ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal14e02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK059810.1| Oryza sativa (japonica cultivar-group) cDNA clon... 466 e-128
2ref|NM_192733.1| Oryza sativa (japonica cultivar-group), predic... 458 e-126
3dbj|AK104951.1| Oryza sativa (japonica cultivar-group) cDNA clon... 458 e-126
4gb|AY103992.1| Zea mays PCO096443 mRNA sequence 446 e-122
5gb|AY462241.1| Xerophyta viscosa V-ATPase subunit c'' proteolipi... 174 1e-40
6dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
7dbj|AP002844.2| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
8gb|AY226999.1| Citrus limon vacuolar membrane ATPase subunit c''... 127 3e-26
9ref|NM_128119.1| Arabidopsis thaliana ATPase AT2G25610 mRNA, com... 98 3e-17
10gb|AF436827.1|AF436827 Arabidopsis thaliana At2g25620/F3N11.7 mR... 98 3e-17
11gb|AY084540.1| Arabidopsis thaliana clone 11111 mRNA, complete s... 98 3e-17
12gb|BT002487.1| Arabidopsis thaliana Unnknown protein (At2g25610:... 98 3e-17
13emb|BX819373.1|CNS0AADF Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
14gb|AC006053.3| Arabidopsis thaliana chromosome 2 clone F3N11 map... 72 1e-09
15gb|BT013030.1| Lycopersicon esculentum clone 114278R, mRNA sequence 62 1e-06
16ref|NM_119405.2| Arabidopsis thaliana ATPase AT4G32530 mRNA, com... 52 0.001
17gb|AY072480.1| Arabidopsis thaliana unknown protein mRNA, comple... 52 0.001
18gb|AY042863.1| Arabidopsis thaliana H+-transporting ATPase-like ... 52 0.001
19gb|AY226998.1| Arabidopsis thaliana vacuolar membrane ATPase sub... 52 0.001
20gb|BT013555.1| Lycopersicon esculentum clone 132292R, mRNA sequence 46 0.082
21gb|AY185519.1| Gossypium barbadense clone 2__2 putative vacuolar... 44 0.33
22ref|XM_638545.1| Dictyostelium discoideum hypothetical protein (... 42 1.3
23ref|XM_513108.1| PREDICTED: Pan troglodytes similar to Beta-1,4-... 42 1.3
24gb|BC060703.1| Mus musculus microtubule associated serine/threon... 42 1.3
25gb|AC114258.3| Dictyostelium discoideum chromosome 2 map complem... 42 1.3
26gb|BC000423.2| Homo sapiens ATPase, H+ transporting, lysosomal 2... 42 1.3
27gb|BC005876.2| Homo sapiens ATPase, H+ transporting, lysosomal 2... 42 1.3
28gb|BT008194.1| Synthetic construct Homo sapiens ATPase, H+ trans... 42 1.3
29gb|BT007151.1| Homo sapiens ATPase, H+ transporting, lysosomal 2... 42 1.3
30emb|CR615700.1| full-length cDNA clone CS0DF010YG10 of Fetal bra... 42 1.3
31ref|NM_001038038.1| Bos taurus ATPase, H+ transporting, lysosoma... 42 1.3
32emb|CR621763.1| full-length cDNA clone CS0DL005YK01 of B cells (... 42 1.3
33emb|CR613387.1| full-length cDNA clone CS0DM003YJ24 of Fetal liv... 42 1.3
34emb|CR601146.1| full-length cDNA clone CS0DC020YJ01 of Neuroblas... 42 1.3
35emb|CR599148.1| full-length cDNA clone CS0DA010YJ24 of Neuroblas... 42 1.3
36emb|CR596289.1| full-length cDNA clone CS0DI035YO13 of Placenta ... 42 1.3
37emb|CR591603.1| full-length cDNA clone CS0DC024YO20 of Neuroblas... 42 1.3
38ref|NM_008641.1| Mus musculus microtubule associated serine/thre... 42 1.3
39emb|CR456972.1| Homo sapiens full open reading frame cDNA clone ... 42 1.3
40gb|BC053601.1| Homo sapiens ATPase, H+ transporting, lysosomal 2... 42 1.3
41gb|BC042664.1| Homo sapiens ATPase, H+ transporting, lysosomal 2... 42 1.3
42gb|BC111150.1| Bos taurus cDNA clone MGC:134511 IMAGE:8052124, c... 42 1.3
43ref|NM_004047.3| Homo sapiens ATPase, H+ transporting, lysosomal... 42 1.3
44ref|NM_001039457.1| Homo sapiens ATPase, H+ transporting, lysoso... 42 1.3
45dbj|AK004728.1| Mus musculus adult male lung cDNA, RIKEN full-le... 42 1.3
46gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 1.3
47ref|XM_233782.3| PREDICTED: Rattus norvegicus microtubule associ... 42 1.3
48gb|AY892285.1| Synthetic construct Homo sapiens clone FLH015432.... 42 1.3
49gb|AY889818.1| Synthetic construct Homo sapiens clone FLH015437.... 42 1.3
50gb|AY889817.1| Synthetic construct Homo sapiens clone FLH015436.... 42 1.3
51dbj|AB093264.1| Mus musculus mRNA for mKIAA0807 protein 42 1.3
52gb|U02313.1|MMU02313 Mus musculus MAST205 protein kinase mRNA, c... 42 1.3
53emb|AL670603.6| Mouse DNA sequence from clone RP23-276M23 on chr... 42 1.3
54dbj|D89052.1| Homo sapiens mRNA for proton-ATPase-like protein, ... 42 1.3
55ref|XM_515337.1| PREDICTED: Pan troglodytes LOC459077 (LOC459077... 40 5.1
56ref|NM_018263.3| Homo sapiens additional sex combs like 2 (Droso... 40 5.1
57gb|AC127556.4| Mus musculus BAC clone RP24-344J6 from chromosome... 40 5.1
58ref|NM_008583.1| Mus musculus multiple endocrine neoplasia 1 (Me... 40 5.1
59gb|BC036287.1| Mus musculus multiple endocrine neoplasia 1, mRNA... 40 5.1
60gb|AC125478.14| Medicago truncatula clone mth2-31i19, complete s... 40 5.1
61gb|AC006956.16| Mus musculus Chromosome 19 BAC Clone 7d23, compl... 40 5.1
62gb|BC042999.2| Homo sapiens additional sex combs like 2 (Drosoph... 40 5.1
63emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete ... 40 5.1
64emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 5.1
65emb|CR933613.1| Homo sapiens mRNA; cDNA DKFZp686C1968 (from clon... 40 5.1
66dbj|AB084281.1| Homo sapiens mRNA for chimeric MOZ-ASXH2 fusion ... 40 5.1
67dbj|AK001760.1| Homo sapiens cDNA FLJ10898 fis, clone NT2RP5003492 40 5.1
68dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 5.1
69dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 40 5.1
70gb|AY965679.1| Eptatretus burgeri variable lymphocyte receptor B... 40 5.1
71dbj|AK170713.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 5.1
72gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 40 5.1
73gb|AY185518.1| Gossypium barbadense clone 1__2 putative vacuolar... 40 5.1
74gb|AC010150.3| Homo sapiens BAC clone RP11-404P12 from 2, comple... 40 5.1
75dbj|AB051472.2| Homo sapiens mRNA for KIAA1685 protein, partial cds 40 5.1
76dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.1
77dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 5.1
78emb|BX647527.1|HSM807673 Homo sapiens mRNA; cDNA DKFZp686F074 (f... 40 5.1
79emb|BX648218.1|HSM808366 Homo sapiens mRNA; cDNA DKFZp686L2369 (... 40 5.1
80dbj|AB084279.1| Homo sapiens ASXH2 mRNA for polycomb group prote... 40 5.1
81gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 5.1
82gb|AF130368.1|AF130368 Mus musculus MEN1 tumor suppressor (Men1)... 40 5.1
83gb|AF109390.1|AF109390 Mus musculus menin (Men1) gene, complete cds 40 5.1
84gb|AF109389.1|AF109389 Mus musculus menin (Men1) mRNA, complete cds 40 5.1
85gb|AF024513.1|AF024513 Mus musculus menin (Men1) gene, complete cds 40 5.1
86gb|AF093756.1|AF093756 Mus musculus menin (Men1) gene, complete cds 40 5.1 
>dbj|AK059810.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A07, full
           insert sequence
          Length = 1029

