiens chromosome 8, clone CTD-3083F21, com...	42	1.3
432	gb\|AC016651.8\| Homo sapiens chromosome 5 clone RP1-251I12, compl...	42	1.3
433	gb\|AC097108.5\| Homo sapiens BAC clone RP11-745K4 from 4, complet...	42	1.3
434	gb\|CP000251.1\| Anaeromyxobacter dehalogenans 2CP-C, complete genome	42	1.3
435	gb\|AC087349.17\| Homo sapiens chromosome 8, clone RP11-339A23, co...	42	1.3
436	gb\|AC137484.2\| Rattus Norvegicus Strain BN/SsNHsd/MCW BAC, CH230...	42	1.3
437	gb\|AC113174.3\| Homo sapiens chromosome 1 clone RP11-397A15, comp...	42	1.3
438	dbj\|AP000492.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
439	dbj\|AP005742.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
440	emb\|BX248085.10\| Zebrafish DNA sequence from clone DKEY-225E17 i...	42	1.3
441	emb\|BX842660.2\| Mouse DNA sequence from clone RP23-54L24 on chro...	42	1.3
442	emb\|AL954701.10\| Mouse DNA sequence from clone RP23-43J11 on chr...	42	1.3
443	emb\|AL805898.11\| Mouse DNA sequence from clone RP23-432F24 on ch...	42	1.3
444	emb\|BX005420.7\| Zebrafish DNA sequence from clone CH211-163I12 i...	42	1.3
445	emb\|BX571894.9\| Mouse DNA sequence from clone RP23-203N8 on chro...	42	1.3
446	emb\|BX004839.9\| Zebrafish DNA sequence from clone DKEY-18A23 in ...	42	1.3
447	dbj\|AP005071.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
448	dbj\|AP004113.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
449	emb\|AL929254.12\| Mouse DNA sequence from clone RP23-456I1 on chr...	42	1.3
450	emb\|BX649217.1\| Mouse DNA sequence from clone RP24-86D15 on chro...	42	1.3
451	emb\|AL929097.12\| Mouse DNA sequence from clone RP23-76M8 on chro...	42	1.3
452	emb\|AL844480.29\| Mouse DNA sequence from clone RP23-190B10 on ch...	42	1.3
453	emb\|AL627127.20\| Mouse DNA sequence from clone RP23-360O1 on chr...	42	1.3
454	emb\|AL928902.16\| Mouse DNA sequence from clone RP24-221D3 on chr...	42	1.3
455	dbj\|AK119302.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.3
456	dbj\|AP005697.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.3
457	ref\|XM_314177.2\| Anopheles gambiae str. PEST ENSANGP00000015918 ...	42	1.3
458	gb\|AC154341.2\| Mus musculus BAC clone RP23-240C2 from 16, comple...	42	1.3
459	gb\|AC004960.1\|AC004960 Homo sapiens PAC clone RP5-1098B1 from 7q...	42	1.3
460	gb\|AC154260.2\| Mus musculus BAC clone RP24-225C5 from 17, comple...	42	1.3
461	dbj\|AK072113.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.3
462	emb\|CT025867.20\| Mouse DNA sequence from clone RP24-318I24 on ch...	42	1.3
463	gb\|AC114424.10\| Mus musculus chromosome 3, clone RP24-84L9, comp...	42	1.3
464	dbj\|AK067101.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.3
465	gb\|AC150560.5\| Mus musculus BAC clone RP23-16I14 from 15, comple...	42	1.3
466	gb\|AC122197.4\| Mus musculus BAC clone RP23-55A6 from 10, complet...	42	1.3
467	gb\|AC154378.2\| Mus musculus BAC clone RP23-64O5 from 17, complet...	42	1.3
468	gb\|AC126275.3\| Mus musculus BAC clone RP23-111N17 from 14, compl...	42	1.3
469	gb\|AC149599.3\| Mus musculus BAC clone RP23-193A3 from 18, comple...	42	1.3
470	gb\|AC156019.2\| Mus musculus BAC clone RP23-348E17 from 5, comple...	42	1.3
471	gb\|AC154719.2\| Mus musculus BAC clone RP24-370O15 from 16, compl...	42	1.3
472	gb\|AC122328.4\| Mus musculus BAC clone RP23-341A4 from 15, comple...	42	1.3
473	gb\|AC122495.4\| Mus musculus BAC clone RP24-397P10 from 9, comple...	42	1.3
474	gb\|AC155266.2\| Mus musculus BAC clone RP23-259L1 from 12, comple...	42	1.3
475	emb\|BX465199.9\| Zebrafish DNA sequence from clone DKEY-84I7 in l...	42	1.3
476	gb\|AY109441.1\| Zea mays CL359_1 mRNA sequence	42	1.3
477	emb\|AL590148.8\| Zebrafish DNA sequence from clone RP71-30I22 in ...	42	1.3
478	gb\|AC107766.14\| Mus musculus chromosome 1, clone RP23-166L24, co...	42	1.3
479	emb\|CT025611.16\| Mouse DNA sequence from clone RP24-100P15 on ch...	42	1.3
480	emb\|CR735106.9\| Zebrafish DNA sequence from clone CH211-232N15 i...	42	1.3
481	emb\|AL442104.2\| Oryza sativa genomic DNA, chromosome 4, BAC clon...	42	1.3
482	gb\|AE003829.4\| Drosophila melanogaster chromosome 2R, section 21...	42	1.3
483	gb\|AE003796.3\| Drosophila melanogaster chromosome 2R, section 54...	42	1.3
484	gb\|AE003451.5\| Drosophila melanogaster chromosome X, section 35 ...	42	1.3
485	emb\|AL355101.2\|CNS05TCK Human chromosome 14 DNA sequence BAC R-6...	42	1.3
486	gb\|AC121131.14\| Mus musculus chromosome 8, clone RP23-187D7, com...	42	1.3
487	gb\|AC115761.12\| Mus musculus chromosome 7, clone RP23-62N10, com...	42	1.3
488	gb\|AC101931.8\| Mus musculus chromosome 1, clone RP24-63O23, comp...	42	1.3
489	gb\|AC107776.12\| Mus musculus chromosome 17, clone RP23-92G2, com...	42	1.3
490	gb\|AC105989.14\| Mus musculus chromosome 8, clone RP24-95N3, comp...	42	1.3
491	emb\|BX901900.20\| Zebrafish DNA sequence from clone CH211-189A21 ...	42	1.3
492	emb\|CT033750.18\| Mouse DNA sequence from clone RP23-263M5 on chr...	42	1.3
493	gb\|AC100967.15\| Mus musculus chromosome 5, clone RP23-74L20, com...	42	1.3
494	gb\|AC102209.11\| Mus musculus chromosome 3, clone RP24-280F5, com...	42	1.3
495	gb\|AC074042.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	1.3
496	emb\|AL928661.10\| Mouse DNA sequence from clone RP23-3E2 on chrom...	42	1.3
497	emb\|CR855880.13\| Zebrafish DNA sequence from clone DKEY-215C14 i...	42	1.3
498	gb\|AC100541.17\| Mus musculus chromosome 8, clone RP23-152F18, co...	42	1.3
499	gb\|AC164400.7\| Mus musculus chromosome 1, clone RP23-379N20, com...	42	1.3
500	gb\|L42167.1\|MUSSEQAA Mus musculus (clone R24) rds gene, partial cds	42	1.3

>gb|AY107218.1| Zea mays PCO140184 mRNA sequence
          Length = 548

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 5   tggagctgcccgacgacgacgacgaggactacctcatcgttcccgatcttggatgaga 62
           ||||| |||| ||||||||||||||||||||| |||||||||| |||||||| |||||
Sbjct: 195 tggaggtgcctgacgacgacgacgaggactacttcatcgttcctgatcttggctgaga 252

to top

>gb|AY137517.1| Hordeum vulgare subsp. vulgare hypersensitive-induced reaction
            protein 3 (hir3) gene, complete cds
          Length = 6537

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 155  tggtttcagttcaaatttgtactaaaagcacgacaaatattttggaacgga 205
            |||||| |||||||||||||||||||| |||||||  ||||||||| ||||
Sbjct: 5880 tggttttagttcaaatttgtactaaaaccacgacacttattttggatcgga 5830

to top

>emb|AL662938.3|OSJN00138 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30,
             complete sequence
          Length = 88547

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 22    gacgacgaggactacctcatcgttcccgatcttggatgagat 63
             ||||||||||||| | |||||||||| |||||||||||||||
Sbjct: 78635 gacgacgaggacttcttcatcgttcctgatcttggatgagat 78594

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                          
Query: 22       gacgacgaggactacctcatcgttcccgatcttggatgagat 63
                ||||||||||||| | |||||||||| |||||||||||||||
Sbjct: 24623490 gacgacgaggacttcttcatcgttcctgatcttggatgagat 24623449



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 8       agctgcccgacgacgacgacga 29
               ||||||||||||||||||||||
Sbjct: 5634297 agctgcccgacgacgacgacga 5634276



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 95       atgtattccctccgttccaaagtacttgtcgt 126
                |||||||||||||||| |||| ||||| ||||
Sbjct: 34651974 atgtattccctccgtttcaaattacttatcgt 34651943



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 93       tgatgtattccctccgttccaaagtacttgtc 124
                ||||||| ||||||||||||||| || |||||
Sbjct: 24027096 tgatgtactccctccgttccaaattagttgtc 24027127



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 188      caaatattttggaacggatgaagtatga 215
                ||||||||| || |||||||||||||||
Sbjct: 20825260 caaatatttaggtacggatgaagtatga 20825287



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 251584 tatgtatgtgtgtatgtatg 251603

to top

>dbj|AK061664.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-E12, full
           insert sequence
          Length = 765

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 22  gacgacgaggactacctcatcgttcccgatcttggatgagat 63
           ||||||||||||| | |||||||||| |||||||||||||||
Sbjct: 517 gacgacgaggacttcttcatcgttcctgatcttggatgagat 558

to top

>emb|AL512542.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0522A01, complete
             sequence
          Length = 97077

