ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal15d01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470104.1| Oryza sativa (japonica cultivar-group), mRNA 76 1e-10
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 1e-10
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
4gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genom... 76 1e-10
5dbj|AK104998.2| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
6gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence 44 0.42
7gb|AE009642.1| Brucella melitensis 16M chromosome II, section 4 ... 44 0.42
8gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 44 0.42
9emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II... 44 0.42
10emb|AL390375.11| Human DNA sequence from clone RP11-505I19 on ch... 42 1.7
11emb|AL365437.14| Human DNA sequence from clone RP11-343K13 on ch... 42 1.7
12gb|AY973195.1| Anopheles gambiae defensin 2 mRNA, complete cds 42 1.7
13emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chro... 42 1.7
14gb|DQ370035.1| Anopheles gambiae defensin mRNA, complete cds 42 1.7
15gb|AC026234.4|F14O10 Sequence of BAC F14O10 from Arabidopsis tha... 42 1.7
16ref|XM_557449.1| Anopheles gambiae str. PEST ENSANGP00000026023 ... 42 1.7
17gb|AE016830.1| Enterococcus faecalis V583, complete genome 42 1.7
18emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on ch... 42 1.7
19ref|XM_363862.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.6
20gb|BC052074.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cD... 40 6.6
21gb|AC133946.3| Mus musculus BAC clone RP24-188D7 from chromosome... 40 6.6
22gb|BC043324.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cD... 40 6.6
23gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Ho... 40 6.6
24emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 o... 40 6.6
25emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 40 6.6
26emb|AL806529.6| Mouse DNA sequence from clone RP23-234M1 on chro... 40 6.6
27dbj|AB091589.1| Crassostrea gigas DNA, microsatellite locus TNFR... 40 6.6
28gb|AC093909.2| Homo sapiens BAC clone RP11-756P10 from 4, comple... 40 6.6
29dbj|AK155870.1| Mus musculus B6-derived CD11 +ve dendritic cells... 40 6.6
30dbj|AK152130.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 6.6
31ref|NM_181397.1| Mus musculus RIKEN cDNA 2310015N21 gene (231001... 40 6.6
32dbj|AK153288.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 6.6
33emb|AL929261.27| Zebrafish DNA sequence from clone CH211-245H5 i... 40 6.6
34dbj|AK088466.1| Mus musculus 2 days neonate thymus thymic cells ... 40 6.6
35dbj|AK087803.1| Mus musculus 2 days pregnant adult female ovary ... 40 6.6
36dbj|AK049045.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 6.6
37dbj|AK082517.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 6.6
38dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 6.6
39dbj|AK172884.1| Mus musculus mRNA for mKIAA0084 protein 40 6.6
40emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chr... 40 6.6
41emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chr... 40 6.6 
>ref|XM_470104.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 6690

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                        
Query: 327  tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 386
            |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 5895 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 5954

                              
Query: 387  gatgcttcatcctaatta 404
            |||||||||||| |||||
Sbjct: 5955 gatgcttcatccaaatta 5972
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                            
Query: 327      tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 386
                |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 33961946 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 33962005

                                  
Query: 387      gatgcttcatcctaatta 404
                |||||||||||| |||||
Sbjct: 33962006 gatgcttcatccaaatta 33962023
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                            
Query: 327      tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 386
                |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 34052418 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 34052477

                                  
Query: 387      gatgcttcatcctaatta 404
                |||||||||||| |||||
Sbjct: 34052478 gatgcttcatccaaatta 34052495
to top
>gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genomic sequence, complete
             sequence
          Length = 172337

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                         
Query: 327   tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 386
             |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 95745 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 95686

                               
Query: 387   gatgcttcatcctaatta 404
             |||||||||||| |||||
Sbjct: 95685 gatgcttcatccaaatta 95668
to top
>dbj|AK104998.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-E05, full
           insert sequence
          Length = 1630

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 327 tgaaggcggctatgcacatgccgagcagccaccagtgacgggatggactgttggacctca 386
           |||||| ||||||  ||||||||||||||||||||| | ||| ||||||||  |||| ||
Sbjct: 860 tgaaggtggctatttacatgccgagcagccaccagtcatgggctggactgtgagacccca 919

                             
Query: 387 gatgcttcatcctaatta 404
           |||||||||||| |||||
Sbjct: 920 gatgcttcatccaaatta 937
to top
>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence
          Length = 1207381

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 315   tgatgaccttggtgaaggcggc 336
             ||||||||||||||||||||||
Sbjct: 55272 tgatgaccttggtgaaggcggc 55293
to top
>gb|AE009642.1| Brucella melitensis 16M chromosome II, section 4 of 107 of the
            complete sequence
          Length = 14439

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 315  tgatgaccttggtgaaggcggc 336
            ||||||||||||||||||||||
Sbjct: 5610 tgatgaccttggtgaaggcggc 5589
to top
>gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome II, complete sequence
          Length = 1162204