 Score =  466 bits (235), Expect = e-128
 Identities = 292/311 (93%)
 Strand = Plus / Plus

                                                                       
Query: 65  tcgtcgtcgtgggcgcgcgcgctcgtgcatatctcgccctacaccttctccgccatcggc 124
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 235 tcgtcgtcgtgggcgcgcgcgctcgtgcagatctcgccctacaccttctccgccatcggc 294

                                                                       
Query: 125 atcgccgtctccatcggcgtctctgtcctcggcgcagcatgggggatcttcatcacgggg 184
           || |||||||||||||||||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 295 atagccgtctccatcggcgtctccgtcctcggcgccgcctgggggatcttcatcacgggg 354

                                                                       
Query: 185 agcagcctcatcggggccgccatcaaggcgcccaggatcacctccaagaacctcatcagt 244
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 355 agcagcctcatcggggccgccatcaaggcccccaggatcacctccaagaacctcatcagt 414

                                                                       
Query: 245 gtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctccaaaca 304
           ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 415 gtcatcttctgtgaggctgttgcaatttatggtgttatcgtggcaatcatcctccaaact 474

                                                                       
Query: 305 aagcttgaaagtgtgccaacatcccgaatgcatgatccagagtctatgcgagctggttat 364
           |||||||||||||| |||||  | | | ||||| ||||||||||| | || |||||||||
Sbjct: 475 aagcttgaaagtgtaccaactgctctagtgcatcatccagagtctctccgggctggttat 534

                      
Query: 365 gcaatctttgc 375
           |||||||||||
Sbjct: 535 gcaatctttgc 545
to top
>ref|NM_192733.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 531

 Score =  458 bits (231), Expect = e-126
 Identities = 291/311 (93%)
 Strand = Plus / Plus

                                                                       
Query: 65  tcgtcgtcgtgggcgcgcgcgctcgtgcatatctcgccctacaccttctccgccatcggc 124
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 13  tcgtcgtcgtgggcgcgcgcgctcgtgcagatctcgccctacaccttctccgccatcggc 72

                                                                       
Query: 125 atcgccgtctccatcggcgtctctgtcctcggcgcagcatgggggatcttcatcacgggg 184
           || |||||||||||||||||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 73  atagccgtctccatcggcgtctccgtcctcggcgccgcctgggggatcttcatcacgggg 132

                                                                       
Query: 185 agcagcctcatcggggccgccatcaaggcgcccaggatcacctccaagaacctcatcagt 244
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 133 agcagcctcatcggggccgccatcaaggcccccaggatcacctccaagaacctcatcagt 192

                                                                       
Query: 245 gtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctccaaaca 304
           ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 193 gtcatcttctgtgaggctgttgcaatttatggtgttatcgtggcaatcatcctccaaact 252

                                                                       
Query: 305 aagcttgaaagtgtgccaacatcccgaatgcatgatccagagtctatgcgagctggttat 364
           |||||||||||||| |||||  | | | ||||| ||||||||||| | || ||||| |||
Sbjct: 253 aagcttgaaagtgtaccaactgctctagtgcatcatccagagtctctccgggctggctat 312

                      
Query: 365 gcaatctttgc 375
           |||||||||||
Sbjct: 313 gcaatctttgc 323
to top
>dbj|AK104951.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-C12, full
           insert sequence
          Length = 1003

 Score =  458 bits (231), Expect = e-126
 Identities = 291/311 (93%)
 Strand = Plus / Plus

                                                                       
Query: 65  tcgtcgtcgtgggcgcgcgcgctcgtgcatatctcgccctacaccttctccgccatcggc 124
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 235 tcgtcgtcgtgggcgcgcgcgctcgtgcagatctcgccctacaccttctccgccatcggc 294

                                                                       
Query: 125 atcgccgtctccatcggcgtctctgtcctcggcgcagcatgggggatcttcatcacgggg 184
           || |||||||||||||||||||| ||||||||||| || |||||||||||||||||||||
Sbjct: 295 atagccgtctccatcggcgtctccgtcctcggcgccgcctgggggatcttcatcacgggg 354

                                                                       
Query: 185 agcagcctcatcggggccgccatcaaggcgcccaggatcacctccaagaacctcatcagt 244
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 355 agcagcctcatcggggccgccatcaaggcccccaggatcacctccaagaacctcatcagt 414