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 22    gacgacgaggactacctcatcgttcccgatcttggatgagat 63
             ||||||||||||| | |||||||||| |||||||||||||||
Sbjct: 62281 gacgacgaggacttcttcatcgttcctgatcttggatgagat 62240

to top

>emb|AL606629.3|OSJN00061 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0091E11,
             complete sequence
          Length = 133856

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 22    gacgacgaggactacctcatcgttcccgatcttggatgagat 63
             ||||||||||||| | |||||||||| |||||||||||||||
Sbjct: 13013 gacgacgaggacttcttcatcgttcctgatcttggatgagat 12972

to top

>dbj|AB001883.1| Oryza sativa (japonica cultivar-group) mRNA for zinc finger
           protein, complete cds, clone:E10707
          Length = 987

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 22  gacgacgaggactacctcatcgttcccgatcttggatgagat 63
           ||||||||||||| | |||||||||| |||||||||||||||
Sbjct: 758 gacgacgaggacttcttcatcgttcctgatcttggatgagat 799

to top

>ref|XM_473004.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 774

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 22  gacgacgaggactacctcatcgttcccgatcttggatga 60
           ||||||||||||| | |||||||||| ||||||||||||
Sbjct: 736 gacgacgaggacttcttcatcgttcctgatcttggatga 774

to top

>gb|AC091046.2|AC091046 Homo sapiens chromosome 15 clone RP11-123C21 map 15q21.3, complete
             sequence
          Length = 186846

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 228   tatgtatgtgtgtatgtatgcaaagggat 256
             ||||||||| |||||||||||||||||||
Sbjct: 90806 tatgtatgtatgtatgtatgcaaagggat 90778

to top

>gb|AC152976.1| Mus musculus  BAC RP23-103K17 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 194151

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 228  tatgtatgtgtgtatgtatgcaaa 251
            ||||||||||||||||||||||||
Sbjct: 4253 tatgtatgtgtgtatgtatgcaaa 4230

to top

>gb|AC102668.12| Mus musculus chromosome 6, clone RP23-296I18, complete sequence
          Length = 186488

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 228   tatgtatgtgtgtatgtatgcaaa 251
             ||||||||||||||||||||||||
Sbjct: 86498 tatgtatgtgtgtatgtatgcaaa 86475

to top

>gb|AY821714.1| Peridictyon sanctum beta amylase gene, partial cds; and Stowaway
            MITE, complete sequence
          Length = 1475

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 155  tggtttcagttcaaatttgtactaaaagcacgacaaatattttggaacgga 205
            |||||| |||||||||||| ||||||| ||||||   ||||||||| ||||
Sbjct: 1255 tggttttagttcaaatttgaactaaaaccacgacgcttattttggatcgga 1205

to top

>ref|XM_466630.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 18  cgacgacgacgaggactacctcatcgttcccgatcttgg 56
           ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 898 cgacgacgaggaggattacctcatcgtccctgatcttgg 936

to top

>ref|XM_506858.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1058_F07.25
           mRNA
          Length = 1078

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 18  cgacgacgacgaggactacctcatcgttcccgatcttgg 56
           ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 898 cgacgacgaggaggattacctcatcgtccctgatcttgg 936

to top

>gb|AC158966.5| Mus musculus chromosome 1, clone RP23-382I8, complete sequence
          Length = 183519

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 130652 atatgtatgtgtgtatgtatgca 130630

to top

>gb|AC109305.6| Mus musculus chromosome 1, clone RP24-350F5, complete sequence
          Length = 184088

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 67284 atatgtatgtgtgtatgtatgca 67306

to top

>gb|AC102420.10| Mus musculus chromosome 8, clone RP24-553O21, complete sequence
          Length = 178616

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 225    tgatatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||||
Sbjct: 117012 tgatatgtatgtgtgtatgtatg 117034

to top

>gb|AC161206.10| Mus musculus chromosome 15, clone RP24-299A13, complete sequence
          Length = 165791

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 37777 atatgtatgtgtgtatgtatgca 37799



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 37870 tatgtatgtgtgtatgtatg 37889



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 37858 tatgtatgtgtgtatgtatg 37877



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 37234 tatgtatgtgtgtatgtatg 37253

to top

>gb|AC141566.4| Mus musculus BAC clone RP23-89G14 from chromosome 7, complete sequence
          Length = 236600

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 214508 atatgtatgtgtgtatgtatgca 214486

to top

>gb|AC126442.4| Mus musculus BAC clone RP23-453M12 from chromosome 7, complete sequence
          Length = 204287

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 92080 atatgtatgtgtgtatgtatgca 92102

to top

>gb|AC121575.4| Mus musculus BAC clone RP23-241P4 from 1, complete sequence
          Length = 193725

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 96370 atatgtatgtgtgtatgtatgca 96392

to top

>gb|AC166996.1| Mus musculus BAC clone RP23-268E1 from chromosome 12, complete sequence
          Length = 162710

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 225   tgatatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||||
Sbjct: 12887 tgatatgtatgtgtgtatgtatg 12909

to top

>gb|AC137546.33| Medicago truncatula clone mth2-24g3, complete sequence
          Length = 123291

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 225   tgatatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||||
Sbjct: 82807 tgatatgtatgtgtgtatgtatg 82785

to top

>emb|AL096861.9|HSDJ824H1 Human DNA sequence from clone RP5-824H1 on chromosome Xq27.1-28,
             complete sequence
          Length = 129686

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 88438 atatgtatgtgtgtatgtatgca 88416

to top

>emb|CR407559.8| Zebrafish DNA sequence from clone CH211-283G2 in linkage group 5,
              complete sequence
          Length = 149707

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 135352 atatgtatgtgtgtatgtatgca 135330

to top

>gb|AC116715.22| Mus musculus chromosome 5, clone RP23-129N14, complete sequence
          Length = 193245

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 134759 atatgtatgtgtgtatgtatgca 134737

to top

>emb|AL732631.4| Mouse DNA sequence from clone RP23-345P19 on chromosome 11 no genes,
              complete sequence
          Length = 191363

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 135235 atatgtatgtgtgtatgtatgca 135257

to top

>ref|NM_167461.1| Drosophila melanogaster Platelet-activating factor acetylhydrolase
            alpha CG8962-RA, transcript variant A (Paf-AHalpha), mRNA
          Length = 1503

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 227  atatgtatgtgtgtatgtatgca 249
            |||||||||||||||||||||||
Sbjct: 1260 atatgtatgtgtgtatgtatgca 1238

to top

>ref|NM_080350.3| Drosophila melanogaster Platelet-activating factor acetylhydrolase
            alpha CG8962-RB, transcript variant B (Paf-AHalpha), mRNA
          Length = 1431

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 227  atatgtatgtgtgtatgtatgca 249
            |||||||||||||||||||||||
Sbjct: 1188 atatgtatgtgtgtatgtatgca 1166

to top

>gb|AC016573.7| Homo sapiens chromosome 5 clone CTB-32H22, complete sequence
          Length = 100508

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 56886 atatgtatgtgtgtatgtatgca 56864

to top

>gb|AY069389.1| Drosophila melanogaster LD09790 full length cDNA
          Length = 1443

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 227  atatgtatgtgtgtatgtatgca 249
            |||||||||||||||||||||||
Sbjct: 1181 atatgtatgtgtgtatgtatgca 1159

to top

>gb|AC092401.1|AC092401 Drosophila melanogaster, chromosome X, region 13E-13F, BAC clone
             BACR25C18, complete sequence
          Length = 185200

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 95789 atatgtatgtgtgtatgtatgca 95811

to top

>gb|AC013431.9|AC013431 Drosophila melanogaster, chromosome X, region 13E-13F, BAC clone
             BACR22H11, complete sequence
          Length = 191558

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 74519 atatgtatgtgtgtatgtatgca 74541

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 191      atattttggaacggatgaagtat 213
                |||||||||||||||||||||||
Sbjct: 17543204 atattttggaacggatgaagtat 17543182



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 188      caaatattttggaacggatgaagta 212
                ||||||||| |||||||||||||||
Sbjct: 21539198 caaatatttaggaacggatgaagta 21539222

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 18       cgacgacgacgaggactacctcatcgttcccgatcttgg 56
                ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 23779646 cgacgacgaggaggattacctcatcgtccctgatcttgg 23779684



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 191      atattttggaacggatgaagta 212
                ||||||||||||||||||||||
Sbjct: 20612435 atattttggaacggatgaagta 20612456



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 227     atatgtatgtgtgtatgtatg 247
               |||||||||||||||||||||
Sbjct: 3784796 atatgtatgtgtgtatgtatg 3784776



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 12       gcccgacgacgacgacgagg 31
                ||||||||||||||||||||
Sbjct: 31012760 gcccgacgacgacgacgagg 31012779



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 191      atattttggaacggatgaag 210
                ||||||||||||||||||||
Sbjct: 22891542 atattttggaacggatgaag 22891561



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 15      cgacgacgacgacgaggact 34
               ||||||||||||||||||||
Sbjct: 4829483 cgacgacgacgacgaggact 4829502

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 191      atattttggaacggatgaagtat 213
                |||||||||||||||||||||||
Sbjct: 30581254 atattttggaacggatgaagtat 30581276



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 15       cgacgacgacgacgaggactacctca 40
                ||||||||||||||||| ||||||||
Sbjct: 43117681 cgacgacgacgacgagggctacctca 43117656



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 6       ggagctgcccgacgacgacgacgag 30
               |||| ||||||||||||||||||||
Sbjct: 8406710 ggaggtgcccgacgacgacgacgag 8406686



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 228      tatgtatgtgtgtatgtatg 247
                ||||||||||||||||||||
Sbjct: 20860647 tatgtatgtgtgtatgtatg 20860666



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 13      cccgacgacgacgacgagga 32
               ||||||||||||||||||||
Sbjct: 2253928 cccgacgacgacgacgagga 2253909

to top

>gb|AC026369.21|AC026369 Homo sapiens 12 BAC RP11-598F7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 136725

