ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal16l03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 44 0.48
2gb|AC025614.12|AC025614 Homo sapiens chromosome 3 clone RP11-69K... 44 0.48
3gb|DQ397588.1| Cenarchaeum symbiosum clone C01F04, complete sequ... 42 1.9
4gb|AC107462.5| Homo sapiens BAC clone RP11-338B9 from 4, complet... 42 1.9
5gb|AC021648.25| Homo sapiens 12 BAC RP11-255I14 (Roswell Park Ca... 42 1.9
6gb|U61972.1|ASU61972 Aeromonas sp. beta-agarase (aagA) gene, com... 42 1.9
7gb|AC005687.1| Arabidopsis thaliana BAC F1I21 from chromosome 1,... 40 7.5
8gb|AC102658.9| Mus musculus chromosome 1, clone RP23-82B23, comp... 40 7.5
9gb|AC167438.2| Mus musculus BAC clone RP24-230L6 from chromosome... 40 7.5
10ref|XM_365059.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 7.5
11ref|XM_363967.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 7.5
12ref|XM_676115.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 7.5
13gb|AC142406.2| Mus musculus BAC clone RP24-531P16 from chromosom... 40 7.5
14gb|AC132279.4| Mus musculus BAC clone RP24-346M3 from chromosome... 40 7.5
15gb|AC140436.3| Mus musculus BAC clone RP23-85O2 from chromosome ... 40 7.5
16gb|AC007259.4| Arabidopsis thaliana chromosome I BAC T28P6 genom... 40 7.5
17gb|AC124352.2| Mus musculus BAC clone RP24-477C23 from chromosom... 40 7.5
18gb|AC163899.3| Mus musculus chromosome 1, clone RP24-383F13, com... 40 7.5
19emb|AL590407.8| Human DNA sequence from clone RP11-522L3 on chro... 40 7.5
20emb|AL158054.17| Human DNA sequence from clone RP11-13H5 on chro... 40 7.5
21gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome ... 40 7.5
22emb|AL589883.1|ATT6G21 Arabidopsis thaliana DNA chromosome 5, BA... 40 7.5
23emb|AL161562.2|ATCHRIV62 Arabidopsis thaliana DNA chromosome 4, ... 40 7.5
24emb|AL161534.2|ATCHRIV34 Arabidopsis thaliana DNA chromosome 4, ... 40 7.5
25emb|AL161498.2|ATCHRIV10 Arabidopsis thaliana DNA chromosome 4, ... 40 7.5
26emb|AL161491.2|ATCHRIV3 Arabidopsis thaliana DNA chromosome 4, c... 40 7.5
27emb|AL162351.1|ATT20L15 Arabidopsis thaliana DNA chromosome 5, B... 40 7.5
28emb|AL049730.2|ATT1P17 Arabidopsis thaliana DNA chromosome 4, BA... 40 7.5
29emb|AL035523.1|ATF13M23 Arabidopsis thaliana DNA chromosome 4, B... 40 7.5
30emb|AL049657.1|ATF6I7 Arabidopsis thaliana DNA chromosome 4, BAC... 40 7.5
31emb|AJ248285.1|CNSPAX03 Pyrococcus abyssi complete genome; segme... 40 7.5
32emb|BX530018.8| Zebrafish DNA sequence from clone DKEY-228B21 in... 40 7.5
33emb|BX324115.8| Zebrafish DNA sequence from clone DKEYP-70E6, co... 40 7.5
34gb|AC007018.7| Arabidopsis thaliana chromosome 2 clone F5G3 map ... 40 7.5
35gb|AC005398.3| Arabidopsis thaliana chromosome 2 clone T6B13 map... 40 7.5
36gb|AC004625.3| Arabidopsis thaliana chromosome 2 clone T26J13 ma... 40 7.5
37gb|AC002510.3| Arabidopsis thaliana chromosome 2 clone T32G6 map... 40 7.5
38gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosom... 40 7.5
39dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.5
40gb|AC069473.4|AC069473 Arabidopsis thaliana chromosome 3 BAC T21... 40 7.5
41gb|AC034107.5|T10F20 Sequence of BAC T10F20 from Arabidopsis tha... 40 7.5
42gb|AC069551.4|AC069551 Genomic sequence for Arabidopsis thaliana... 40 7.5
43emb|BX088594.5| Zebrafish DNA sequence from clone RP71-1G17 in l... 40 7.5
44dbj|AP002063.2| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 7.5
45dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 7.5
46gb|AC147245.3| Mus musculus BAC clone RP23-462E12 from 12, compl... 40 7.5
47gb|AC151896.3| Mus musculus BAC clone RP24-501F15 from 18, compl... 40 7.5
48emb|AL954337.9| Zebrafish DNA sequence from clone CH211-223J10 i... 40 7.5
49gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 40 7.5
50gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.5
51gb|AF077409.1|T24M8 Arabidopsis thaliana BAC T24M8 40 7.5
52emb|AL731548.13| Mouse DNA sequence from clone RP23-71M18 on chr... 40 7.5
53emb|BX000457.2|CNS08CDE Oryza sativa chromosome 12, . BAC OJ1388... 40 7.5
54emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ESSA ... 40 7.5
55emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosome 4, ... 40 7.5
56gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10 40 7.5
57emb|AL672270.12| Mouse DNA sequence from clone RP23-351A10 on ch... 40 7.5 
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 492     gtatgaaatagatagttaaatatttatttt 521
               |||||||| ||||| |||||||||||||||
Sbjct: 6148468 gtatgaaaaagataattaaatatttatttt 6148439
to top
>gb|AC025614.12|AC025614 Homo sapiens chromosome 3 clone RP11-69K20, complete sequence
          Length = 172083