                                                                       
Query: 245 gtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctccaaaca 304
           ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 415 gtcatcttctgtgaggctgttgcaatttatggtgttatcgtggcaatcatcctccaaact 474

                                                                       
Query: 305 aagcttgaaagtgtgccaacatcccgaatgcatgatccagagtctatgcgagctggttat 364
           |||||||||||||| |||||  | | | ||||| ||||||||||| | || ||||| |||
Sbjct: 475 aagcttgaaagtgtaccaactgctctagtgcatcatccagagtctctccgggctggctat 534

                      
Query: 365 gcaatctttgc 375
           |||||||||||
Sbjct: 535 gcaatctttgc 545
to top
>gb|AY103992.1| Zea mays PCO096443 mRNA sequence
          Length = 914

 Score =  446 bits (225), Expect = e-122
 Identities = 302/327 (92%), Gaps = 3/327 (0%)
 Strand = Plus / Plus

                                                                       
Query: 49  gatgtcgtcggactactcgtcgtcgtgggcgcgcgcgctcgtgcatatctcgccctacac 108
           |||||||||||   |||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 74  gatgtcgtcgg---actcctcgtcgtgggcgcgcgccctggtgcagatctcgccctacac 130

                                                                       
Query: 109 cttctccgccatcggcatcgccgtctccatcggcgtctctgtcctcggcgcagcatgggg 168
           ||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||
Sbjct: 131 cttctccgccatcggcatcgctgtctccatcggcgtctcggtcctcggcgcggcatgggg 190

                                                                       
Query: 169 gatcttcatcacggggagcagcctcatcggggccgccatcaaggcgcccaggatcacctc 228
            |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||
Sbjct: 191 tatcttcatcacggggagcagcctcatcggggctgccatcaaggcgcccaggatcacatc 250

                                                                       
Query: 229 caagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggc 288
            |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 251 taagaacctcatcagtgtcatcttctgtgaggctgttgcaatttatggtgtaattgtggc 310

                                                                       
Query: 289 aatcatcctccaaacaaagcttgaaagtgtgccaacatcccgaatgcatgatccagagtc 348
           |||||||||||| |||||||||||||||||||||||||||| |||| | ||||| |||||
Sbjct: 311 aatcatcctccagacaaagcttgaaagtgtgccaacatcccaaatgtacgatccggagtc 370

                                      
Query: 349 tatgcgagctggttatgcaatctttgc 375
           | | |||||||| ||||| ||||||||
Sbjct: 371 tcttcgagctggctatgcgatctttgc 397
to top
>gb|AY462241.1| Xerophyta viscosa V-ATPase subunit c'' proteolipid (VHA-c''1) mRNA,
           complete cds
          Length = 534

 Score =  174 bits (88), Expect = 1e-40
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 95  atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgtcctc 154
           |||||||| ||||| ||| ||||||||||||||||  |||||||||||||||||||||||
Sbjct: 43  atctcgccgtacactttcgccgccatcggcatcgcaatctccatcggcgtctctgtcctc 102

                                                                       
Query: 155 ggcgcagcatgggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcg 214
           ||||| || |||||||||||||| ||||| |||||  | ||||| || || ||||| |||
Sbjct: 103 ggcgccgcctgggggatcttcataacgggtagcagtttgatcggtgcggcgatcaaagcg 162

                                                                       
Query: 215 cccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttat 274
           || || ||||| || |||||||||||||| ||||||||||||||||| ||||| || |||
Sbjct: 163 ccgagaatcacttctaagaacctcatcagcgtcatcttctgtgaggcagttgctatatat 222

                                                       
Query: 275 ggtgtaatcgtggcaatcatcctccaaacaaagcttgaaagtgt 318
           || || || || ||||| ||| | ||||| ||| | ||||||||
Sbjct: 223 ggagtcatagttgcaattatcttgcaaacgaagttagaaagtgt 266



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 354 gagctggttatgcaatctttgc 375
           ||||||||||||||||||||||
Sbjct: 302 gagctggttatgcaatctttgc 323
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  165 bits (83), Expect = 1e-37
 Identities = 92/95 (96%)
 Strand = Plus / Plus

                                                                            
Query: 65       tcgtcgtcgtgggcgcgcgcgctcgtgcatatctcgccctacaccttctccgccatcggc 124
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 24122970 tcgtcgtcgtgggcgcgcgcgctcgtgcagatctcgccctacaccttctccgccatcggc 24123029

                                                   
Query: 125      atcgccgtctccatcggcgtctctgtcctcggcgc 159
                || |||||||||||||||||||| |||||||||||
Sbjct: 24123030 atagccgtctccatcggcgtctccgtcctcggcgc 24123064



 Score =  157 bits (79), Expect = 3e-35
 Identities = 121/135 (89%)
 Strand = Plus / Plus

                                                                            
Query: 241      cagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctcca 300
                ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 24125037 cagtgtcatcttctgtgaggctgttgcaatttatggtgttatcgtggcaatcatcctcca 24125096

                                                                            
Query: 301      aacaaagcttgaaagtgtgccaacatcccgaatgcatgatccagagtctatgcgagctgg 360
                ||| |||||||||||||| |||||  | | | ||||| ||||||||||| | || |||||
Sbjct: 24125097 aactaagcttgaaagtgtaccaactgctctagtgcatcatccagagtctctccgggctgg 24125156

                               
Query: 361      ttatgcaatctttgc 375
                 ||||||||||||||
Sbjct: 24125157 ctatgcaatctttgc 24125171



 Score =  149 bits (75), Expect = 8e-33
 Identities = 78/79 (98%)
 Strand = Plus / Plus

                                                                            
Query: 165      gggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcgcccaggatca 224
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 24123183 gggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcccccaggatca 24123242

                                   
Query: 225      cctccaagaacctcatcag 243
                |||||||||||||||||||
Sbjct: 24123243 cctccaagaacctcatcag 24123261
to top
>dbj|AP002844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0410E03
          Length = 164839

 Score =  165 bits (83), Expect = 1e-37
 Identities = 92/95 (96%)
 Strand = Plus / Plus

                                                                         
Query: 65    tcgtcgtcgtgggcgcgcgcgctcgtgcatatctcgccctacaccttctccgccatcggc 124
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 98792 tcgtcgtcgtgggcgcgcgcgctcgtgcagatctcgccctacaccttctccgccatcggc 98851