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 88837 atatgtatgtgtgtatgtatgca 88815

to top

>gb|AC101696.14| Mus musculus chromosome 1, clone RP23-238M18, complete sequence
          Length = 162270

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 60020 atatgtatgtgtgtatgtatgca 59998

to top

>dbj|AP003309.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0036G09
          Length = 124118

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 191   atattttggaacggatgaagtat 213
             |||||||||||||||||||||||
Sbjct: 63858 atattttggaacggatgaagtat 63880

to top

>dbj|AP003560.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1060H01
          Length = 157987

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 191   atattttggaacggatgaagtat 213
             |||||||||||||||||||||||
Sbjct: 23531 atattttggaacggatgaagtat 23553

to top

>gb|AC106731.3| Homo sapiens chromosome 5 clone CTD-2216D16, complete sequence
          Length = 132722

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 130423 atatgtatgtgtgtatgtatgca 130445

to top

>dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0019B14
          Length = 127570

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 191    atattttggaacggatgaagtat 213
              |||||||||||||||||||||||
Sbjct: 107382 atattttggaacggatgaagtat 107360

to top

>dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0030C08
          Length = 163423

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 18   cgacgacgacgaggactacctcatcgttcccgatcttgg 56
            ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 1312 cgacgacgaggaggattacctcatcgtccctgatcttgg 1350

to top

>dbj|AP004111.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1058_F07
          Length = 95841

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 18    cgacgacgacgaggactacctcatcgttcccgatcttgg 56
             ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 90230 cgacgacgaggaggattacctcatcgtccctgatcttgg 90268

to top

>dbj|AK104293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G06, full
           insert sequence
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 18  cgacgacgacgaggactacctcatcgttcccgatcttgg 56
           ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 898 cgacgacgaggaggattacctcatcgtccctgatcttgg 936

to top

>dbj|AK061044.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-E01, full
           insert sequence
          Length = 1078

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 18  cgacgacgacgaggactacctcatcgttcccgatcttgg 56
           ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 898 cgacgacgaggaggattacctcatcgtccctgatcttgg 936

to top

>gb|AE003500.4| Drosophila melanogaster chromosome X, section 52 of 74 of the complete
             sequence
          Length = 303344

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 78509 atatgtatgtgtgtatgtatgca 78531

to top

>gb|AC104225.18| Mus musculus chromosome 15, clone RP23-74H8, complete sequence
          Length = 246325

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 128610 atatgtatgtgtgtatgtatgca 128632



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 128703 tatgtatgtgtgtatgtatg 128722



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 128691 tatgtatgtgtgtatgtatg 128710



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 128067 tatgtatgtgtgtatgtatg 128086

to top

>gb|AF098069.1|AF098069 Drosophila melanogaster platelet-activating factor acetylhydrolase
           alpha subunit homolog mRNA, complete cds
          Length = 1178

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 227 atatgtatgtgtgtatgtatgca 249
           |||||||||||||||||||||||
Sbjct: 977 atatgtatgtgtgtatgtatgca 955

to top

>emb|CR974457.17| Mouse DNA sequence from clone RP23-319E15 on chromosome 17, complete
             sequence
          Length = 124639

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 58727 atatgtatgtgtgtatgtatgca 58749

to top

>emb|AL590988.11| Mouse DNA sequence from clone RP23-46C18 on chromosome 8, complete
              sequence
          Length = 183975

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 106842 atatgtatgtgtgtatgtatgca 106820

to top

>gb|AC111089.27| Mus musculus chromosome 5, clone RP23-156F20, complete sequence
          Length = 211658

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 204210 atatgtatgtgtgtatgtatgca 204232

to top

>gb|AC131189.3| Mus musculus BAC clone RP24-330P2 from 8, complete sequence
          Length = 157757

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 227    atatgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||||
Sbjct: 116492 atatgtatgtgtgtatgtatgca 116514

to top

>gb|AF050157.1|MMHC135G15 Mus musculus major histocompatibility locus class II region: major
             histocompatibility protein class II alpha chain (IAalpha)
             and major histocompatibility protein class II beta chain
             (IEbeta) genes, complete cds; butyrophilin-like (NG9),
             butyrophilin-like (NG10), hypothetical protein (NG8), and
             butyrophilin-like (NG11) genes, partial cds; NG12
             pseudogene, partial sequence; and hypothetical
             butyrophilin-like protein (NG13) gene, partial cds
          Length = 245439

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 99895 atatgtatgtgtgtatgtatgca 99917



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    atatgtatgtgtgtatgtat 246
              ||||||||||||||||||||
Sbjct: 177558 atatgtatgtgtgtatgtat 177539

to top

>gb|AC146603.3| Mus musculus BAC clone RP23-304P17 from 8, complete sequence
          Length = 167842

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 227   atatgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||||
Sbjct: 62590 atatgtatgtgtgtatgtatgca 62612

to top

>dbj|AB001885.1| Oryza sativa (japonica cultivar-group) mRNA for zinc finger
           protein, complete cds, clone:R1577
          Length = 1197

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 18  cgacgacgacgaggactacctcatcgttcccgatcttgg 56
           ||||||||| ||||| ||||||||||| || ||||||||
Sbjct: 893 cgacgacgaggaggattacctcatcgtccctgatcttgg 931

to top

>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence
          Length = 201694

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 226    gatatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||||
Sbjct: 106213 gatatgtatgtgtgtatgtatg 106234

to top

>gb|AC124664.14| Mus musculus chromosome 1, clone RP23-103B18, complete sequence
          Length = 220456

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 205042 tatgtatgtgtgtatgtatgca 205063

to top

>gb|AC166491.8| Mus musculus chromosome 15, clone RP24-380A15, complete sequence
          Length = 154673

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 224    gtgatatgtatgtgtgtatgtatgca 249
              ||||||||||||| ||||||||||||
Sbjct: 138840 gtgatatgtatgtatgtatgtatgca 138865

to top

>gb|AC155264.2| Mus musculus BAC clone RP23-281B4 from chromosome 16, complete sequence
          Length = 199531

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 52637 tatgtatgtgtgtatgtatgca 52616



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 52613 tatgtatgtgtgtatgtatgca 52592



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 52517 tatgtatgtgtgtatgtatgca 52496



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 52489 tatgtatgtgtgtatgtatgca 52468

to top

>gb|AC132830.12| Mus musculus chromosome 1, clone RP24-566B6, complete sequence
          Length = 205300

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 60490 tatgtatgtgtgtatgtatgca 60511

to top

>ref|XM_475286.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 621

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 8   agctgcccgacgacgacgacga 29
           ||||||||||||||||||||||
Sbjct: 491 agctgcccgacgacgacgacga 512

to top

>ref|XM_474689.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 555

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 8   agctgcccgacgacgacgacga 29
           ||||||||||||||||||||||
Sbjct: 278 agctgcccgacgacgacgacga 257

to top

>ref|NM_189498.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1392

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 15  cgacgacgacgacgaggactacctca 40
           ||||||||||||||||| ||||||||
Sbjct: 138 cgacgacgacgacgagggctacctca 163

to top

>gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, complete sequence
          Length = 181717

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 31860 tatgtatgtgtgtatgtatgca 31839

to top

>gb|AC138278.9| Mus musculus chromosome 8, clone RP23-378E4, complete sequence
          Length = 177245

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 127873 tatgtatgtgtgtatgtatgca 127852

to top

>gb|AC145809.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0023E20, complete sequence
          Length = 130827

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 192   tattttggaacggatgaagtat 213
             ||||||||||||||||||||||
Sbjct: 90808 tattttggaacggatgaagtat 90787

to top

>gb|AC097087.13| Rattus norvegicus  BAC CH230-140P4 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 166595

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 227    atatgtatgtgtgtatgtatgc 248
              ||||||||||||||||||||||
Sbjct: 134396 atatgtatgtgtgtatgtatgc 134417



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 17389 tatgtatgtgtgtatgtatgca 17368



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 134328 atatgtatgtgtgtatgtatg 134348



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 133663 tatgtatgtgtgtatgtatg 133682



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 17401 tatgtatgtgtgtatgtatg 17382

to top

>gb|AC105769.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1301_G07,
             complete sequence
          Length = 106166

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 8     agctgcccgacgacgacgacga 29
             ||||||||||||||||||||||
Sbjct: 76106 agctgcccgacgacgacgacga 76127

to top

>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on
             chromosome 19
          Length = 413528

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 27669 tatgtatgtgtgtatgtatgca 27690



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 324666 tatgtatgtgtgtatgtatg 324647



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 324650 tatgtatgtgtgtatgtatg 324631



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 27816 tatgtatgtgtgtatgtatg 27835



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 27633 tatgtatgtgtgtatgtatg 27652



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 27587 tatgtatgtgtgtatgtatg 27606

to top

>gb|AC161595.3| Mus musculus BAC clone RP23-471H21 from chromosome 9, complete sequence
          Length = 189223

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 171287 tatgtatgtgtgtatgtatgca 171308



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 171198 atatgtatgtgtgtatgtatg 171218



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 171506 tatgtatgtgtgtatgtatg 171525



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    atatgtatgtgtgtatgtat 246
              ||||||||||||||||||||
Sbjct: 171322 atatgtatgtgtgtatgtat 171341

to top

>gb|AC114634.14| Mus musculus chromosome 8, clone RP24-116E2, complete sequence
          Length = 198670

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 31958 tatgtatgtgtgtatgtatgca 31979



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 31938 tatgtatgtgtgtatgtatg 31957

to top

>gb|AC133098.7| Mus musculus BAC clone RP23-336L12 from chromosome 6, complete sequence
          Length = 182955

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 87083 tatgtatgtgtgtatgtatgca 87062

to top

>gb|AC141563.3| Mus musculus BAC clone RP23-410M22 from chromosome 6, complete sequence
          Length = 186983