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 315   tgatgaccttggtgaaggcggc 336
             ||||||||||||||||||||||
Sbjct: 55071 tgatgaccttggtgaaggcggc 55092
to top
>emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II, complete sequence,
             strain 2308
          Length = 1156948

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 315   tgatgaccttggtgaaggcggc 336
             ||||||||||||||||||||||
Sbjct: 55120 tgatgaccttggtgaaggcggc 55141
to top
>emb|AL390375.11| Human DNA sequence from clone RP11-505I19 on chromosome 13, complete
            sequence
          Length = 71118

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 302  taagtaaatatcttgatgaccttgg 326
            |||||||||||||| ||||||||||
Sbjct: 6117 taagtaaatatctttatgaccttgg 6141
to top
>emb|AL365437.14| Human DNA sequence from clone RP11-343K13 on chromosome 6, complete
             sequence
          Length = 39186

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 295   agcaatataagtaaatatctt 315
             |||||||||||||||||||||
Sbjct: 32857 agcaatataagtaaatatctt 32877
to top
>gb|AY973195.1| Anopheles gambiae defensin 2 mRNA, complete cds
          Length = 292

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 334 ggctatgcacatgccgagcag 354
           |||||||||||||||||||||
Sbjct: 214 ggctatgcacatgccgagcag 234
to top
>emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chromosome 11 Contains the
             3' end of the Myh13 gene for skeletal muscle myosin heavy
             polypeptide 13, the 5' end of the Gas7 gene for growth
             arrest specific 7, a novel gene and a CpG island, complete
             sequence
          Length = 251096

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 468   gccagtttcagtgagaaacat 488
             |||||||||||||||||||||
Sbjct: 73439 gccagtttcagtgagaaacat 73459
to top
>gb|DQ370035.1| Anopheles gambiae defensin mRNA, complete cds
          Length = 282

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 334 ggctatgcacatgccgagcag 354
           |||||||||||||||||||||
Sbjct: 218 ggctatgcacatgccgagcag 238
to top
>gb|AC026234.4|F14O10 Sequence of BAC F14O10 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 53889

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 80    cttcagacacaacagaacata 100
             |||||||||||||||||||||
Sbjct: 33388 cttcagacacaacagaacata 33368
to top
>ref|XM_557449.1| Anopheles gambiae str. PEST ENSANGP00000026023
           (ENSANGG00000022229), partial mRNA
          Length = 165

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 334 ggctatgcacatgccgagcag 354
           |||||||||||||||||||||
Sbjct: 101 ggctatgcacatgccgagcag 121
to top
>gb|AE016830.1| Enterococcus faecalis V583, complete genome
          Length = 3218031

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 434    aacctgaggtcacagattatc 454
              |||||||||||||||||||||
Sbjct: 714619 aacctgaggtcacagattatc 714639
to top
>emb|AL732502.32| Mouse DNA sequence from clone RP23-292G12 on chromosome 4, complete
              sequence
          Length = 173351

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 224    ctgaagattatcctcatggtg 244
              |||||||||||||||||||||
Sbjct: 158159 ctgaagattatcctcatggtg 158139
to top
>ref|XM_363862.1| Magnaporthe grisea 70-15 hypothetical protein (MG01788.4) partial
           mRNA
          Length = 2715

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 244 gatcataacttggacacaga 263
           ||||||||||||||||||||
Sbjct: 679 gatcataacttggacacaga 698
to top
>gb|BC052074.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cDNA clone MGC:62488
            IMAGE:6401192), complete cds
          Length = 2832

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1725 atgagaagaatctggaagaccagt 1748
to top
>gb|AC133946.3| Mus musculus BAC clone RP24-188D7 from chromosome 17, complete sequence
          Length = 170090

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 38    atgagaagaatctgaaagaccagt 61
             |||||||||||||| |||||||||
Sbjct: 82223 atgagaagaatctggaagaccagt 82246
to top
>gb|BC043324.1| Mus musculus RIKEN cDNA 2310015N21 gene, mRNA (cDNA clone
           IMAGE:5371547), partial cds
          Length = 1923

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 38  atgagaagaatctgaaagaccagt 61
           |||||||||||||| |||||||||
Sbjct: 782 atgagaagaatctggaagaccagt 805
to top
>gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 293757

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     gatgagaagaatctgaaaga 56
              ||||||||||||||||||||
Sbjct: 238725 gatgagaagaatctgaaaga 238744
to top
>emb|AL031119.1|HS28C20 Human DNA sequence from clone RP1-28C20 on chromosome 6q24 Contains the
             3' end of a variant of the EPM2A gene for progressive
             myoclonus type 2 epilepsy (Lafora disease) protein
             (laforin) and a BTB/POZ domain zinc finger protein
             pseudogene, complete sequence
          Length = 115835

