ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal14g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 46 0.079
2emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 44 0.31
3gb|AF242738.3| Bacteriophage phi LC3, complete genome 40 4.9
4ref|XM_747912.1| Aspergillus fumigatus Af293 MFS hexose transpor... 40 4.9
5emb|BX927148.1| Corynebacterium glutamicum ATCC 13032, IS finger... 40 4.9
6emb|BX248357.1| Corynebacterium diphtheriae gravis NCTC13129, co... 40 4.9
7emb|BX248354.1| Corynebacterium diphtheriae gravis NCTC13129, co... 40 4.9
8gb|AC008735.9| Homo sapiens chromosome 19 clone CTD-2537I9, comp... 40 4.9
9dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 4.9
10dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, compl... 40 4.9
11dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 4.9
12dbj|AK160385.1| Homo sapiens mRNA for FLJ00416 protein 40 4.9
13tpe|BN000506.1| TPA: TPA_inf: Magnaporthe grisea 70-15 syn6 gene... 40 4.9
14gb|U38906.1|BRU38906 Bacteriophage r1t integrase, repressor prot... 40 4.9

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 21      tcggcggcggcgaggccaccgcc 43
               |||||||||||||||||||||||
Sbjct: 3451531 tcggcggcggcgaggccaccgcc 3451553



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 21     tcggcggcggcgaggccaccgc 42
              ||||||||||||||||||||||
Sbjct: 307844 tcggcggcggcgaggccaccgc 307823



to top

>gb|AF242738.3| Bacteriophage phi LC3, complete genome
          Length = 32172

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   gcagaacaagaagaagtgct 188
             ||||||||||||||||||||
Sbjct: 25677 gcagaacaagaagaagtgct 25696



to top

>ref|XM_747912.1| Aspergillus fumigatus Af293 MFS hexose transporter (Afu1g16390)
           partial mRNA
          Length = 1548

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 142 gatcgcaaaggaagcggaga 161
           ||||||||||||||||||||
Sbjct: 777 gatcgcaaaggaagcggaga 796



to top

>emb|BX927148.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete
              genome; segment 1/10
          Length = 348071

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 19     cctcggcggcggcgaggccaccgc 42
              ||||||||||||||||| ||||||
Sbjct: 263129 cctcggcggcggcgaggacaccgc 263106



to top

>emb|BX248357.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
              4/8
          Length = 349535

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 54     gtcgtctcgtcgagcacagcgagc 77
              |||||||||||||||||| |||||
Sbjct: 205431 gtcgtctcgtcgagcacatcgagc 205408



to top

>emb|BX248354.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
              1/8
          Length = 348517

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 19     cctcggcggcggcgaggccaccgcccag 46
              ||||||||||||||| | ||||||||||
Sbjct: 225166 cctcggcggcggcgaagacaccgcccag 225139



to top

>gb|AC008735.9| Homo sapiens chromosome 19 clone CTD-2537I9, complete sequence
          Length = 223879

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    cccctcggcggcggcgaggc 36
             ||||||||||||||||||||
Sbjct: 76031 cccctcggcggcggcgaggc 76050



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 22      cggcggcggcgaggccaccg 41
               ||||||||||||||||||||
Sbjct: 4950371 cggcggcggcgaggccaccg 4950390



to top

>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome
          Length = 3309401

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 19     cctcggcggcggcgaggccaccgc 42
              ||||||||||||||||| ||||||
Sbjct: 263128 cctcggcggcggcgaggacaccgc 263105



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 192     acctggccgaacgcgcacgc 211
               ||||||||||||||||||||
Sbjct: 2393092 acctggccgaacgcgcacgc 2393073



to top

>dbj|AK160385.1| Homo sapiens mRNA for FLJ00416 protein
          Length = 4684

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   cccctcggcggcggcgaggc 36
            ||||||||||||||||||||
Sbjct: 1655 cccctcggcggcggcgaggc 1674



to top

>tpe|BN000506.1| TPA: TPA_inf: Magnaporthe grisea 70-15 syn6 gene for putative
            polyketide synthase, exons 1-12
          Length = 9956

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 19   cctcggcggcggcgaggcca 38
            ||||||||||||||||||||
Sbjct: 3590 cctcggcggcggcgaggcca 3609



to top

>gb|U38906.1|BRU38906 Bacteriophage r1t integrase, repressor protein (rro), dUTPase, holin
             and lysin genes, complete cds
          Length = 33350

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   gcagaacaagaagaagtgct 188
             ||||||||||||||||||||
Sbjct: 28128 gcagaacaagaagaagtgct 28147


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,510,850
Number of Sequences: 3902068
Number of extensions: 2510850
Number of successful extensions: 58382
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58076
Number of HSP's gapped (non-prelim): 306
length of query: 368
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 346
effective length of database: 17,147,199,772
effective search space: 5932931121112
effective search space used: 5932931121112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top