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 25327 tatgtatgtgtgtatgtatgca 25348



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 25397 tatgtatgtgtgtatgtatg 25416

to top

>gb|AC139750.3| Mus musculus BAC clone RP24-444K8 from chromosome 17, complete sequence
          Length = 160413

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 226    gatatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||||
Sbjct: 105766 gatatgtatgtgtgtatgtatg 105745

to top

>emb|CT010493.12| Mouse DNA sequence from clone RP23-140P6 on chromosome 14, complete
             sequence
          Length = 223982

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 10432 tatgtatgtgtgtatgtatgca 10453

to top

>emb|CR626933.1| Triticum turgidum
          Length = 25216

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 156   ggtttcagttcaaatttgtactaaaagcacgacaaatattttggaacgga 205
             ||||| |||||||||||| ||||||| || ||||  |||||||| |||||
Sbjct: 11862 ggttttagttcaaatttgaactaaaaccaagacacttattttgggacgga 11813

to top

>emb|CR626929.1| Triticum aestivum
          Length = 20745

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 156   ggtttcagttcaaatttgtactaaaagcacgacaaatattttggaacgga 205
             ||||| |||||||||||| ||||||| || ||||  |||||||| |||||
Sbjct: 14580 ggttttagttcaaatttgaactaaaaccaagacacttattttgggacgga 14531

to top

>emb|BX927257.11| Zebrafish DNA sequence from clone CH211-122I22 in linkage group 6,
             complete sequence
          Length = 133388

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 87063 tatgtatgtgtgtatgtatgca 87084



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 87003 tatgtatgtgtgtatgtatgca 87024

to top

>gb|AC138288.13| Mus musculus chromosome 9, clone RP23-464K22, complete sequence
          Length = 235544

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 139113 tatgtatgtgtgtatgtatgca 139134



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 139097 tatgtatgtgtgtatgtatg 139116



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 139081 tatgtatgtgtgtatgtatg 139100



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 139065 tatgtatgtgtgtatgtatg 139084

to top

>gb|AC127575.4| Mus musculus BAC clone RP24-240L12 from chromosome 8, complete sequence
          Length = 162564

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 117087 tatgtatgtgtgtatgtatgca 117066

to top

>gb|AC116596.3| Mus musculus BAC clone RP24-335P21 from chromosome 15, complete
             sequence
          Length = 165103

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 76233 tatgtatgtgtgtatgtatgca 76212

to top

>gb|AC121789.2| Mus musculus BAC clone RP23-398C14 from 1, complete sequence
          Length = 181157

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 222   tagtgatatgtatgtgtgtatgtatg 247
             |||| |||||||||||||||||||||
Sbjct: 77848 tagtaatatgtatgtgtgtatgtatg 77873

to top

>gb|AC110422.3| Mus musculus BAC clone RP24-198G12 from 2, complete sequence
          Length = 111357

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 104305 tatgtatgtgtgtatgtatgca 104284

to top

>gb|AF264711.1|AF264710S2 Rattus norvegicus 6-phosphofructo-1-kinase M-type subunit gene,
           promoter region, partial sequence
          Length = 1747

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 228 tatgtatgtgtgtatgtatgca 249
           ||||||||||||||||||||||
Sbjct: 350 tatgtatgtgtgtatgtatgca 371

to top

>gb|AC102527.6| Mus musculus chromosome 8, clone RP23-29G4, complete sequence
          Length = 197976

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 125271 tatgtatgtgtgtatgtatgca 125292

to top

>gb|AC134528.6| Mus musculus BAC clone RP24-502G8 from chromosome 10, complete sequence
          Length = 166393

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 139610 tatgtatgtgtgtatgtatgca 139589



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 139579 tatgtatgtgtgtatgtatgca 139558



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    atgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||
Sbjct: 139687 atgtatgtgtgtatgtatgca 139667

to top

>gb|AC161049.2| Mus musculus BAC clone RP24-94D6 from chromosome 12, complete sequence
          Length = 193424

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 89004 tatgtatgtgtgtatgtatgca 88983

to top

>emb|AL732479.6| Human DNA sequence from clone RP11-351D13 on chromosome 10, complete
             sequence
          Length = 97781

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 89423 tatgtatgtgtgtatgtatgca 89402

to top

>emb|AL645568.9| Human DNA sequence from clone RP11-296O14 on chromosome 1 Contains a
              pseudogene similar to part of ribosomal protein L26
              (RPL26), a novel pseudogene and a novel gene, complete
              sequence
          Length = 136031

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 111664 tatgtatgtgtgtatgtatgca 111643

to top

>emb|AL357518.15| Human DNA sequence from clone RP11-679B17 on chromosome 6 Contains a
             novel gene and a CpG island, complete sequence
          Length = 115378

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 227   atatgtatgtgtgtatgtatgc 248
             ||||||||||||||||||||||
Sbjct: 42318 atatgtatgtgtgtatgtatgc 42297

to top

>gb|AC091518.22| Mus musculus strain 129/SvJ clone mgs1-257j2 map 10, complete sequence
          Length = 124270

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 68107 tatgtatgtgtgtatgtatgca 68128

to top

>emb|AL133230.25| Human DNA sequence from clone RP4-530I15 on chromosome 20 Contains the
             3' end of the PTPN1 gene for protein tyrosine phosphatase,
             non-receptor type 1 (EC 3.1.3.48), the C20orf175 gene for
             a novel protein similar to DIFF48, the RPL36P2 gene for
             ribosomal protein L36 pseudogene 2 and three novel genes,
             complete sequence
          Length = 111039

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 227   atatgtatgtgtgtatgtatgc 248
             ||||||||||||||||||||||
Sbjct: 59457 atatgtatgtgtgtatgtatgc 59478

to top

>gb|AC166325.1| Mus musculus BAC clone RP24-421O23 from chromosome 13, complete sequence
          Length = 192167

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 136975 tatgtatgtgtgtatgtatgca 136954



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 137291 tatgtatgtgtgtatgtatg 137272



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 137193 tatgtatgtgtgtatgtatg 137174



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 137177 tatgtatgtgtgtatgtatg 137158



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 137147 tatgtatgtgtgtatgtatg 137128



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 137019 tatgtatgtgtgtatgtatg 137000



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 136801 tatgtatgtgtgtatgtatg 136782



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 136785 tatgtatgtgtgtatgtatg 136766



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 136720 tatgtatgtgtgtatgtatg 136701



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   atatgtatgtgtgtatgtat 246
             ||||||||||||||||||||
Sbjct: 82743 atatgtatgtgtgtatgtat 82762

to top

>gb|AC161576.7| Mus musculus chromosome 8, clone RP24-315L4, complete sequence
          Length = 180039

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 60221 tatgtatgtgtgtatgtatgca 60200

to top

>gb|AC154394.6| Mus musculus chromosome 18, clone RP23-315M1, complete sequence
          Length = 246033

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 136527 tatgtatgtgtgtatgtatgca 136548

to top

>emb|AL645912.18| Mouse DNA sequence from clone RP23-134G19 on chromosome 11 Contains the
             5' end of the gene for a novel protein similar to human
             KIBRA, a pseudogene similar to part of actin, the Odz2
             gene for odd Oz/ten-m homolog 2 (Drosophila) and two CpG
             islands, complete sequence
          Length = 186736

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 78893 tatgtatgtgtgtatgtatgca 78914

to top

>gb|AC120393.16| Mus musculus chromosome 7, clone RP24-312B12, complete sequence
          Length = 183977

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 172325 tatgtatgtgtgtatgtatgca 172304

to top

>gb|AC108508.2| Genomic sequence for Mus musculus, clone RP23-437O14, complete sequence
          Length = 196162

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 29651 tatgtatgtgtgtatgtatgca 29672

to top

>emb|CR855308.6| Zebrafish DNA sequence from clone DKEY-71K24, complete sequence
          Length = 59116

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 20480 tatgtatgtgtgtatgtatgca 20459



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 20408 tatgtatgtgtgtatgtatgca 20387



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   tatgtatgtgtgtatgtatgc 248
             |||||||||||||||||||||
Sbjct: 19935 tatgtatgtgtgtatgtatgc 19915

to top

>gb|AC091694.9| Mus musculus Strain C57BL6/J chromosome 11 BAC, RP23-316F3, Complete
             Sequence, complete sequence
          Length = 213119

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 74861 tatgtatgtgtgtatgtatgca 74840



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 75036 tatgtatgtgtgtatgtatg 75017



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 74727 tatgtatgtgtgtatgtatg 74708

to top

>emb|BX323991.10| Zebrafish DNA sequence from clone CH211-66H3 in linkage group 3, complete
              sequence
          Length = 174390

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 226    gatatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||||
Sbjct: 133372 gatatgtatgtgtgtatgtatg 133351

to top

>emb|BX294106.10| Zebrafish DNA sequence from clone DKEY-211F4 in linkage group 5, complete
              sequence
          Length = 190191

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 176731 tatgtatgtgtgtatgtatgca 176752



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176651 tatgtatgtgtgtatgtatg 176670



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176635 tatgtatgtgtgtatgtatg 176654



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176623 tatgtatgtgtgtatgtatg 176642



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176473 tatgtatgtgtgtatgtatg 176492



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176457 tatgtatgtgtgtatgtatg 176476



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176445 tatgtatgtgtgtatgtatg 176464



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176363 tatgtatgtgtgtatgtatg 176382



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176351 tatgtatgtgtgtatgtatg 176370



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176331 tatgtatgtgtgtatgtatg 176350



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176319 tatgtatgtgtgtatgtatg 176338



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176307 tatgtatgtgtgtatgtatg 176326



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176295 tatgtatgtgtgtatgtatg 176314



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176183 tatgtatgtgtgtatgtatg 176202



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 176171 tatgtatgtgtgtatgtatg 176190



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175987 tatgtatgtgtgtatgtatg 176006



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175903 tatgtatgtgtgtatgtatg 175922



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175891 tatgtatgtgtgtatgtatg 175910