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   aagtaaatatcttgatgacc 322
             ||||||||||||||||||||
Sbjct: 70178 aagtaaatatcttgatgacc 70159
to top
>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 62      caatcataagtgggttaccttcag 85
               |||| |||||||||||||||||||
Sbjct: 4478234 caataataagtgggttaccttcag 4478211
to top
>emb|AL806529.6| Mouse DNA sequence from clone RP23-234M1 on chromosome 11 Contains the
             3' end of the Nxn gene for nucleoredoxin, complete
             sequence
          Length = 74841

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 72    tgggttaccttcagacacaacaga 95
             |||| |||||||||||||||||||
Sbjct: 37947 tgggataccttcagacacaacaga 37970
to top
>dbj|AB091589.1| Crassostrea gigas DNA, microsatellite locus TNFRI-Crgi46
          Length = 709

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 114 agtgttagaagaaggcaata 133
           ||||||||||||||||||||
Sbjct: 280 agtgttagaagaaggcaata 261
to top
>gb|AC093909.2| Homo sapiens BAC clone RP11-756P10 from 4, complete sequence
          Length = 181886

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     gaagaatctgaaagaccagt 61
              ||||||||||||||||||||
Sbjct: 121586 gaagaatctgaaagaccagt 121605
to top
>dbj|AK155870.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F730311H15
            product:weakly similar to Raftlin [Gallus gallus], full
            insert sequence
          Length = 2813

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1689 atgagaagaatctggaagaccagt 1712
to top
>dbj|AK152130.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830048L08 product:weakly similar to
            Raftlin [Gallus gallus], full insert sequence
          Length = 2771

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1647 atgagaagaatctggaagaccagt 1670
to top
>ref|NM_181397.1| Mus musculus RIKEN cDNA 2310015N21 gene (2310015N21Rik), mRNA
          Length = 2832

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1725 atgagaagaatctggaagaccagt 1748
to top
>dbj|AK153288.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830135C11 product:weakly similar to
            Raftlin [Gallus gallus], full insert sequence
          Length = 2771

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1647 atgagaagaatctggaagaccagt 1670
to top
>emb|AL929261.27| Zebrafish DNA sequence from clone CH211-245H5 in linkage group 24,
             complete sequence
          Length = 193600

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    agttcaaatgcatcagatga 41
             ||||||||||||||||||||
Sbjct: 68962 agttcaaatgcatcagatga 68943
to top
>dbj|AK088466.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
            full-length enriched library, clone:E430018F20
            product:similar to HYPOTHETICAL 35.0 KDA PROTEIN
            (FRAGMENT) [Homo sapiens], full insert sequence
          Length = 2386

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1262 atgagaagaatctggaagaccagt 1285
to top
>dbj|AK087803.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
            full-length enriched library, clone:E330023B18
            product:hypothetical protein, full insert sequence
          Length = 3626

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1499 atgagaagaatctggaagaccagt 1522
to top
>dbj|AK049045.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230095A10
            product:unclassifiable, full insert sequence
          Length = 1923

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 192  aggccagtcacatactgcagaatcaatg 219
            |||||||||||||| ||| |||||||||
Sbjct: 1282 aggccagtcacatagtgcggaatcaatg 1309
to top
>dbj|AK082517.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230058M18 product:similar to
            HYPOTHETICAL 35.0 KDA PROTEIN (FRAGMENT) [Homo sapiens],
            full insert sequence
          Length = 3349

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1338 atgagaagaatctggaagaccagt 1361
to top
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 312     tcttgatgaccttggtgaag 331
               ||||||||||||||||||||
Sbjct: 2555556 tcttgatgaccttggtgaag 2555537
to top
>dbj|AK172884.1| Mus musculus mRNA for mKIAA0084 protein
          Length = 2779

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 38   atgagaagaatctgaaagaccagt 61
            |||||||||||||| |||||||||
Sbjct: 1653 atgagaagaatctggaagaccagt 1676
to top
>emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chromosome 2, complete
              sequence
          Length = 105895

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 192    aggccagtcacatactgcagaatcaatg 219
              |||||||||||||| ||| |||||||||
Sbjct: 104108 aggccagtcacatagtgcggaatcaatg 104081
to top
>emb|AL844526.5| Mouse DNA sequence from clone RP23-201O18 on chromosome 2, complete
           sequence
          Length = 204398

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 192 aggccagtcacatactgcagaatcaatg 219
           |||||||||||||| ||| |||||||||
Sbjct: 213 aggccagtcacatagtgcggaatcaatg 186


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,425,390
Number of Sequences: 3902068
Number of extensions: 4425390
Number of successful extensions: 76399
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76258
Number of HSP's gapped (non-prelim): 141
length of query: 489
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 467
effective length of database: 17,147,199,772
effective search space: 8007742293524
effective search space used: 8007742293524
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top