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 143   agggcactgacaggtccaaggg 164
             ||||||||||||||||||||||
Sbjct: 11306 agggcactgacaggtccaaggg 11327
to top
>gb|DQ397588.1| Cenarchaeum symbiosum clone C01F04, complete sequence
          Length = 37861

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 76    attgagggcatgcacggtcac 96
             |||||||||||||||||||||
Sbjct: 12219 attgagggcatgcacggtcac 12239
to top
>gb|AC107462.5| Homo sapiens BAC clone RP11-338B9 from 4, complete sequence
          Length = 192173

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 514    tttattttggtggtaccttat 534
              |||||||||||||||||||||
Sbjct: 177262 tttattttggtggtaccttat 177242
to top
>gb|AC021648.25| Homo sapiens 12 BAC RP11-255I14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 128809

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 494   atgaaatagatagttaaatatttat 518
             |||||||| ||||||||||||||||
Sbjct: 21247 atgaaatacatagttaaatatttat 21271
to top
>gb|U61972.1|ASU61972 Aeromonas sp. beta-agarase (aagA) gene, complete cds
          Length = 1495

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 498 aatagatagttaaatatttattttg 522
           |||||||| ||||||||||||||||
Sbjct: 180 aatagataattaaatatttattttg 156
to top
>gb|AC005687.1| Arabidopsis thaliana BAC F1I21 from chromosome 1, near 59 cM, complete
              sequence
          Length = 129271

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 493    tatgaaatagatagttaaat 512
              ||||||||||||||||||||
Sbjct: 111721 tatgaaatagatagttaaat 111702
to top
>gb|AC102658.9| Mus musculus chromosome 1, clone RP23-82B23, complete sequence
          Length = 186097

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   tgccacagagtaggagcttt 373
             ||||||||||||||||||||
Sbjct: 29079 tgccacagagtaggagcttt 29098
to top
>gb|AC167438.2| Mus musculus BAC clone RP24-230L6 from chromosome 6, complete
            sequence
          Length = 147111

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 531  ttatagatggtagtgatgtg 550
            ||||||||||||||||||||
Sbjct: 1709 ttatagatggtagtgatgtg 1690
to top
>ref|XM_365059.1| Magnaporthe grisea 70-15 hypothetical protein (MG09904.4) partial
            mRNA
          Length = 2040