                                                
Query: 125   atcgccgtctccatcggcgtctctgtcctcggcgc 159
             || |||||||||||||||||||| |||||||||||
Sbjct: 98852 atagccgtctccatcggcgtctccgtcctcggcgc 98886



 Score =  157 bits (79), Expect = 3e-35
 Identities = 121/135 (89%)
 Strand = Plus / Plus

                                                                          
Query: 241    cagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctcca 300
              ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 100859 cagtgtcatcttctgtgaggctgttgcaatttatggtgttatcgtggcaatcatcctcca 100918

                                                                          
Query: 301    aacaaagcttgaaagtgtgccaacatcccgaatgcatgatccagagtctatgcgagctgg 360
              ||| |||||||||||||| |||||  | | | ||||| ||||||||||| | || |||||
Sbjct: 100919 aactaagcttgaaagtgtaccaactgctctagtgcatcatccagagtctctccgggctgg 100978

                             
Query: 361    ttatgcaatctttgc 375
               ||||||||||||||
Sbjct: 100979 ctatgcaatctttgc 100993



 Score =  149 bits (75), Expect = 8e-33
 Identities = 78/79 (98%)
 Strand = Plus / Plus

                                                                         
Query: 165   gggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcgcccaggatca 224
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 99005 gggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcccccaggatca 99064

                                
Query: 225   cctccaagaacctcatcag 243
             |||||||||||||||||||
Sbjct: 99065 cctccaagaacctcatcag 99083
to top
>gb|AY226999.1| Citrus limon vacuolar membrane ATPase subunit c'' (VMA16) mRNA,
           complete cds
          Length = 891

 Score =  127 bits (64), Expect = 3e-26
 Identities = 175/212 (82%)
 Strand = Plus / Plus

                                                                       
Query: 107 accttctccgccatcggcatcgccgtctccatcggcgtctctgtcctcggcgcagcatgg 166
           ||||||||||||||||||||||| ||  ||||||||||||| |||||||| || || |||
Sbjct: 215 accttctccgccatcggcatcgctgtggccatcggcgtctccgtcctcggtgccgcctgg 274

                                                                       
Query: 167 gggatcttcatcacggggagcagcctcatcggggccgccatcaaggcgcccaggatcacc 226
           ||||||| ||| |||||||| ||  | ||||| ||||| |||||||| ||  | ||||||
Sbjct: 275 gggatctacataacggggagtagtttaatcggtgccgcaatcaaggctcctcgtatcacc 334

                                                                       
Query: 227 tccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtg 286
           |||||||| ||||||||||| || || ||||| || ||||| || ||||| || || || 
Sbjct: 335 tccaagaatctcatcagtgtaattttttgtgaagctgttgctatatatggggtcattgtt 394

                                           
Query: 287 gcaatcatcctccaaacaaagcttgaaagtgt 318
           ||||| ||  | ||||||||| | ||||||||
Sbjct: 395 gcaattattttacaaacaaagttagaaagtgt 426
to top
>ref|NM_128119.1| Arabidopsis thaliana ATPase AT2G25610 mRNA, complete cds
          Length = 868

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 223/281 (79%)
 Strand = Plus / Plus

                                                                       
Query: 95  atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgtcctc 154
           ||||| || ||||| |||||||||||||| |||||| ||||||||||||||||||| || 
Sbjct: 89  atctccccgtacactttctccgccatcggaatcgccatctccatcggcgtctctgttctt 148

                                                                       
Query: 155 ggcgcagcatgggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcg 214
           || || || ||||| || | ||| || || || ||  | ||||| ||||||||  | || 
Sbjct: 149 ggtgctgcctggggaatttacattaccggaagtagtttgatcggtgccgccattgaagct 208

                                                                       
Query: 215 cccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttat 274
           ||  | ||||| |||||||| ||||||||||| ||||||||||| ||||| || || || 
Sbjct: 209 cctcgaatcacttccaagaatctcatcagtgtaatcttctgtgaagccgtggctatatac 268

                                                                       
Query: 275 ggtgtaatcgtggcaatcatcctccaaacaaagcttgaaagtgtgccaacatcccgaatg 334
           ||||| || |||||||||||  | ||||| ||| | || ||||| ||| ||||    |||
Sbjct: 269 ggtgttattgtggcaatcatattacaaacgaagttggagagtgtaccatcatcaaagatg 328

                                                    
Query: 335 catgatccagagtctatgcgagctggttatgcaatctttgc 375
            ||||| | |||||| |  ||||||| ||||||||||||||
Sbjct: 329 tatgatgctgagtctctaagagctggatatgcaatctttgc 369
to top
>gb|AF436827.1|AF436827 Arabidopsis thaliana At2g25620/F3N11.7 mRNA, complete cds
          Length = 2722

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 223/281 (79%)
 Strand = Plus / Plus

                                                                        
Query: 95   atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgtcctc 154
            ||||| || ||||| |||||||||||||| |||||| ||||||||||||||||||| || 
Sbjct: 2161 atctccccgtacactttctccgccatcggaatcgccatctccatcggcgtctctgttctt 2220

                                                                        
Query: 155  ggcgcagcatgggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcg 214
            || || || ||||| || | ||| || || || ||  | ||||| ||||||||  | || 
Sbjct: 2221 ggtgctgcctggggaatttacattaccggaagtagtttgatcggtgccgccattgaagct 2280

                                                                        
Query: 215  cccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttat 274
            ||  | ||||| |||||||| ||||||||||| ||||||||||| ||||| || || || 
Sbjct: 2281 cctcgaatcacttccaagaatctcatcagtgtaatcttctgtgaagccgtggctatatac 2340

                                                                        
Query: 275  ggtgtaatcgtggcaatcatcctccaaacaaagcttgaaagtgtgccaacatcccgaatg 334
            ||||| || |||||||||||  | ||||| ||| | || ||||| ||| ||||    |||
Sbjct: 2341 ggtgttattgtggcaatcatattacaaacgaagttggagagtgtaccatcatcaaagatg 2400

                                                     
Query: 335  catgatccagagtctatgcgagctggttatgcaatctttgc 375
             ||||| | |||||| |  ||||||| ||||||||||||||
Sbjct: 2401 tatgatgctgagtctctaagagctggatatgcaatctttgc 2441
to top
>gb|AY084540.1| Arabidopsis thaliana clone 11111 mRNA, complete sequence
          Length = 871