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175875 tatgtatgtgtgtatgtatg 175894



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175863 tatgtatgtgtgtatgtatg 175882



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175851 tatgtatgtgtgtatgtatg 175870



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175839 tatgtatgtgtgtatgtatg 175858



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175755 tatgtatgtgtgtatgtatg 175774



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175743 tatgtatgtgtgtatgtatg 175762



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175543 tatgtatgtgtgtatgtatg 175562



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175527 tatgtatgtgtgtatgtatg 175546



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175515 tatgtatgtgtgtatgtatg 175534



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175499 tatgtatgtgtgtatgtatg 175518



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175487 tatgtatgtgtgtatgtatg 175506



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 175475 tatgtatgtgtgtatgtatg 175494



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 170394 tatgtatgtgtgtatgtatg 170413

to top

>gb|AC112912.4| Homo sapiens 3 BAC RP11-634L24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 156948

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 226   gatatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||||
Sbjct: 49304 gatatgtatgtgtgtatgtatg 49283

to top

>gb|AF372495.1|AF372495S1 Homo sapiens cytochrome P450 2f1 (CYP2F1P) pseudogene, exons 4
            through 6
          Length = 2276

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 228  tatgtatgtgtgtatgtatgca 249
            ||||||||||||||||||||||
Sbjct: 1182 tatgtatgtgtgtatgtatgca 1161



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  tatgtatgtgtgtatgtatg 247
            ||||||||||||||||||||
Sbjct: 1260 tatgtatgtgtgtatgtatg 1241



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  tatgtatgtgtgtatgtatg 247
            ||||||||||||||||||||
Sbjct: 1214 tatgtatgtgtgtatgtatg 1195



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  tatgtatgtgtgtatgtatg 247
            ||||||||||||||||||||
Sbjct: 1035 tatgtatgtgtgtatgtatg 1016

to top

>emb|BX511164.11| Zebrafish DNA sequence from clone DKEY-63J1 in linkage group 19, complete
              sequence
          Length = 214001

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 198439 tatgtatgtgtgtatgtatgca 198460



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 198585 tatgtatgtgtgtatgtatg 198604



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 198561 tatgtatgtgtgtatgtatg 198580



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 198497 tatgtatgtgtgtatgtatg 198516

to top

>gb|AC160639.2| Mus musculus BAC clone RP23-103I12 from chromosome 14, complete sequence
          Length = 195224

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 223    agtgatatgtatgtgtgtatgt 244
              ||||||||||||||||||||||
Sbjct: 187789 agtgatatgtatgtgtgtatgt 187810

to top

>emb|BX682531.11| Zebrafish DNA sequence from clone CH211-12C17 in linkage group 23,
             complete sequence
          Length = 171113

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 57978 tatgtatgtgtgtatgtatgca 57957



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 57786 tatgtatgtgtgtatgtatgca 57765



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 57542 tatgtatgtgtgtatgtatgca 57521



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 57398 tatgtatgtgtgtatgtatgca 57377



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 57042 tatgtatgtgtgtatgtatgca 57021



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 57686 tatgtatgtgtgtatgtatg 57667



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 57610 tatgtatgtgtgtatgtatg 57591



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 230   tgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||
Sbjct: 57248 tgtatgtgtgtatgtatgca 57229



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 57130 tatgtatgtgtgtatgtatg 57111

to top

>gb|AC154257.2| Mus musculus BAC clone RP24-211E15 from chromosome 13, complete
             sequence
          Length = 152267

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 15390 tatgtatgtgtgtatgtatgca 15369



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15706 tatgtatgtgtgtatgtatg 15687



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15608 tatgtatgtgtgtatgtatg 15589



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15592 tatgtatgtgtgtatgtatg 15573



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15562 tatgtatgtgtgtatgtatg 15543



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15434 tatgtatgtgtgtatgtatg 15415



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15216 tatgtatgtgtgtatgtatg 15197



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15200 tatgtatgtgtgtatgtatg 15181



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15135 tatgtatgtgtgtatgtatg 15116

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 192     tattttggaacggatgaagtat 213
               ||||||||||||||||||||||
Sbjct: 7272361 tattttggaacggatgaagtat 7272382



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 192      tattttggaacggatgaagta 212
                |||||||||||||||||||||
Sbjct: 25266920 tattttggaacggatgaagta 25266900



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 9        gctgcccgacgacgacgacga 29
                |||||||||||||||||||||
Sbjct: 23818107 gctgcccgacgacgacgacga 23818127



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 191     atattttggaacggatgaagtatg 214
               ||||||||||||||||| ||||||
Sbjct: 4427423 atattttggaacggatgtagtatg 4427446

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 191      atattttggaacggatgaagta 212
                ||||||||||||||||||||||
Sbjct: 20975387 atattttggaacggatgaagta 20975408



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 191      atattttggaacggatgaagta 212
                ||||||||||||||||||||||
Sbjct: 11825204 atattttggaacggatgaagta 11825183

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 8        agctgcccgacgacgacgacga 29
                ||||||||||||||||||||||
Sbjct: 21097241 agctgcccgacgacgacgacga 21097262



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 14       ccgacgacgacgacgaggac 33
                ||||||||||||||||||||
Sbjct: 18536842 ccgacgacgacgacgaggac 18536861

to top

>gb|AC084214.19|AC084214 Mus musculus X BAC RP23-382J5 (Roswell Park Cancer Institute Mouse
            BAC Library) complete sequence
          Length = 56321

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 226  gatatgtatgtgtgtatgtatg 247
            ||||||||||||||||||||||
Sbjct: 2168 gatatgtatgtgtgtatgtatg 2189

to top

>emb|BX248130.8| Zebrafish DNA sequence from clone CH211-236E5 in linkage group 1,
             complete sequence
          Length = 183058

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 10179 tatgtatgtgtgtatgtatgca 10200

to top

>gb|DQ004742.1| Bos taurus isolate UoG-BovSAGE-UK3L aromatase cytochrome P450 mRNA,
            complete cds
          Length = 1400

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 228  tatgtatgtgtgtatgtatgca 249
            ||||||||||||||||||||||
Sbjct: 1088 tatgtatgtgtgtatgtatgca 1067

to top

>gb|AC157998.2| Mus musculus BAC clone RP23-27L18 from chromosome 9, complete sequence
          Length = 253762

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 54539 tatgtatgtgtgtatgtatgca 54518

to top

>gb|AC008537.5|AC008537 Homo sapiens chromosome 19 clone CTC-490E21, complete sequence
          Length = 169089

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 48669 tatgtatgtgtgtatgtatgca 48690



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 48816 tatgtatgtgtgtatgtatg 48835



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 48633 tatgtatgtgtgtatgtatg 48652



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 48587 tatgtatgtgtgtatgtatg 48606

to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 15     cgacgacgacgacgaggactacctca 40
              ||||||||||||||||| ||||||||
Sbjct: 114710 cgacgacgacgacgagggctacctca 114685

to top

>dbj|AP003228.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0020E09
          Length = 149195

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 15   cgacgacgacgacgaggactacctca 40
            ||||||||||||||||| ||||||||
Sbjct: 5136 cgacgacgacgacgagggctacctca 5111

to top

>gb|AC134575.3| Mus musculus BAC clone RP24-67I21 from chromosome 14, complete sequence
          Length = 172103

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 223   agtgatatgtatgtgtgtatgt 244
             ||||||||||||||||||||||
Sbjct: 62500 agtgatatgtatgtgtgtatgt 62521

to top

>dbj|AP005805.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0006M19
          Length = 144073

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 191   atattttggaacggatgaagta 212
             ||||||||||||||||||||||
Sbjct: 93139 atattttggaacggatgaagta 93118

to top

>dbj|AP004739.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0090E14
          Length = 161119

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 191    atattttggaacggatgaagta 212
              ||||||||||||||||||||||
Sbjct: 102311 atattttggaacggatgaagta 102332

to top

>dbj|AP005611.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0051E21
          Length = 137959

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 191    atattttggaacggatgaagta 212
              ||||||||||||||||||||||
Sbjct: 107993 atattttggaacggatgaagta 108014

to top

>dbj|AP005469.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0040I22
          Length = 134273

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 191  atattttggaacggatgaagta 212
            ||||||||||||||||||||||
Sbjct: 9290 atattttggaacggatgaagta 9311

to top

>gb|AC149294.8| Mus musculus chromosome 15, clone RP24-389G21, complete sequence
          Length = 136530

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 224    gtgatatgtatgtgtgtatgtatgca 249
              ||||||||||||| ||||||||||||
Sbjct: 131545 gtgatatgtatgtatgtatgtatgca 131520

to top

>dbj|AK100045.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013153N14, full
           insert sequence
          Length = 2193

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 8   agctgcccgacgacgacgacga 29
           ||||||||||||||||||||||
Sbjct: 303 agctgcccgacgacgacgacga 282

to top

>gb|AC154752.2| Mus musculus BAC clone RP24-402K18 from 16, complete sequence
          Length = 174112

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 124148 tatgtatgtgtgtatgtatgca 124127



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 134869 tatgtatgtgtgtatgtatg 134850

to top

>gb|AC119196.12| Mus musculus chromosome 7, clone RP24-179I13, complete sequence
          Length = 165611

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 113470 tatgtatgtgtgtatgtatgca 113449

to top

>dbj|AK067175.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098G13, full
           insert sequence
          Length = 2014

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 15  cgacgacgacgacgaggactacctca 40
           ||||||||||||||||| ||||||||
Sbjct: 207 cgacgacgacgacgagggctacctca 232

to top

>gb|AC107746.9| Mus musculus chromosome 1, clone RP23-311K2, complete sequence
          Length = 202822

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 227   atatgtatgtgtgtatgtatgc 248
             ||||||||||||||||||||||
Sbjct: 56518 atatgtatgtgtgtatgtatgc 56539

to top

>emb|AL844840.8| Mouse DNA sequence from clone RP23-337P9 on chromosome 2, complete
             sequence
          Length = 219568

