ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal14b08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_483192.1| Oryza sativa (japonica cultivar-group), mRNA 373 e-100
2dbj|AK101328.1| Oryza sativa (japonica cultivar-group) cDNA clon... 373 e-100
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
4dbj|AP003892.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
5dbj|AP003873.2| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
6gb|AF162137.2|AF162137 Mus musculus WNT-2 gene, partial cds; put... 44 0.44
7gb|AC158663.2| Mus musculus BAC RP23-16J8 (Roswell Park Cancer ... 44 0.44
8gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 42 1.7
9ref|XM_635138.1| Dictyostelium discoideum hypothetical protein (... 42 1.7
10dbj|AP005542.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
11dbj|AP003911.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
12gb|L07305.1|HTOHATPASE Histoplasma capsulatum (clone pMS3) H-ATP... 42 1.7
13gb|M64985.1|HTOPMATP Histoplasma capsulatum plasma membrane H+ A... 42 1.7
14gb|BC031430.1| Mus musculus nucleotide binding protein 1, mRNA (... 40 6.9
15gb|AC109145.11| Mus musculus chromosome 1, clone RP23-109O14, co... 40 6.9
16gb|AC147514.12| Mus musculus chromosome 1, clone RP23-442A6, com... 40 6.9
17gb|AC154025.12| Mus musculus 6 BAC RP24-539J4 (Roswell Park Canc... 40 6.9
18gb|AC091257.13| Mus musculus chromosome 6, clone RP23-154A4, com... 40 6.9
19gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosom... 40 6.9
20gb|AC132612.3| Mus musculus BAC clone RP23-388L8 from chromosome... 40 6.9
21gb|BC047926.1| Mus musculus nucleotide binding protein 1, mRNA (... 40 6.9
22gb|AC126551.3| Mus musculus BAC clone RP24-505C20 from chromosom... 40 6.9
23gb|AC132133.1| Mus musculus BAC clone RP23-242A12 from 17, compl... 40 6.9
24gb|AC124542.4| Mus musculus BAC clone RP23-259B10 from 12, compl... 40 6.9
25gb|AY312533.1| Sus scrofa BAC 783D7 porcine endogenous retroviru... 40 6.9
26gb|AY312532.1| Sus scrofa BAC 667G4 porcine endogenous retroviru... 40 6.9
27gb|AY312531.1| Sus scrofa BAC 647G4 porcine endogenous retroviru... 40 6.9
28gb|AY312530.1| Sus scrofa BAC 534G4 porcine endogenous retroviru... 40 6.9
29gb|AY312529.1| Sus scrofa BAC 498D8 porcine endogenous retroviru... 40 6.9
30gb|AY312528.1| Sus scrofa BAC 484G4 porcine endogenous retroviru... 40 6.9
31gb|AY312522.1| Sus scrofa BAC 161B7 porcine endogenous retroviru... 40 6.9
32gb|AY312518.1| Sus scrofa BAC 1058D6 porcine endogenous retrovir... 40 6.9
33gb|AY312517.1| Sus scrofa BAC 80H6 porcine endogenous retrovirus... 40 6.9
34gb|BC055436.1| Mus musculus nucleotide binding protein 1, mRNA (... 40 6.9
35gb|AY056027.1| Sus scrofa clone 78 porcine endogenous retrovirus... 40 6.9
36gb|AC139206.5| Mus musculus chromosome 1, clone RP23-82P18, comp... 40 6.9
37gb|AC108710.3| Homo sapiens 3p BAC RP11-88I7 (Roswell Park Cance... 40 6.9
38emb|Y17013.1|PERY17013 Porcine endogenous retrovirus gag, pol, e... 40 6.9
39emb|Y12239.1|PERENV2 Porcine endogenous retrovirus env gene, 348... 40 6.9