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 344  ccatcatcgatgccacagag 363
            ||||||||||||||||||||
Sbjct: 1760 ccatcatcgatgccacagag 1779
to top
>ref|XM_363967.1| Magnaporthe grisea 70-15 hypothetical protein (MG01894.4) partial
           mRNA
          Length = 2496

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 95  actttgagtgcttcatcgag 114
           ||||||||||||||||||||
Sbjct: 863 actttgagtgcttcatcgag 882
to top
>ref|XM_676115.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7938.2), mRNA
          Length = 1527

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 511  atatttattttggtggtacc 530
            ||||||||||||||||||||
Sbjct: 1373 atatttattttggtggtacc 1392
to top
>gb|AC142406.2| Mus musculus BAC clone RP24-531P16 from chromosome 9, complete sequence
          Length = 169938

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 507    ttaaatatttattttggtgg 526
              ||||||||||||||||||||
Sbjct: 144763 ttaaatatttattttggtgg 144744
to top
>gb|AC132279.4| Mus musculus BAC clone RP24-346M3 from chromosome 6, complete sequence
          Length = 173744

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 531    ttatagatggtagtgatgtg 550
              ||||||||||||||||||||
Sbjct: 114480 ttatagatggtagtgatgtg 114461
to top
>gb|AC140436.3| Mus musculus BAC clone RP23-85O2 from chromosome 9, complete sequence
          Length = 142560

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 507   ttaaatatttattttggtgg 526
             ||||||||||||||||||||
Sbjct: 67311 ttaaatatttattttggtgg 67292
to top
>gb|AC007259.4| Arabidopsis thaliana chromosome I BAC T28P6 genomic sequence, complete
             sequence
          Length = 97146

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 46735 tatgaaatagatagttaaat 46754
to top
>gb|AC124352.2| Mus musculus BAC clone RP24-477C23 from chromosome 9, complete sequence
          Length = 177886

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 507    ttaaatatttattttggtgg 526
              ||||||||||||||||||||
Sbjct: 102920 ttaaatatttattttggtgg 102901
to top
>gb|AC163899.3| Mus musculus chromosome 1, clone RP24-383F13, complete sequence
          Length = 227890

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   tgccacagagtaggagcttt 373
             ||||||||||||||||||||
Sbjct: 85105 tgccacagagtaggagcttt 85124
to top
>emb|AL590407.8| Human DNA sequence from clone RP11-522L3 on chromosome X Contains five
             mitochondrial NADH dehydrogenase (MTND1, MTND2, MTND4,
             MTND5, MTND6) pseudogenes, pseudogenes similar to part of
             ytochrome c oxidase I and 2 (MTCO1, MTCO2), a
             mitochondrial cytochrome c oxidase II (MTCO2) pseudogene,
             mitochondrial ATP synthase 6 (MTATP6) pseudogene, and a
             mitochondrial cytochrome B (MTCYB) pseudogene and part of
             a novel gene, complete sequence
          Length = 81805

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    taaaatgcctttaattttgt 52
             ||||||||||||||||||||
Sbjct: 26328 taaaatgcctttaattttgt 26309
to top
>emb|AL158054.17| Human DNA sequence from clone RP11-13H5 on chromosome 13, complete
            sequence
          Length = 4113

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 519  tttggtggtaccttatagat 538
            ||||||||||||||||||||
Sbjct: 3001 tttggtggtaccttatagat 2982
to top
>gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome 9, complete sequence
          Length = 221791

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 507    ttaaatatttattttggtgg 526
              ||||||||||||||||||||
Sbjct: 101328 ttaaatatttattttggtgg 101347
to top
>emb|AL589883.1|ATT6G21 Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project)
          Length = 149788

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 493    tatgaaatagatagttaaat 512
              ||||||||||||||||||||
Sbjct: 120225 tatgaaatagatagttaaat 120244
to top
>emb|AL161562.2|ATCHRIV62 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 62
          Length = 197070

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 493    tatgaaatagatagttaaat 512
              ||||||||||||||||||||
Sbjct: 118902 tatgaaatagatagttaaat 118883
to top
>emb|AL161534.2|ATCHRIV34 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 34
          Length = 196107