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 223/281 (79%)
 Strand = Plus / Plus

                                                                       
Query: 95  atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgtcctc 154
           ||||| || ||||| |||||||||||||| |||||| ||||||||||||||||||| || 
Sbjct: 90  atctccccgtacactttctccgccatcggaatcgccatctccatcggcgtctctgttctt 149

                                                                       
Query: 155 ggcgcagcatgggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcg 214
           || || || ||||| || | ||| || || || ||  | ||||| ||||||||  | || 
Sbjct: 150 ggtgctgcctggggaatttacattaccggaagtagtttgatcggtgccgccattgaagct 209

                                                                       
Query: 215 cccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttat 274
           ||  | ||||| |||||||| ||||||||||| ||||||||||| ||||| || || || 
Sbjct: 210 cctcgaatcacttccaagaatctcatcagtgtaatcttctgtgaagccgtggctatatac 269

                                                                       
Query: 275 ggtgtaatcgtggcaatcatcctccaaacaaagcttgaaagtgtgccaacatcccgaatg 334
           ||||| || |||||||||||  | ||||| ||| | || ||||| ||| ||||    |||
Sbjct: 270 ggtgttattgtggcaatcatattacaaacgaagttggagagtgtaccatcatcaaagatg 329

                                                    
Query: 335 catgatccagagtctatgcgagctggttatgcaatctttgc 375
            ||||| | |||||| |  ||||||| ||||||||||||||
Sbjct: 330 tatgatgctgagtctctaagagctggatatgcaatctttgc 370
to top
>gb|BT002487.1| Arabidopsis thaliana Unnknown protein (At2g25610:At2g25620) mRNA,
            complete cds
          Length = 2721

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 223/281 (79%)
 Strand = Plus / Plus

                                                                        
Query: 95   atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgtcctc 154
            ||||| || ||||| |||||||||||||| |||||| ||||||||||||||||||| || 
Sbjct: 2161 atctccccgtacactttctccgccatcggaatcgccatctccatcggcgtctctgttctt 2220

                                                                        
Query: 155  ggcgcagcatgggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcg 214
            || || || ||||| || | ||| || || || ||  | ||||| ||||||||  | || 
Sbjct: 2221 ggtgctgcctggggaatttacattaccggaagtagtttgatcggtgccgccattgaagct 2280

                                                                        
Query: 215  cccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttat 274
            ||  | ||||| |||||||| ||||||||||| ||||||||||| ||||| || || || 
Sbjct: 2281 cctcgaatcacttccaagaatctcatcagtgtaatcttctgtgaagccgtggctatatac 2340

                                                                        
Query: 275  ggtgtaatcgtggcaatcatcctccaaacaaagcttgaaagtgtgccaacatcccgaatg 334
            ||||| || |||||||||||  | ||||| ||| | || ||||| ||| ||||    |||
Sbjct: 2341 ggtgttattgtggcaatcatattacaaacgaagttggagagtgtaccatcatcaaagatg 2400

                                                     
Query: 335  catgatccagagtctatgcgagctggttatgcaatctttgc 375
             ||||| | |||||| |  ||||||| ||||||||||||||
Sbjct: 2401 tatgatgctgagtctctaagagctggatatgcaatctttgc 2441
to top
>emb|BX819373.1|CNS0AADF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB72ZD06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 747

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 162/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 95  atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgtcctc 154
           ||||| || ||||| |||||||||||||| |||||| ||||||||||||||||||| || 
Sbjct: 69  atctccccgtacactttctccgccatcggaatcgccatctccatcggcgtctctgttctt 128

                                                                       
Query: 155 ggcgcagcatgggggatcttcatcacggggagcagcctcatcggggccgccatcaaggcg 214
           || || || ||||| || | ||| || || || ||  | ||||| ||||||||  | || 
Sbjct: 129 ggtgctgcctggggaatttacattaccggaagtagtttgatcggtgccgccattgaagct 188

                                                                       
Query: 215 cccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttat 274
           ||  | ||||| |||||||| ||||||||||| ||||||||||| ||||| || || || 
Sbjct: 189 cctcgaatcacttccaagaatctcatcagtgtaatcttctgtgaagccgtggctatatac 248

                               
Query: 275 ggtgtaatcgtggcaatcat 294
           ||||| || |||||||||||
Sbjct: 249 ggtgttattgtggcaatcat 268
to top
>gb|AC006053.3| Arabidopsis thaliana chromosome 2 clone F3N11 map B68, complete
             sequence
          Length = 100745

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                     
Query: 95    atctcgccctacaccttctccgccatcggcatcgccgtctccatcggcgtctctgt 150
             ||||| || ||||| |||||||||||||| |||||| |||||||||||||||||||
Sbjct: 19407 atctccccgtacactttctccgccatcggaatcgccatctccatcggcgtctctgt 19352



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 108/136 (79%)
 Strand = Plus / Minus

                                                                         
Query: 240   tcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctcc 299
             ||||||| ||||||||||| ||||| || || || ||||| || |||||||||||  | |
Sbjct: 18987 tcagtgtaatcttctgtgaagccgtggctatatacggtgttattgtggcaatcatattac 18928

                                                                         
Query: 300   aaacaaagcttgaaagtgtgccaacatcccgaatgcatgatccagagtctatgcgagctg 359
             |||| ||| | || ||||| ||| ||||    ||| ||||| | |||||| |  ||||||
Sbjct: 18927 aaacgaagttggagagtgtaccatcatcaaagatgtatgatgctgagtctctaagagctg 18868

                             
Query: 360   gttatgcaatctttgc 375
             | ||||||||||||||
Sbjct: 18867 gatatgcaatctttgc 18852
to top
>gb|BT013030.1| Lycopersicon esculentum clone 114278R, mRNA sequence
          Length = 1047

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 atcacctccaagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgta 280
           |||||||||||||| || || ||||| || |||||||| |||||||| || |||||||| 
Sbjct: 304 atcacctccaagaatcttattagtgtgattttctgtgaagccgttgctatctatggtgtt 363

                      
Query: 281 atcgtggcaat 291
           || ||||||||
Sbjct: 364 attgtggcaat 374
to top
>ref|NM_119405.2| Arabidopsis thaliana ATPase AT4G32530 mRNA, complete cds
          Length = 938