40emb|AL596171.1| Listeria innocua Clip11262 complete genome, segm... 40 6.9
41emb|AJ293657.1|PEN293657 Porcine endogenous type C retrovirus pr... 40 6.9
42emb|AJ288589.1|PEN288589 Porcine endogenous retrovirus PERV-B1 e... 40 6.9
43emb|AJ288588.1|PEN288588 Porcine endogenous retrovirus PERV-AB7 ... 40 6.9
44emb|AJ279057.1|PEN279057 Porcine endogenous retrovirus proviral ... 40 6.9
45emb|AJ133818.1|PEN133818 Porcine endogenous retrovirus type C pr... 40 6.9
46emb|AJ133816.1|PEN133816 Porcine endogenous retrovirus type C pr... 40 6.9
47emb|AL669826.10| Mouse DNA sequence from clone RP23-5N19 on chro... 40 6.9
48gb|AY099324.1| Porcine endogenous retrovirus B gag-pol polyprote... 40 6.9
49gb|AC068912.29| Mus musculus strain 129/Sv chromosome 11 clone c... 40 6.9
50gb|AC104704.1| Drosophila melanogaster 3L BAC RP98-8H6 (Roswell ... 40 6.9
51gb|AF426946.1| Sus scrofa Taq-9 porcine endogenous retrovirus en... 40 6.9
52gb|AF426940.1| Sus scrofa Taq-4 porcine endogenous retrovirus en... 40 6.9
53gb|AF426939.1| Sus scrofa Taq-3 porcine endogenous retrovirus no... 40 6.9
54gb|AF426938.1| Sus scrofa Taq-29 porcine endogenous retrovirus n... 40 6.9
55gb|AF426937.1| Sus scrofa Taq-24 porcine endogenous retrovirus e... 40 6.9
56gb|AF426935.1| Sus scrofa Taq-20 porcine endogenous retrovirus e... 40 6.9
57gb|AF426933.1| Sus scrofa Taq-14 porcine endogenous retrovirus e... 40 6.9
58gb|AF426932.1| Sus scrofa Taq-12 porcine endogenous retrovirus n... 40 6.9
59gb|AF426916.1| Sus scrofa Pfu-1 porcine endogenous retrovirus en... 40 6.9
60gb|AC024890.20| Homo sapiens 3 BAC RP11-389A20 (Roswell Park Can... 40 6.9
61gb|AC069536.4| Homo sapiens chromosome 10 clone RP11-112J5, comp... 40 6.9
62gb|AY056035.1| Porcine endogenous retrovirus clone 78 gag, pol a... 40 6.9
63dbj|AK157212.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 6.9
64gb|AY056031.1| Porcine endogenous retrovirus clone 65321 3' LTR,... 40 6.9
65gb|AY056030.1| Porcine endogenous retrovirus clone 73414 3' LTR,... 40 6.9
66gb|AY056028.1| Sus scrofa clone 2441 porcine endogenous retrovir... 40 6.9
67gb|AY056026.1| Sus scrofa clone 73414 porcine endogenous retrovi... 40 6.9
68gb|AY056025.1| Sus scrofa clone 35121 porcine endogenous retrovi... 40 6.9
69gb|AY056024.1| Sus scrofa clone 21321 porcine endogenous retrovi... 40 6.9
70dbj|AK020876.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 6.9
71gb|DQ011798.1| Sus scrofa isolate T24 endogenous virus Porcine e... 40 6.9
72gb|DQ011797.1| Sus scrofa isolate T23 endogenous virus Porcine e... 40 6.9
73gb|DQ011795.1| Sus scrofa isolate T18 endogenous virus Porcine e... 40 6.9
74gb|DQ011793.1| Sus scrofa isolate T13 endogenous virus Porcine e... 40 6.9
75gb|DQ011792.1| Sus scrofa isolate T11 endogenous virus Porcine e... 40 6.9
76gb|DQ011790.1| Sus scrofa isolate T7 endogenous virus Porcine en... 40 6.9
77gb|DQ011789.1| Sus scrofa isolate T6 endogenous virus Porcine en... 40 6.9
78gb|DQ011787.1| Sus scrofa isolate M33 endogenous virus Porcine e... 40 6.9