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 87799 tatgtatgtgtgtatgtatgca 87778

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 192     tattttggaacggatgaagtat 213
               ||||||||||||||||||||||
Sbjct: 7342447 tattttggaacggatgaagtat 7342468



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 192      tattttggaacggatgaagta 212
                |||||||||||||||||||||
Sbjct: 25585578 tattttggaacggatgaagta 25585558



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 9        gctgcccgacgacgacgacga 29
                |||||||||||||||||||||
Sbjct: 24129776 gctgcccgacgacgacgacga 24129796



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 191     atattttggaacggatgaagtatg 214
               ||||||||||||||||| ||||||
Sbjct: 4436117 atattttggaacggatgtagtatg 4436140

to top

>emb|AL662994.3|OSJN00192 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0006L01,
             complete sequence
          Length = 162227

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 8     agctgcccgacgacgacgacga 29
             ||||||||||||||||||||||
Sbjct: 91504 agctgcccgacgacgacgacga 91483

to top

>emb|AL929465.6| Mouse DNA sequence from clone RP23-395N7 on chromosome 4, complete
             sequence
          Length = 197037

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 24866 tatgtatgtgtgtatgtatgca 24845

to top

>gb|AC139159.3| Mus musculus BAC clone RP23-119I13 from 8, complete sequence
          Length = 185950

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 125081 tatgtatgtgtgtatgtatgca 125102



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 125061 tatgtatgtgtgtatgtatg 125080

to top

>emb|AL928589.11| Mouse DNA sequence from clone RP23-350C1 on chromosome 2, complete
              sequence
          Length = 209053

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 147607 tatgtatgtgtgtatgtatgca 147628



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    atgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||
Sbjct: 147640 atgtatgtgtgtatgtatgca 147660

to top

>emb|CT027693.11| Mouse DNA sequence from clone RP24-120H1 on chromosome 16, complete
             sequence
          Length = 186376

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 41113 tatgtatgtgtgtatgtatgca 41092

to top

>emb|AL928992.7| Mouse DNA sequence from clone RP23-208O9 on chromosome 2, complete
             sequence
          Length = 136064

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 44117 tatgtatgtgtgtatgtatgca 44138

to top

>emb|AL683809.7| Mouse DNA sequence from clone RP23-440B21 on chromosome X, complete
              sequence
          Length = 213187

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 226    gatatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||||
Sbjct: 204689 gatatgtatgtgtgtatgtatg 204710

to top

>emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chromosome 2, complete
              sequence
          Length = 185348

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 103800 tatgtatgtgtgtatgtatgca 103821

to top

>emb|AL627077.14| Mouse DNA sequence from clone RP23-384D6 on chromosome 4, complete
             sequence
          Length = 190647

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 95453 tatgtatgtgtgtatgtatgca 95474

to top

>emb|AL645542.13| Mouse DNA sequence from clone RP23-468A19 on chromosome 11, complete
              sequence
          Length = 166100

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 154892 tatgtatgtgtgtatgtatgca 154913



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 155026 tatgtatgtgtgtatgtatg 155045



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 154717 tatgtatgtgtgtatgtatg 154736

to top

>emb|AL606987.11| Mouse DNA sequence from clone RP23-383I4 on chromosome 4, complete
             sequence
          Length = 212647

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 71215 tatgtatgtgtgtatgtatgca 71236

to top

>emb|AL606919.12| Mouse DNA sequence from clone RP23-264F10 on chromosome 4, complete
             sequence
          Length = 187816

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 93986 tatgtatgtgtgtatgtatgca 94007

to top

>gb|AC152500.7| Mus musculus BAC clone RP24-555P14 from chromosome 10, complete sequence
          Length = 170235

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 228    tatgtatgtgtgtatgtatgca 249
              ||||||||||||||||||||||
Sbjct: 124848 tatgtatgtgtgtatgtatgca 124869

to top

>dbj|AB036794.1| Drosophila melanogaster genomic DNA, chromosome 2R, map 54A, flanking
             sequence of P element insertion site
          Length = 32985

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 28848 tatgtatgtgtgtatgtatgca 28869

to top

>emb|AL807392.7| Mouse DNA sequence from clone RP23-104D24 on chromosome 4, complete
             sequence
          Length = 132773

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 228   tatgtatgtgtgtatgtatgca 249
             ||||||||||||||||||||||
Sbjct: 80732 tatgtatgtgtgtatgtatgca 80711

to top

>emb|AL731727.18| Mouse DNA sequence from clone RP23-147K15 on chromosome X, complete
             sequence
          Length = 64392

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 226   gatatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||||
Sbjct: 56002 gatatgtatgtgtgtatgtatg 55981

to top

>gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, complete sequence
          Length = 187046

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 70426 atatgtatgtgtgtatgtatg 70446

to top

>gb|AC099645.11| Mus musculus chromosome 15, clone RP23-426G4, complete sequence
          Length = 208095

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 40965 atatgtatgtgtgtatgtatg 40985

to top

>gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, complete sequence
          Length = 162317

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 228   tatgtatgtgtgtatgtatgcaaag 252
             ||||||| |||||||||||||||||
Sbjct: 86902 tatgtatctgtgtatgtatgcaaag 86878

to top

>gb|AC153645.4| Mus musculus BAC clone RP24-534E8 from chromosome 13, complete sequence
          Length = 182805

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 137148 atatgtatgtgtgtatgtatg 137128



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 145353 tatgtatgtgtgtatgtatg 145334

to top

>gb|AC165289.2| Mus musculus BAC clone RP23-467L11 from chromosome 17, complete
             sequence
          Length = 193418

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 43381 atatgtatgtgtgtatgtatg 43361



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 43330 tatgtatgtgtgtatgtatg 43311

to top

>gb|AC164119.4| Mus musculus BAC clone RP24-288I15 from chromosome 5, complete sequence
          Length = 189243

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 153116 atatgtatgtgtgtatgtatg 153096

to top

>gb|AC159998.6| Mus musculus BAC clone RP24-576J22 from chromosome 10, complete
             sequence
          Length = 166313

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 62996 atatgtatgtgtgtatgtatg 62976

to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 23293 atatgtatgtgtgtatgtatg 23273



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 31498 tatgtatgtgtgtatgtatg 31479

to top

>gb|AC099884.12| Mus musculus chromosome 15, clone RP23-11F24, complete sequence
          Length = 265797

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 6969 atatgtatgtgtgtatgtatg 6989

to top

>gb|AC138680.7| Mus musculus chromosome 1, clone RP23-373D7, complete sequence
          Length = 175790

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 29456 atatgtatgtgtgtatgtatg 29476

to top

>gb|AC116792.17| Mus musculus chromosome 6, clone RP24-304O23, complete sequence
          Length = 155145

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 21533 atatgtatgtgtgtatgtatg 21553



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 21507 atatgtatgtgtgtatgtatg 21527

to top

>gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, complete sequence
          Length = 245125

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 181465 atatgtatgtgtgtatgtatg 181485

to top

>gb|AC161269.4| Mus musculus BAC clone RP23-120K16 from chromosome 15, complete
             sequence
          Length = 206234

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 66444 atatgtatgtgtgtatgtatg 66424

to top

>gb|AC168269.3| Mus musculus BAC clone RP23-193M17 from chromosome 17, complete
             sequence
          Length = 223337

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 95585 atatgtatgtgtgtatgtatg 95605

to top

>gb|AC123720.32| Mus musculus chromosome 10, clone RP23-413G8, complete sequence
          Length = 192037

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 43525 atatgtatgtgtgtatgtatg 43505

to top

>ref|NM_187882.1| Oryza sativa (japonica cultivar-group), Ozsa8324 predicted mRNA
          Length = 1320

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 6   ggagctgcccgacgacgacgacgag 30
           |||| ||||||||||||||||||||
Sbjct: 930 ggaggtgcccgacgacgacgacgag 906

to top

>gb|AC123060.4| Mus musculus chromosome 6 clone RP23-214M22, complete sequence
          Length = 210248

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 158090 atatgtatgtgtgtatgtatg 158070



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    atatgtatgtgtgtatgtat 246
              ||||||||||||||||||||
Sbjct: 158006 atatgtatgtgtgtatgtat 157987



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 227    atatgtatgtgtgtatgtat 246
              ||||||||||||||||||||
Sbjct: 157988 atatgtatgtgtgtatgtat 157969

to top

>gb|AC114537.6| Mus musculus chromosome 15, clone RP23-51A16, complete sequence
          Length = 189760

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    atgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||
Sbjct: 160939 atgtatgtgtgtatgtatgca 160919

to top

>gb|AC154301.2| Mus musculus BAC clone RP23-392P5 from chromosome 14, complete sequence
          Length = 207510

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 160597 atatgtatgtgtgtatgtatg 160617



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 160530 tatgtatgtgtgtatgtatg 160549

to top

>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence
          Length = 177167

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 129451 atatgtatgtgtgtatgtatg 129431



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 129082 atatgtatgtgtgtatgtatg 129062



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 128886 atatgtatgtgtgtatgtatg 128866



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 228    tatgtatgtgtgtatgtatgc 248
              |||||||||||||||||||||
Sbjct: 128741 tatgtatgtgtgtatgtatgc 128721

to top

>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence
          Length = 253457

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 219408 atatgtatgtgtgtatgtatg 219388



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 219373 tatgtatgtgtgtatgtatg 219354

to top

>gb|AC139574.4| Mus musculus BAC clone RP23-477I8 from chromosome 15, complete sequence
          Length = 190948

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    atgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||
Sbjct: 160263 atgtatgtgtgtatgtatgca 160283

to top

>gb|AC165236.5| Mus musculus chromosome 5, clone RP23-348C18, complete sequence
          Length = 204772

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 226    gatatgtatgtgtgtatgtatgcaa 250
              ||||||||||||||||||| |||||
Sbjct: 122564 gatatgtatgtgtgtatgtttgcaa 122540

to top

>gb|AC167202.8| Mus musculus  BAC RP24-243A15 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 180658