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 aagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggca 289
           ||||| ||||||||||||||||| || || || ||||| || ||||| || || || |||
Sbjct: 303 aagaatctcatcagtgtcatcttttgcgaagctgttgctatatatggagttattgttgca 362

                             
Query: 290 atcatcctccaaacaaag 307
           ||||| || |||||||||
Sbjct: 363 atcatactgcaaacaaag 380
to top
>gb|AY072480.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 aagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggca 289
           ||||| ||||||||||||||||| || || || ||||| || ||||| || || || |||
Sbjct: 193 aagaatctcatcagtgtcatcttttgcgaagctgttgctatatatggagttattgttgca 252

                             
Query: 290 atcatcctccaaacaaag 307
           ||||| || |||||||||
Sbjct: 253 atcatactgcaaacaaag 270
to top
>gb|AY042863.1| Arabidopsis thaliana H+-transporting ATPase-like protein (L23H3.10)
           mRNA, complete cds
          Length = 937

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 aagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggca 289
           ||||| ||||||||||||||||| || || || ||||| || ||||| || || || |||
Sbjct: 303 aagaatctcatcagtgtcatcttttgcgaagctgttgctatatatggagttattgttgca 362

                             
Query: 290 atcatcctccaaacaaag 307
           ||||| || |||||||||
Sbjct: 363 atcatactgcaaacaaag 380
to top
>gb|AY226998.1| Arabidopsis thaliana vacuolar membrane ATPase subunit c'' (VMA16)
           mRNA, complete cds
          Length = 937

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 aagaacctcatcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggca 289
           ||||| ||||||||||||||||| || || || ||||| || ||||| || || || |||
Sbjct: 303 aagaatctcatcagtgtcatcttttgcgaagctgttgctatatatggagttattgttgca 362

                             
Query: 290 atcatcctccaaacaaag 307
           ||||| || |||||||||
Sbjct: 363 atcatactgcaaacaaag 380
to top
>gb|BT013555.1| Lycopersicon esculentum clone 132292R, mRNA sequence
          Length = 2040

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                        
Query: 240  tcagtgtcatcttctgtgaggccgttgcaatttatggtgtaatcgtggcaatcatcctcc 299
            ||||||| || || ||||| || ||||| || |||||||| || ||||| ||||| || |
Sbjct: 1340 tcagtgtaattttttgtgaagcggttgctatatatggtgttattgtggccatcattcttc 1399

                               
Query: 300  aaacaaagcttgaaagtgt 318
            |||||||||| || |||||
Sbjct: 1400 aaacaaagctcgagagtgt 1418
to top
>gb|AY185519.1| Gossypium barbadense clone 2__2 putative vacuolar ATP synthase
           gene, partial cds
          Length = 367

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 336 atgatccagagtctatgcgagctggttatgcaatctttgcctcagg 381
           |||| ||||||||| |  ||||||| |||||||||||||| |||||
Sbjct: 70  atgaaccagagtctcttagagctggatatgcaatctttgcttcagg 115
to top
>ref|XM_638545.1| Dictyostelium discoideum hypothetical protein (DDB0217733), partial
            mRNA
          Length = 3813

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 336  atgatccagagtctatgcgagctgg 360
            |||||||||||||||||| ||||||
Sbjct: 2546 atgatccagagtctatgcaagctgg 2570
to top
>ref|XM_513108.1| PREDICTED: Pan troglodytes similar to
           Beta-1,4-galactosyltransferase 2 (Beta-1,4-GalTase 2)
           (Beta4Gal-T2) (b4Gal-T2)
           (UDP-galactose:beta-N-acetylglucosamine
           beta-1,4-galactosyltransferase 2) (UDP-Gal:beta-GlcNAc
           beta-1,4-galactosyltransferase 2) (LOC456522), mRNA
          Length = 1653

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 124 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 176
to top
>gb|BC060703.1| Mus musculus microtubule associated serine/threonine kinase 2, mRNA
            (cDNA clone MGC:67101 IMAGE:6412811), complete cds
          Length = 5315

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 235  cctcatcagtgtcatcttctg 255
            |||||||||||||||||||||
Sbjct: 4379 cctcatcagtgtcatcttctg 4359
to top
>gb|AC114258.3| Dictyostelium discoideum chromosome 2 map complement(427476-387492)
             strain AX4, complete sequence
          Length = 39984

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 336   atgatccagagtctatgcgagctgg 360
             |||||||||||||||||| ||||||
Sbjct: 16902 atgatccagagtctatgcaagctgg 16926
to top
>gb|BC000423.2| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit
           b, transcript variant 1, mRNA (cDNA clone MGC:8673
           IMAGE:2964510), complete cds
          Length = 1003

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 308 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 360
to top
>gb|BC005876.2| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit
           b, transcript variant 1, mRNA (cDNA clone MGC:4498
           IMAGE:2964510), complete cds
          Length = 1003

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 308 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 360
to top
>gb|BT008194.1| Synthetic construct Homo sapiens ATPase, H+ transporting, lysosomal
           21kDa, V0 subunit c'' mRNA, partial cds
          Length = 618

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 244 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 296
to top
>gb|BT007151.1| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit
           c'' mRNA, complete cds
          Length = 618

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 244 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 296
to top
>emb|CR615700.1| full-length cDNA clone CS0DF010YG10 of Fetal brain of Homo sapiens
           (human)
          Length = 944

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 288 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 340
to top
>ref|NM_001038038.1| Bos taurus ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
           (ATP6V0B), mRNA
          Length = 1098

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   | ||||||||  ||||| ||||||||||||||||
Sbjct: 329 aaggcccccaggatcaagactaagaacctggtcagtatcatcttctgtgaggc 381
to top
>emb|CR621763.1| full-length cDNA clone CS0DL005YK01 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 977

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 319 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 371
to top
>emb|CR613387.1| full-length cDNA clone CS0DM003YJ24 of Fetal liver of Homo sapiens
           (human)
          Length = 1685

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 341 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 393
to top
>emb|CR601146.1| full-length cDNA clone CS0DC020YJ01 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 957

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 319 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 371
to top
>emb|CR599148.1| full-length cDNA clone CS0DA010YJ24 of Neuroblastoma of Homo
           sapiens (human)
          Length = 988

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 330 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 382
to top
>emb|CR596289.1| full-length cDNA clone CS0DI035YO13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1703

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 306 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 358
to top
>emb|CR591603.1| full-length cDNA clone CS0DC024YO20 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 994