79gb|DQ011786.1| Sus scrofa isolate M31 endogenous virus Porcine e... 40 6.9
80gb|DQ011785.1| Sus scrofa isolate M29 endogenous virus Porcine e... 40 6.9
81gb|DQ011784.1| Sus scrofa isolate M28 endogenous virus Porcine e... 40 6.9
82gb|DQ011783.1| Sus scrofa isolate M27 endogenous virus Porcine e... 40 6.9
83gb|DQ011782.1| Sus scrofa isolate M26 endogenous virus Porcine e... 40 6.9
84gb|DQ011781.1| Sus scrofa isolate M25 endogenous virus Porcine e... 40 6.9
85gb|DQ011779.1| Sus scrofa isolate M20 endogenous virus Porcine e... 40 6.9
86gb|DQ011775.1| Sus scrofa isolate M8 endogenous virus Porcine en... 40 6.9
87gb|DQ011774.1| Sus scrofa isolate M2 endogenous virus Porcine en... 40 6.9
88gb|DQ011773.1| Sus scrofa isolate T12 endogenous virus Porcine e... 40 6.9
89gb|DQ011770.1| Sus scrofa isolate Y28 endogenous virus Porcine e... 40 6.9
90gb|DQ011769.1| Sus scrofa isolate Y20 endogenous virus Porcine e... 40 6.9
91gb|DQ011766.1| Sus scrofa isolate Y16 endogenous virus Porcine e... 40 6.9
92gb|DQ011765.1| Sus scrofa isolate Y13 endogenous virus Porcine e... 40 6.9
93gb|DQ011764.1| Sus scrofa isolate Y11 endogenous virus Porcine e... 40 6.9
94gb|DQ011763.1| Sus scrofa isolate Y4 endogenous virus Porcine en... 40 6.9
95gb|DQ011762.1| Sus scrofa isolate Y1 endogenous virus Porcine en... 40 6.9
96gb|DQ011761.1| Sus scrofa isolate L28 endogenous virus Porcine e... 40 6.9
97gb|DQ011760.1| Sus scrofa isolate L27 endogenous virus Porcine e... 40 6.9
98gb|DQ011759.1| Sus scrofa isolate L26 endogenous virus Porcine e... 40 6.9
99gb|DQ011758.1| Sus scrofa isolate L23 endogenous virus Porcine e... 40 6.9
100gb|DQ011757.1| Sus scrofa isolate L17 endogenous virus Porcine e... 40 6.9
101gb|DQ011752.1| Sus scrofa isolate D17 endogenous virus Porcine e... 40 6.9
102gb|DQ011751.1| Sus scrofa isolate D7 endogenous virus Porcine en... 40 6.9
103gb|DQ011747.1| Sus scrofa isolate B20 endogenous virus Porcine e... 40 6.9
104gb|DQ011744.1| Sus scrofa isolate Y22 endogenous virus Porcine e... 40 6.9
105gb|DQ011743.1| Sus scrofa isolate Y19 endogenous virus Porcine e... 40 6.9
106gb|DQ011742.1| Sus scrofa isolate L21 endogenous virus Porcine e... 40 6.9
107gb|DQ011741.1| Sus scrofa isolate L10 endogenous virus Porcine e... 40 6.9
108gb|DQ011740.1| Sus scrofa isolate D21 endogenous virus Porcine e... 40 6.9
109gb|DQ011739.1| Sus scrofa isolate D14 endogenous virus Porcine e... 40 6.9
110gb|DQ011738.1| Sus scrofa isolate D10 endogenous virus Porcine e... 40 6.9
111gb|DQ011737.1| Sus scrofa isolate D6 endogenous virus Porcine en... 40 6.9
112gb|DQ011735.1| Sus scrofa isolate B9 endogenous virus Porcine en... 40 6.9
113gb|AF114170.1|AF114170 Mus musculus nucleotide-binding protein l... 40 6.9
114gb|AE003527.3| Drosophila melanogaster chromosome 3L, section 58... 40 6.9
115gb|AF014162.1|AF014162 Porcine endogenous retrovirus envelope pr... 40 6.9
116ref|NM_011955.1| Mus musculus nucleotide binding protein 1 (Nubp... 40 6.9 
>ref|XM_483192.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2237