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 76601 tatgaaatagatagttaaat 76620
to top
>emb|AL161498.2|ATCHRIV10 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 10
          Length = 196296

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 494    atgaaatagatagttaaata 513
              ||||||||||||||||||||
Sbjct: 188582 atgaaatagatagttaaata 188601
to top
>emb|AL161491.2|ATCHRIV3 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 3
          Length = 196149

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 31458 tatgaaatagatagttaaat 31439
to top
>emb|AL162351.1|ATT20L15 Arabidopsis thaliana DNA chromosome 5, BAC clone T20L15 (ESSA project)
          Length = 96565

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 71943 tatgaaatagatagttaaat 71924
to top
>emb|AL049730.2|ATT1P17 Arabidopsis thaliana DNA chromosome 4, BAC clone T1P17 (ESSA project)
          Length = 137519

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 72069 tatgaaatagatagttaaat 72088
to top
>emb|AL035523.1|ATF13M23 Arabidopsis thaliana DNA chromosome 4, BAC clone  F13M23 (ESSAII
             project)
          Length = 99688

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 37154 tatgaaatagatagttaaat 37135
to top
>emb|AL049657.1|ATF6I7 Arabidopsis thaliana DNA chromosome 4, BAC clone  F6I7 (ESSA project)
          Length = 95185

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 89477 tatgaaatagatagttaaat 89458
to top
>emb|AJ248285.1|CNSPAX03 Pyrococcus abyssi complete genome; segment 3/6
          Length = 307120

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    agggctataattgcggcctc 288
              ||||||||||||||||||||
Sbjct: 237523 agggctataattgcggcctc 237542
to top
>emb|BX530018.8| Zebrafish DNA sequence from clone DKEY-228B21 in linkage group 1,
             complete sequence
          Length = 221617

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 504   tagttaaatatttattttgg 523
             ||||||||||||||||||||
Sbjct: 95263 tagttaaatatttattttgg 95244
to top
>emb|BX324115.8| Zebrafish DNA sequence from clone DKEYP-70E6, complete sequence
          Length = 202547

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     cctttaattttgtagattgc 59
              ||||||||||||||||||||
Sbjct: 133570 cctttaattttgtagattgc 133551
to top
>gb|AC007018.7| Arabidopsis thaliana chromosome 2 clone F5G3 map RNS1, complete
             sequence
          Length = 124326

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 73944 tatgaaatagatagttaaat 73963
to top
>gb|AC005398.3| Arabidopsis thaliana chromosome 2 clone T6B13 map mi398, complete
             sequence
          Length = 92524

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 17372 tatgaaatagatagttaaat 17391
to top
>gb|AC004625.3| Arabidopsis thaliana chromosome 2 clone T26J13 map CIC11C08, complete
             sequence
          Length = 42499

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 32961 tatgaaatagatagttaaat 32942
to top
>gb|AC002510.3| Arabidopsis thaliana chromosome 2 clone T32G6 map CIC11C08,
           complete sequence
          Length = 91979

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 493 tatgaaatagatagttaaat 512
           ||||||||||||||||||||
Sbjct: 615 tatgaaatagatagttaaat 596
to top
>gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosome 12, complete
             sequence
          Length = 141293

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 515   ttattttggtggtaccttat 534
             ||||||||||||||||||||
Sbjct: 70125 ttattttggtggtaccttat 70144
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 498      aatagatagttaaatatttatttt 521
                ||||||||||||||||| ||||||
Sbjct: 26187888 aatagatagttaaatatatatttt 26187911
to top
>gb|AC069473.4|AC069473 Arabidopsis thaliana chromosome 3 BAC T21B14 genomic sequence,
            complete sequence
          Length = 85657

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 493  tatgaaatagatagttaaat 512
            ||||||||||||||||||||
Sbjct: 7845 tatgaaatagatagttaaat 7826
to top
>gb|AC034107.5|T10F20 Sequence of BAC T10F20 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 81129