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 334 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 386
to top
>ref|NM_008641.1| Mus musculus microtubule associated serine/threonine kinase 2
            (Mast2), mRNA
          Length = 5374

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 235  cctcatcagtgtcatcttctg 255
            |||||||||||||||||||||
Sbjct: 4461 cctcatcagtgtcatcttctg 4441
to top
>emb|CR456972.1| Homo sapiens full open reading frame cDNA clone RZPDo834C025D for
           gene ATP6V0B, ATPase, H+ transporting, lysosomal 21kDa,
           V0 subunit c''; complete cds, incl. stopcodon
          Length = 618

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 244 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 296
to top
>gb|BC053601.1| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b,
            mRNA (cDNA clone IMAGE:5767662)
          Length = 2463

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 209  aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
            ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 1006 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 1058
to top
>gb|BC042664.1| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b,
            mRNA (cDNA clone IMAGE:5180100), with apparent retained
            intron
          Length = 1723

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 209  aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
            ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 1005 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 1057
to top
>gb|BC111150.1| Bos taurus cDNA clone MGC:134511 IMAGE:8052124, complete cds
          Length = 1098

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   | ||||||||  ||||| ||||||||||||||||
Sbjct: 329 aaggcccccaggatcaagactaagaacctggtcagtatcatcttctgtgaggc 381
to top
>ref|NM_004047.3| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
           (ATP6V0B), transcript variant 1, mRNA
          Length = 1028

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 355 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 407
to top
>ref|NM_001039457.1| Homo sapiens ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b
           (ATP6V0B), transcript variant 2, mRNA
          Length = 979

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 306 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 358
to top
>dbj|AK004728.1| Mus musculus adult male lung cDNA, RIKEN full-length enriched
            library, clone:1200012K12 product:microtubule associated
            testis specific serine/threonine protein kinase, full
            insert sequence
          Length = 3213

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 235  cctcatcagtgtcatcttctg 255
            |||||||||||||||||||||
Sbjct: 2301 cctcatcagtgtcatcttctg 2281
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 111     tctccgccatcggcatcgccg 131
               |||||||||||||||||||||
Sbjct: 1036425 tctccgccatcggcatcgccg 1036405
to top
>ref|XM_233782.3| PREDICTED: Rattus norvegicus microtubule associated serine/threonine
            kinase 2 (predicted) (Mast2_predicted), mRNA
          Length = 5456

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 235  cctcatcagtgtcatcttctg 255
            |||||||||||||||||||||
Sbjct: 4555 cctcatcagtgtcatcttctg 4535
to top
>gb|AY892285.1| Synthetic construct Homo sapiens clone FLH015432.01L ATPase H+
           transporting lysosomal 21kDa V0 subunit c'' (ATP6V0B)
           mRNA, partial cds
          Length = 618

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 244 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 296
to top
>gb|AY889818.1| Synthetic construct Homo sapiens clone FLH015437.01X ATPase
           lysosomal V0 subunit c'' (ATP6V0B) mRNA, complete cds
          Length = 618

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 244 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 296
to top
>gb|AY889817.1| Synthetic construct Homo sapiens clone FLH015436.01X ATPase
           lysosomal V0 subunit c'' (ATP6V0B) mRNA, complete cds
          Length = 618

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 244 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 296
to top
>dbj|AB093264.1| Mus musculus mRNA for mKIAA0807 protein
          Length = 4353

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 235  cctcatcagtgtcatcttctg 255
            |||||||||||||||||||||
Sbjct: 3441 cctcatcagtgtcatcttctg 3421
to top
>gb|U02313.1|MMU02313 Mus musculus MAST205 protein kinase mRNA, complete cds
          Length = 5374

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 235  cctcatcagtgtcatcttctg 255
            |||||||||||||||||||||
Sbjct: 4461 cctcatcagtgtcatcttctg 4441
to top
>emb|AL670603.6| Mouse DNA sequence from clone RP23-276M23 on chromosome 4, complete
              sequence
          Length = 173696

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 235    cctcatcagtgtcatcttctg 255
              |||||||||||||||||||||
Sbjct: 147310 cctcatcagtgtcatcttctg 147330
to top
>dbj|D89052.1| Homo sapiens mRNA for proton-ATPase-like protein, complete cds
          Length = 987

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 209 aaggcgcccaggatcacctccaagaacctcatcagtgtcatcttctgtgaggc 261
           ||||| ||||||||||   ||||||||||  ||||  ||||||||||||||||
Sbjct: 326 aaggcccccaggatcaagaccaagaacctggtcagcatcatcttctgtgaggc 378
to top
>ref|XM_515337.1| PREDICTED: Pan troglodytes LOC459077 (LOC459077), mRNA
          Length = 5421

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 4663 cctcatcagtgtcatcttct 4644
to top
>ref|NM_018263.3| Homo sapiens additional sex combs like 2 (Drosophila) (ASXL2), mRNA
          Length = 7231

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 3815 cctcatcagtgtcatcttct 3796
to top
>gb|AC127556.4| Mus musculus BAC clone RP24-344J6 from chromosome 19, complete sequence
          Length = 214042

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    gggagcagcctcatcggggc 201
              ||||||||||||||||||||
Sbjct: 177615 gggagcagcctcatcggggc 177634
to top
>ref|NM_008583.1| Mus musculus multiple endocrine neoplasia 1 (Men1), mRNA
          Length = 2984

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gggagcagcctcatcggggc 201
           ||||||||||||||||||||
Sbjct: 189 gggagcagcctcatcggggc 208
to top
>gb|BC036287.1| Mus musculus multiple endocrine neoplasia 1, mRNA (cDNA clone
           MGC:25230 IMAGE:4189611), complete cds
          Length = 2782

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gggagcagcctcatcggggc 201
           ||||||||||||||||||||
Sbjct: 117 gggagcagcctcatcggggc 136
to top
>gb|AC125478.14| Medicago truncatula clone mth2-31i19, complete sequence
          Length = 111256

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                    
Query: 240  tcagtgtcatcttctgtgaggccgttgcaatttatggtgt 279
            ||||||| ||||||||||| || ||||| || ||||||||
Sbjct: 2404 tcagtgtaatcttctgtgaagctgttgctatatatggtgt 2443
to top
>gb|AC006956.16| Mus musculus Chromosome 19 BAC Clone 7d23, complete sequence
          Length = 132397