 Score =  373 bits (188), Expect = e-100
 Identities = 365/424 (86%)
 Strand = Plus / Plus

                                                                       
Query: 84  agagaatagctcgaatatcggtcacttggagaggcaggcaacttgacgttgatgcagacc 143
           ||||||||||||| || |||||||||||||||||||| || || || || ||||||||||
Sbjct: 18  agagaatagctcggatttcggtcacttggagaggcagacagctcgatgtcgatgcagacc 77

                                                                       
Query: 144 caagatgtacgatcaaggaatttgggcaactgctccaggatttgactaatgttaaaccag 203
           | || |||||| | |||||||| ||||||||  | ||||||||||||| |||||| ||||
Sbjct: 78  cgagctgtacggtgaaggaattcgggcaacttttgcaggatttgactagtgttaacccag 137

                                                                       
Query: 204 agacgttgaagctcatagttccgcaatctgcaaacaaaggttccaagctgatcagtccat 263
           |||| |||||||| || |||||||| ||| |||||||||| |||||||||||||  || |
Sbjct: 138 agacattgaagcttattgttccgcagtctacaaacaaaggctccaagctgatcacaccgt 197

                                                                       
Query: 264 tttcagacacccattcaagcttaacactgaaagaagccgctatcagtgagggtaagctta 323
           |||| ||| | ||||||   || ||| |||||||||| ||||| ||||| || |||| ||
Sbjct: 198 tttccgaccctcattcagttttgacattgaaagaagctgctattagtgatgggaagccta 257

                                                                       
Query: 324 ttagaatgatgggtgtatttgaagatgaaattgaggaagtatcagacaatggaaaaaacc 383
           |||||||||||||||| ||| | |||||||| ||||||||||| |||||||| ||||   
Sbjct: 258 ttagaatgatgggtgtttttaatgatgaaatcgaggaagtatcggacaatggcaaaagaa 317

                                                                       
Query: 384 cagatatgcggataattggatttgaagaggaagaacagcggctgaggcaacgatcttcag 443
           ||||| | ||||||||||||||||| ||||||||||| ||||||||||||||| | ||||
Sbjct: 318 cagatctacggataattggatttgaggaggaagaacaacggctgaggcaacgaacatcag 377

                                                                       
Query: 444 gcaggccccgagtttcactgaaacttccacaggggcaatacatcttctgtgattttagga 503
           ||||||||| |||| |||| |||||||||||||| ||||||||||||||||||||| |||
Sbjct: 378 gcaggccccaagttccactcaaacttccacagggccaatacatcttctgtgattttcgga 437

               
Query: 504 cact 507
           ||||
Sbjct: 438 cact 441
to top
>dbj|AK101328.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034G12, full
           insert sequence
          Length = 2575

 Score =  373 bits (188), Expect = e-100
 Identities = 365/424 (86%)
 Strand = Plus / Plus

                                                                       
Query: 84  agagaatagctcgaatatcggtcacttggagaggcaggcaacttgacgttgatgcagacc 143
           ||||||||||||| || |||||||||||||||||||| || || || || ||||||||||
Sbjct: 355 agagaatagctcggatttcggtcacttggagaggcagacagctcgatgtcgatgcagacc 414

                                                                       
Query: 144 caagatgtacgatcaaggaatttgggcaactgctccaggatttgactaatgttaaaccag 203
           | || |||||| | |||||||| ||||||||  | ||||||||||||| |||||| ||||
Sbjct: 415 cgagctgtacggtgaaggaattcgggcaacttttgcaggatttgactagtgttaacccag 474

                                                                       
Query: 204 agacgttgaagctcatagttccgcaatctgcaaacaaaggttccaagctgatcagtccat 263
           |||| |||||||| || |||||||| ||| |||||||||| |||||||||||||  || |
Sbjct: 475 agacattgaagcttattgttccgcagtctacaaacaaaggctccaagctgatcacaccgt 534

                                                                       
Query: 264 tttcagacacccattcaagcttaacactgaaagaagccgctatcagtgagggtaagctta 323
           |||| ||| | ||||||   || ||| |||||||||| ||||| ||||| || |||| ||
Sbjct: 535 tttccgaccctcattcagttttgacattgaaagaagctgctattagtgatgggaagccta 594

                                                                       
Query: 324 ttagaatgatgggtgtatttgaagatgaaattgaggaagtatcagacaatggaaaaaacc 383
           |||||||||||||||| ||| | |||||||| ||||||||||| |||||||| ||||   
Sbjct: 595 ttagaatgatgggtgtttttaatgatgaaatcgaggaagtatcggacaatggcaaaagaa 654