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 40310 tatgaaatagatagttaaat 40291
to top
>gb|AC069551.4|AC069551 Genomic sequence for Arabidopsis thaliana BAC T10O22 from chromosome I,
             complete sequence
          Length = 92948

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 25614 tatgaaatagatagttaaat 25595
to top
>emb|BX088594.5| Zebrafish DNA sequence from clone RP71-1G17 in linkage group 1,
             complete sequence
          Length = 144022

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 503   atagttaaatatttattttg 522
             ||||||||||||||||||||
Sbjct: 77388 atagttaaatatttattttg 77407
to top
>dbj|AP002063.2| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T23B7
          Length = 40167

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 28125 tatgaaatagatagttaaat 28144
to top
>dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9
          Length = 77298

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 65225 tatgaaatagatagttaaat 65206



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 64893 tatgaaatagatagttaaat 64874
to top
>gb|AC147245.3| Mus musculus BAC clone RP23-462E12 from 12, complete sequence
          Length = 179735

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 515   ttattttggtggtaccttat 534
             ||||||||||||||||||||
Sbjct: 23324 ttattttggtggtaccttat 23305
to top
>gb|AC151896.3| Mus musculus BAC clone RP24-501F15 from 18, complete sequence
          Length = 189528

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 502    gatagttaaatatttatttt 521
              ||||||||||||||||||||
Sbjct: 123973 gatagttaaatatttatttt 123992
to top
>emb|AL954337.9| Zebrafish DNA sequence from clone CH211-223J10 in linkage group 19,
             complete sequence
          Length = 205289

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 503   atagttaaatatttattttg 522
             ||||||||||||||||||||
Sbjct: 54032 atagttaaatatttattttg 54051
to top
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 391     ctgaacctaaacctcaactt 410
               ||||||||||||||||||||
Sbjct: 3217314 ctgaacctaaacctcaactt 3217333
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 498      aatagatagttaaatatttatttt 521
                ||||||||||||||||| ||||||
Sbjct: 26116064 aatagatagttaaatatatatttt 26116087
to top
>gb|AF077409.1|T24M8 Arabidopsis thaliana BAC T24M8
          Length = 68251

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 494   atgaaatagatagttaaata 513
             ||||||||||||||||||||
Sbjct: 31501 atgaaatagatagttaaata 31482
to top
>emb|AL731548.13| Mouse DNA sequence from clone RP23-71M18 on chromosome X, complete
             sequence
          Length = 218612

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    taaaatgcctttaattttgt 52
             ||||||||||||||||||||
Sbjct: 27954 taaaatgcctttaattttgt 27935
to top
>emb|BX000457.2|CNS08CDE Oryza sativa chromosome 12, . BAC OJ1388_B05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 144241

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 498   aatagatagttaaatatttatttt 521
             ||||||||||||||||| ||||||
Sbjct: 78126 aatagatagttaaatatatatttt 78149
to top
>emb|Z97338.2|ATFCA3 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 3
          Length = 200252

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 493    tatgaaatagatagttaaat 512
              ||||||||||||||||||||
Sbjct: 133496 tatgaaatagatagttaaat 133477
to top
>emb|AL161541.2|ATCHRIV41 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 41
          Length = 197419

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 86973 tatgaaatagatagttaaat 86954
to top
>gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10
          Length = 106184

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 493   tatgaaatagatagttaaat 512
             ||||||||||||||||||||
Sbjct: 10132 tatgaaatagatagttaaat 10151
to top
>emb|AL672270.12| Mouse DNA sequence from clone RP23-351A10 on chromosome X, complete
             sequence
          Length = 220691

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   atagttaaatatttattttg 522
             ||||||||||||||||||||
Sbjct: 56467 atagttaaatatttattttg 56448


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,758,303
Number of Sequences: 3902068
Number of extensions: 4758303
Number of successful extensions: 95732
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95564
Number of HSP's gapped (non-prelim): 168
length of query: 554
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 531
effective length of database: 17,143,297,704
effective search space: 9103091080824
effective search space used: 9103091080824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top