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 226   gatatgtatgtgtgtatgtat 246
             |||||||||||||||||||||
Sbjct: 97900 gatatgtatgtgtgtatgtat 97880

to top

>gb|AC105995.9| Mus musculus chromosome 5, clone RP24-168A7, complete sequence
          Length = 150133

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 228    tatgtatgtgtgtatgtatgc 248
              |||||||||||||||||||||
Sbjct: 117949 tatgtatgtgtgtatgtatgc 117969



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 118009 tatgtatgtgtgtatgtatg 118028



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 117987 tatgtatgtgtgtatgtatg 118006



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 117915 tatgtatgtgtgtatgtatg 117934



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 117883 tatgtatgtgtgtatgtatg 117902



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 117839 tatgtatgtgtgtatgtatg 117858



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 117817 tatgtatgtgtgtatgtatg 117836

to top

>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 223055

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 24005 atatgtatgtgtgtatgtatg 23985

to top

>gb|AE001375.1| Plasmodium falciparum 3D7 chromosome 2 section 12 of 73 of the
            complete sequence
          Length = 9432

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 1881 atatgtatgtgtgtatgtatg 1861



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  tatgtatgtgtgtatgtatg 247
            ||||||||||||||||||||
Sbjct: 1864 tatgtatgtgtgtatgtatg 1845



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 228  tatgtatgtgtgtatgtatg 247
            ||||||||||||||||||||
Sbjct: 1848 tatgtatgtgtgtatgtatg 1829

to top

>gb|AC101738.16| Mus musculus chromosome 1, clone RP23-472N5, complete sequence
          Length = 183026

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 168638 atatgtatgtgtgtatgtatg 168658

to top

>gb|AC157938.9| Mus musculus chromosome 5, clone RP23-307P18, complete sequence
          Length = 188926

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 228   tatgtatgtgtgtatgtatgc 248
             |||||||||||||||||||||
Sbjct: 15529 tatgtatgtgtgtatgtatgc 15549



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15589 tatgtatgtgtgtatgtatg 15608



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15567 tatgtatgtgtgtatgtatg 15586



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15495 tatgtatgtgtgtatgtatg 15514



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15463 tatgtatgtgtgtatgtatg 15482



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15419 tatgtatgtgtgtatgtatg 15438



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 15397 tatgtatgtgtgtatgtatg 15416

to top

>gb|AC123646.8| Mus musculus chromosome 19, clone RP23-104P24, complete sequence
          Length = 189534

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 52474 atatgtatgtgtgtatgtatg 52454

to top

>gb|AC128597.3| Rattus norvegicus  BAC CH230-62C6 (Children's Hospital Oakland Research
             Institute Rat (BN/SsNHsd/MCW) BAC library) complete
             sequence
          Length = 198520

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 95778 atatgtatgtgtgtatgtatg 95758

to top

>gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosome 16, complete
             sequence
          Length = 187536

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   tatgtatgtgtgtatgtatgc 248
             |||||||||||||||||||||
Sbjct: 76027 tatgtatgtgtgtatgtatgc 76007



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 76129 tatgtatgtgtgtatgtatg 76110



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 76039 tatgtatgtgtgtatgtatg 76020

to top

>gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosome 14, complete sequence
          Length = 220900

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 149970 atatgtatgtgtgtatgtatg 149990

to top

>gb|AC159247.2| Mus musculus BAC clone RP24-249C9 from chromosome 6, complete sequence
          Length = 190474

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 76660 atatgtatgtgtgtatgtatg 76640



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 76291 atatgtatgtgtgtatgtatg 76271



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 76095 atatgtatgtgtgtatgtatg 76075



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   tatgtatgtgtgtatgtatgc 248
             |||||||||||||||||||||
Sbjct: 75950 tatgtatgtgtgtatgtatgc 75930

to top

>gb|AC158943.9| Mus musculus chromosome 1, clone RP24-272N10, complete sequence
          Length = 186003

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 70445 atatgtatgtgtgtatgtatg 70425

to top

>gb|AC110895.14| Mus musculus chromosome 1, clone RP24-159G18, complete sequence
          Length = 186137

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 29466 atatgtatgtgtgtatgtatg 29446

to top

>gb|AC138341.9| Mus musculus chromosome 5, clone RP23-37N15, complete sequence
          Length = 176410

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 31003 atatgtatgtgtgtatgtatg 30983

to top

>gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, complete sequence
          Length = 195159

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 15893 atatgtatgtgtgtatgtatg 15913

to top

>gb|AC007418.9| Drosophila melanogaster clone BACR16P22, complete sequence
          Length = 179325

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 227    atatgtatgtgtgtatgtatgcaaa 251
              |||||||||| ||||||||||||||
Sbjct: 157632 atatgtatgtatgtatgtatgcaaa 157608

to top

>gb|AC124127.12| Mus musculus chromosome 19, clone RP23-150N4, complete sequence
          Length = 194548

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 144650 atatgtatgtgtgtatgtatg 144670

to top

>gb|AC110499.19| Mus musculus chromosome 1, clone RP23-202J6, complete sequence
          Length = 212282

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 20407 atatgtatgtgtgtatgtatg 20387

to top

>gb|AC009208.6| Drosophila melanogaster clone BACR31I21, complete sequence
          Length = 152443

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 227   atatgtatgtgtgtatgtatgcaaa 251
             |||||||||| ||||||||||||||
Sbjct: 89811 atatgtatgtatgtatgtatgcaaa 89787

to top

>gb|AC111060.5| Mus musculus chromosome 1, clone RP24-121I5, complete sequence
          Length = 138419

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 39878 atatgtatgtgtgtatgtatg 39858

to top

>gb|AC138766.20| Mus musculus chromosome 5, clone RP23-444J3, complete sequence
          Length = 206494

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   tatgtatgtgtgtatgtatgc 248
             |||||||||||||||||||||
Sbjct: 40826 tatgtatgtgtgtatgtatgc 40806

to top

>gb|AC109140.6| Mus musculus chromosome 5, clone RP23-153N23, complete sequence
          Length = 228663

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 54383 atatgtatgtgtgtatgtatg 54403



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 228    tatgtatgtgtgtatgtatgcaaa 251
              ||||||||| ||||||||||||||
Sbjct: 195726 tatgtatgtatgtatgtatgcaaa 195703

to top

>gb|AC139107.3| Mus musculus BAC clone RP23-430L2 from chromosome 8, complete sequence
          Length = 192627

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    atgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||
Sbjct: 169055 atgtatgtgtgtatgtatgca 169075

to top

>gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map human ortholog p11.3,
             complete sequence
          Length = 209530

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 94919 atatgtatgtgtgtatgtatg 94939

to top

>gb|AC108821.6| Mus musculus chromosome 15, clone RP23-61D6, complete sequence
          Length = 216909

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 182098 atatgtatgtgtgtatgtatg 182118

to top

>gb|AC099174.7| Rattus norvegicus 4 BAC CH230-98I1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 197530

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 159200 atatgtatgtgtgtatgtatg 159180

to top

>gb|AC123610.10| Mus musculus chromosome 9, clone RP23-343M15, complete sequence
          Length = 206563

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 38139 atatgtatgtgtgtatgtatg 38159



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 38286 tatgtatgtgtgtatgtatg 38305

to top

>gb|AC131728.4| Mus musculus BAC clone RP23-122G5 from chromosome 5, complete sequence
          Length = 211796

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 158397 atatgtatgtgtgtatgtatg 158417



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 104905 tatgtatgtgtgtatgtatg 104924

to top

>gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosome 5, complete sequence
          Length = 215112

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 188326 atatgtatgtgtgtatgtatg 188306

to top

>gb|AC131798.3| Mus musculus BAC clone RP24-497K17 from chromosome 1, complete sequence
          Length = 142333

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 73997 atatgtatgtgtgtatgtatg 74017

to top

>gb|AC134569.4| Mus musculus BAC clone RP24-240H21 from chromosome 16, complete
             sequence
          Length = 168794

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 25206 atatgtatgtgtgtatgtatg 25186



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 25189 tatgtatgtgtgtatgtatg 25170

to top

>gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, complete sequence
          Length = 148875

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    atgtatgtgtgtatgtatgca 249
              |||||||||||||||||||||
Sbjct: 148447 atgtatgtgtgtatgtatgca 148427

to top

>gb|AC146424.3| Pan troglodytes BAC clone RP43-26H22 from 7, complete sequence
          Length = 195194

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 1039 atatgtatgtgtgtatgtatg 1059

to top

>gb|AC146126.3| Pan troglodytes BAC clone RP43-23E20 from 7, complete sequence
          Length = 173381

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 230    tgtatgtgtgtatgtatgcaaaggg 254
              |||||||||||||||||| ||||||
Sbjct: 153094 tgtatgtgtgtatgtatggaaaggg 153070

to top

>gb|AC137558.3| Mus musculus BAC clone RP23-16I17 from chromosome 6, complete sequence
          Length = 225612

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 203350 atatgtatgtgtgtatgtatg 203330

to top

>gb|AC147045.2| Mus musculus BAC clone RP23-100E5 from chromosome 16, complete sequence
          Length = 191975

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 78482 atatgtatgtgtgtatgtatg 78502



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 78499 tatgtatgtgtgtatgtatg 78518

to top

>gb|AC124561.3| Mus musculus BAC clone RP23-169G13 from chromosome 15, complete
             sequence
          Length = 205427

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 28864 atatgtatgtgtgtatgtatg 28884

to top

>gb|AC117949.5| Mus musculus BAC clone RP23-197M6 from chromosome 18, complete sequence
          Length = 196445

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 224    gtgatatgtatgtgtgtatgt 244
              |||||||||||||||||||||
Sbjct: 151595 gtgatatgtatgtgtgtatgt 151575

to top

>gb|AC147020.2| Mus musculus BAC clone RP23-267A11 from chromosome 18, complete
             sequence
          Length = 204727