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    gggagcagcctcatcggggc 201
              ||||||||||||||||||||
Sbjct: 121095 gggagcagcctcatcggggc 121076
to top
>gb|BC042999.2| Homo sapiens additional sex combs like 2 (Drosophila), mRNA (cDNA
            clone MGC:44431 IMAGE:5297392), complete cds
          Length = 3316

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 2438 cctcatcagtgtcatcttct 2419
to top
>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29
          Length = 303550

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   ccatcggcatcgccgtctcc 136
             ||||||||||||||||||||
Sbjct: 33134 ccatcggcatcgccgtctcc 33115
to top
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    gccatcggcatcgccgtctc 135
              ||||||||||||||||||||
Sbjct: 129804 gccatcggcatcgccgtctc 129785
to top
>emb|CR933613.1| Homo sapiens mRNA; cDNA DKFZp686C1968 (from clone DKFZp686C1968)
          Length = 7231

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 3815 cctcatcagtgtcatcttct 3796
to top
>dbj|AB084281.1| Homo sapiens mRNA for chimeric MOZ-ASXH2 fusion protein, complete cds
          Length = 9718

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 6322 cctcatcagtgtcatcttct 6303
to top
>dbj|AK001760.1| Homo sapiens cDNA FLJ10898 fis, clone NT2RP5003492
          Length = 4281

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 235 cctcatcagtgtcatcttct 254
           ||||||||||||||||||||
Sbjct: 884 cctcatcagtgtcatcttct 865
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 211     ggcgcccaggatcacctcca 230
               ||||||||||||||||||||
Sbjct: 3664771 ggcgcccaggatcacctcca 3664752
to top
>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 107     accttctccgccatcggcat 126
               ||||||||||||||||||||
Sbjct: 1563366 accttctccgccatcggcat 1563347
to top
>gb|AY965679.1| Eptatretus burgeri variable lymphocyte receptor B (VLRB) gene, complete
             cds
          Length = 91972

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 288   caatcatcctccaaacaaag 307
             ||||||||||||||||||||
Sbjct: 35609 caatcatcctccaaacaaag 35590
to top
>dbj|AK170713.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630115N08
           product:multiple endocrine neoplasia 1, full insert
           sequence
          Length = 2950

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gggagcagcctcatcggggc 201
           ||||||||||||||||||||
Sbjct: 169 gggagcagcctcatcggggc 188
to top
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    ccgccatcggcatcgccgtc 133
              ||||||||||||||||||||
Sbjct: 701624 ccgccatcggcatcgccgtc 701643



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    ccgccatcggcatcgccgtc 133
              ||||||||||||||||||||
Sbjct: 454152 ccgccatcggcatcgccgtc 454171
to top
>gb|AY185518.1| Gossypium barbadense clone 1__2 putative vacuolar ATP synthase
           gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 354 gagctggttatgcaatctttgcctcagg 381
           ||||||| |||||||||||||| |||||
Sbjct: 88  gagctggatatgcaatctttgcttcagg 115
to top
>gb|AC010150.3| Homo sapiens BAC clone RP11-404P12 from 2, complete sequence
          Length = 173893

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   cctcatcagtgtcatcttct 254
             ||||||||||||||||||||
Sbjct: 51700 cctcatcagtgtcatcttct 51681
to top
>dbj|AB051472.2| Homo sapiens mRNA for KIAA1685 protein, partial cds
          Length = 7174

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 3771 cctcatcagtgtcatcttct 3752
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 120     tcggcatcgccgtctccatcggcg 143
               |||||| |||||||||||||||||
Sbjct: 5466892 tcggcagcgccgtctccatcggcg 5466869
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 119    atcggcatcgccgtctccatcggc 142
              |||||||||||||||| |||||||
Sbjct: 296029 atcggcatcgccgtcttcatcggc 296052
to top
>emb|BX647527.1|HSM807673 Homo sapiens mRNA; cDNA DKFZp686F074 (from clone DKFZp686F074)
          Length = 7264

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 3844 cctcatcagtgtcatcttct 3825
to top
>emb|BX648218.1|HSM808366 Homo sapiens mRNA; cDNA DKFZp686L2369 (from clone DKFZp686L2369)
          Length = 8910

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 3796 cctcatcagtgtcatcttct 3777
to top
>dbj|AB084279.1| Homo sapiens ASXH2 mRNA for polycomb group protein, complete cds
          Length = 7030

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  cctcatcagtgtcatcttct 254
            ||||||||||||||||||||
Sbjct: 3634 cctcatcagtgtcatcttct 3615
to top
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 130    cgtctccatcggcgtctctg 149
              ||||||||||||||||||||
Sbjct: 194861 cgtctccatcggcgtctctg 194842
to top
>gb|AF130368.1|AF130368 Mus musculus MEN1 tumor suppressor (Men1) mRNA, alternative splice
           product, complete cds
          Length = 2947

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gggagcagcctcatcggggc 201
           ||||||||||||||||||||
Sbjct: 171 gggagcagcctcatcggggc 190
to top
>gb|AF109390.1|AF109390 Mus musculus menin (Men1) gene, complete cds
          Length = 9286

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  gggagcagcctcatcggggc 201
            ||||||||||||||||||||
Sbjct: 3151 gggagcagcctcatcggggc 3170
to top
>gb|AF109389.1|AF109389 Mus musculus menin (Men1) mRNA, complete cds
          Length = 2984

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gggagcagcctcatcggggc 201
           ||||||||||||||||||||
Sbjct: 189 gggagcagcctcatcggggc 208
to top
>gb|AF024513.1|AF024513 Mus musculus menin (Men1) gene, complete cds
          Length = 6736

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  gggagcagcctcatcggggc 201
            ||||||||||||||||||||
Sbjct: 1080 gggagcagcctcatcggggc 1099
to top
>gb|AF093756.1|AF093756 Mus musculus menin (Men1) gene, complete cds
          Length = 6779

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 gggagcagcctcatcggggc 201
           ||||||||||||||||||||
Sbjct: 915 gggagcagcctcatcggggc 934


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,424,338
Number of Sequences: 3902068
Number of extensions: 2424338
Number of successful extensions: 45890
Number of sequences better than 10.0: 86
Number of HSP's better than 10.0 without gapping: 86
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45284
Number of HSP's gapped (non-prelim): 601
length of query: 381
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 359
effective length of database: 17,147,199,772
effective search space: 6155844718148
effective search space used: 6155844718148
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top