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 84163 atatgtatgtgtgtatgtatg 84143

to top

>gb|AC132307.5| Mus musculus BAC clone RP24-291H9 from chromosome 18, complete sequence
          Length = 179465

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 83743 atatgtatgtgtgtatgtatg 83723

to top

>gb|AC125322.4| Mus musculus BAC clone RP23-407J24 from chromosome 7, complete
           sequence
          Length = 217912

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 228 tatgtatgtgtgtatgtatgcaaag 252
           |||||||||||||||||||| ||||
Sbjct: 932 tatgtatgtgtgtatgtatgtaaag 956

to top

>gb|AC135108.3| Mus musculus BAC clone RP24-538P2 from chromosome 9, complete sequence
          Length = 137981

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 45651 atatgtatgtgtgtatgtatg 45671

to top

>gb|AC145557.3| Mus musculus BAC clone RP23-313I19 from chromosome 19, complete sequence
          Length = 226099

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 103210 atatgtatgtgtgtatgtatg 103190



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 202114 tatgtatgtgtgtatgtatg 202095

to top

>gb|AC145775.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone P0313E01,
              complete sequence
          Length = 149215

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 192    tattttggaacggatgaagta 212
              |||||||||||||||||||||
Sbjct: 142190 tattttggaacggatgaagta 142170

to top

>gb|AC113262.29| Mus musculus strain 129/Sv clone ct7-518k21 map 5, complete sequence
          Length = 180394

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   tatgtatgtgtgtatgtatgc 248
             |||||||||||||||||||||
Sbjct: 30633 tatgtatgtgtgtatgtatgc 30613



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 30765 tatgtatgtgtgtatgtatg 30746



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 30743 tatgtatgtgtgtatgtatg 30724



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 30699 tatgtatgtgtgtatgtatg 30680



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 30667 tatgtatgtgtgtatgtatg 30648



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 30595 tatgtatgtgtgtatgtatg 30576



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 30573 tatgtatgtgtgtatgtatg 30554

to top

>gb|AC137979.6| Mus musculus chromosome 5, clone RP24-92M6, complete sequence
          Length = 170969

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 67057 atatgtatgtgtgtatgtatg 67037

to top

>gb|AC068661.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-203F1, complete
             sequence
          Length = 148170

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 36954 atatgtatgtgtgtatgtatg 36934



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 36888 atatgtatgtgtgtatgtatg 36868



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 10258 tatgtatgtgtgtatgtatg 10239

to top

>gb|AC157771.8| Mus musculus chromosome 1, clone RP24-287N8, complete sequence
          Length = 189621

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 60089 atatgtatgtgtgtatgtatg 60069

to top

>gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 181588

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 70403 atatgtatgtgtgtatgtatg 70383

to top

>gb|AC153970.4| Mus musculus 10 BAC RP24-116A15 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 178124

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 14813 atatgtatgtgtgtatgtatg 14833

to top

>gb|AC139553.5| Mus musculus chromosome 19, clone RP24-386E18, complete sequence
          Length = 168091

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 17424 atatgtatgtgtgtatgtatg 17404



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 17407 tatgtatgtgtgtatgtatg 17388

to top

>gb|AC154422.2| Mus musculus BAC clone RP24-218O2 from chromosome 13, complete sequence
          Length = 170866

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 62936 atatgtatgtgtgtatgtatg 62916

to top

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 96358 atatgtatgtgtgtatgtatg 96338

to top

>gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome 5, complete sequence
          Length = 188588

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 134229 atatgtatgtgtgtatgtatg 134249



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    tatgtatgtgtgtatgtatg 247
              ||||||||||||||||||||
Sbjct: 113172 tatgtatgtgtgtatgtatg 113191



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 227    atatgtatgtgtgtatgtat 246
              ||||||||||||||||||||
Sbjct: 113005 atatgtatgtgtgtatgtat 113024

to top

>gb|AC124226.12| Mus musculus chromosome 15, clone RP23-94G21, complete sequence
          Length = 189787

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 128736 atatgtatgtgtgtatgtatg 128716

to top

>gb|AC160114.2| Mus musculus BAC clone RP24-70J8 from chromosome 13, complete sequence
          Length = 237699

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 191997 atatgtatgtgtgtatgtatg 192017

to top

>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 264561

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 226   gatatgtatgtgtgtatgtat 246
             |||||||||||||||||||||
Sbjct: 24577 gatatgtatgtgtgtatgtat 24557

to top

>gb|AC140477.2| Mus musculus BAC clone RP24-132G6 from chromosome 12, complete sequence
          Length = 185642

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 66481 atatgtatgtgtgtatgtatg 66501

to top

>gb|AC121849.3| Mus musculus BAC clone RP24-90K18 from chromosome 6, complete sequence
          Length = 205721

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 30717 atatgtatgtgtgtatgtatg 30737

to top

>gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI Sheared BAC Drosophila
              melanogaster library) complete sequence
          Length = 166613

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 15     cgacgacgacgacgaggacta 35
              |||||||||||||||||||||
Sbjct: 129312 cgacgacgacgacgaggacta 129332

to top

>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 148234 atatgtatgtgtgtatgtatg 148214

to top

>gb|AC094950.6| Rattus norvegicus 14 BAC CH230-6H12 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 237532

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 113352 atatgtatgtgtgtatgtatg 113332

to top

>gb|AC124168.3| Mus musculus BAC clone RP23-143G9 from chromosome 18, complete
            sequence
          Length = 203187

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 9236 atatgtatgtgtgtatgtatg 9216

to top

>gb|AC123941.3| Mus musculus BAC clone RP23-458G24 from chromosome 19, complete
             sequence
          Length = 182733

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 67793 atatgtatgtgtgtatgtatg 67813



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   tatgtatgtgtgtatgtatg 247
             ||||||||||||||||||||
Sbjct: 67810 tatgtatgtgtgtatgtatg 67829

to top

>gb|AC140109.4| Mus musculus BAC clone RP24-156A17 from chromosome 3, complete sequence
          Length = 130716

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 11524 atatgtatgtgtgtatgtatg 11504



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 11466 atatgtatgtgtgtatgtatg 11446



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 11418 atatgtatgtgtgtatgtatg 11398

to top

>gb|AC136018.5| Mus musculus BAC clone RP24-125E6 from chromosome 7, complete
            sequence
          Length = 210491

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 6572 atatgtatgtgtgtatgtatg 6592

to top

>gb|AC135110.3| Mus musculus BAC clone RP23-392G14 from chromosome 18, complete
             sequence
          Length = 182942

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 229   atgtatgtgtgtatgtatgca 249
             |||||||||||||||||||||
Sbjct: 21946 atgtatgtgtgtatgtatgca 21966

to top

>gb|AC132093.3| Mus musculus BAC clone RP24-506H13 from chromosome 10, complete
             sequence
          Length = 148364

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 65158 atatgtatgtgtgtatgtatg 65178



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 228  tatgtatgtgtgtatgtatgcaaa 251
            ||||||||||| ||||||||||||
Sbjct: 4898 tatgtatgtgtatatgtatgcaaa 4921

to top

>gb|AC124547.4| Mus musculus BAC clone RP23-274I8 from chromosome 1, complete
            sequence
          Length = 225058

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 1352 atatgtatgtgtgtatgtatg 1332

to top

>emb|CR450685.13| Zebrafish DNA sequence from clone DKEY-83K24 in linkage group 8, complete
              sequence
          Length = 195473

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 191613 atatgtatgtgtgtatgtatg 191633



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   atatgtatgtgtgtatgtat 246
             ||||||||||||||||||||
Sbjct: 18652 atatgtatgtgtgtatgtat 18671

to top

>emb|AJ566457.1|TCA566457 Theobroma cacao microsatellite, clone mTcCIR115
          Length = 274

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 227 atatgtatgtgtgtatgtatg 247
           |||||||||||||||||||||
Sbjct: 245 atatgtatgtgtgtatgtatg 265

to top

>emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in linkage group 15,
             complete sequence
          Length = 212742

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 31909 atatgtatgtgtgtatgtatg 31929

to top

>emb|CT010430.6| Mouse DNA sequence from clone RP23-335P18 on chromosome 17, complete
            sequence
          Length = 156683

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 7595 atatgtatgtgtgtatgtatg 7615



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   atatgtatgtgtgtatgtat 246
             ||||||||||||||||||||
Sbjct: 82496 atatgtatgtgtgtatgtat 82477

to top

>gb|AC107664.8| Mus musculus chromosome 17, clone RP23-103F2, complete sequence
          Length = 208198

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  atatgtatgtgtgtatgtatg 247
            |||||||||||||||||||||
Sbjct: 3758 atatgtatgtgtgtatgtatg 3778

to top

>emb|CR954970.9| Mouse DNA sequence from clone RP23-402J24 on chromosome X, complete
             sequence
          Length = 99959

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 21824 atatgtatgtgtgtatgtatg 21804

to top

>emb|AL669948.8| Mouse DNA sequence from clone RP23-248K2 on chromosome 11, complete
              sequence
          Length = 223030

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    atatgtatgtgtgtatgtatg 247
              |||||||||||||||||||||
Sbjct: 181245 atatgtatgtgtgtatgtatg 181265

to top

>gb|AC134452.4| Mus musculus BAC clone RP24-252M6 from chromosome 16, complete sequence
          Length = 149607

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 53485 atatgtatgtgtgtatgtatg 53505

to top

>gb|AC127564.4| Mus musculus BAC clone RP24-290E2 from chromosome 5, complete sequence
          Length = 157220

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   atatgtatgtgtgtatgtatg 247
             |||||||||||||||||||||
Sbjct: 74272 atatgtatgtgtgtatgtatg 74252


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,146,942
Number of Sequences: 3902068
Number of extensions: 4146942
Number of successful extensions: 237486
Number of sequences better than 10.0: 2333
Number of HSP's better than 10.0 without gapping: 2353
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 214861
Number of HSP's gapped (non-prelim): 22592
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result