                                                                       
Query: 384 cagatatgcggataattggatttgaagaggaagaacagcggctgaggcaacgatcttcag 443
           ||||| | ||||||||||||||||| ||||||||||| ||||||||||||||| | ||||
Sbjct: 655 cagatctacggataattggatttgaggaggaagaacaacggctgaggcaacgaacatcag 714

                                                                       
Query: 444 gcaggccccgagtttcactgaaacttccacaggggcaatacatcttctgtgattttagga 503
           ||||||||| |||| |||| |||||||||||||| ||||||||||||||||||||| |||
Sbjct: 715 gcaggccccaagttccactcaaacttccacagggccaatacatcttctgtgattttcgga 774

               
Query: 504 cact 507
           ||||
Sbjct: 775 cact 778
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  214 bits (108), Expect = 2e-52
 Identities = 174/196 (88%)
 Strand = Plus / Plus

                                                                            
Query: 312      agggtaagcttattagaatgatgggtgtatttgaagatgaaattgaggaagtatcagaca 371
                |||| |||| |||||||||||||||||| ||| | |||||||| ||||||||||| ||||
Sbjct: 24720737 aggggaagcctattagaatgatgggtgtttttaatgatgaaatcgaggaagtatcggaca 24720796

                                                                            
Query: 372      atggaaaaaacccagatatgcggataattggatttgaagaggaagaacagcggctgaggc 431
                |||| ||||   ||||| | ||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 24720797 atggcaaaagaacagatctacggataattggatttgaggaggaagaacaacggctgaggc 24720856

                                                                            
Query: 432      aacgatcttcaggcaggccccgagtttcactgaaacttccacaggggcaatacatcttct 491
                ||||| | ||||||||||||| |||| |||| |||||||||||||| |||||||||||||
Sbjct: 24720857 aacgaacatcaggcaggccccaagttccactcaaacttccacagggccaatacatcttct 24720916

                                
Query: 492      gtgattttaggacact 507
                |||||||| |||||||
Sbjct: 24720917 gtgattttcggacact 24720932



 Score =  168 bits (85), Expect = 1e-38
 Identities = 193/229 (84%)
 Strand = Plus / Plus

                                                                            
Query: 84       agagaatagctcgaatatcggtcacttggagaggcaggcaacttgacgttgatgcagacc 143
                ||||||||||||| || |||||||||||||||||||| || || || || ||||||||||
Sbjct: 24720407 agagaatagctcggatttcggtcacttggagaggcagacagctcgatgtcgatgcagacc 24720466

                                                                            
Query: 144      caagatgtacgatcaaggaatttgggcaactgctccaggatttgactaatgttaaaccag 203
                | || |||||| | |||||||| ||||||||  | ||||||||||||| |||||| ||||
Sbjct: 24720467 cgagctgtacggtgaaggaattcgggcaacttttgcaggatttgactagtgttaacccag 24720526

                                                                            
Query: 204      agacgttgaagctcatagttccgcaatctgcaaacaaaggttccaagctgatcagtccat 263
                |||| |||||||| || |||||||| ||| |||||||||| |||||||||||||  || |
Sbjct: 24720527 agacattgaagcttattgttccgcagtctacaaacaaaggctccaagctgatcacaccgt 24720586

                                                                 
Query: 264      tttcagacacccattcaagcttaacactgaaagaagccgctatcagtga 312
                |||| ||| | ||||||   || ||| |||||||||| ||||| |||||
Sbjct: 24720587 tttccgaccctcattcagttttgacattgaaagaagctgctattagtga 24720635



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 348     atgaaattgaggaagtatcagacaa 372
               ||||||||||||||||| |||||||
Sbjct: 2283658 atgaaattgaggaagtaacagacaa 2283634
to top
>dbj|AP003892.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1345_D02
          Length = 159613

 Score =  214 bits (108), Expect = 2e-52
 Identities = 174/196 (88%)
 Strand = Plus / Plus

                                                                         
Query: 312   agggtaagcttattagaatgatgggtgtatttgaagatgaaattgaggaagtatcagaca 371
             |||| |||| |||||||||||||||||| ||| | |||||||| ||||||||||| ||||
Sbjct: 21538 aggggaagcctattagaatgatgggtgtttttaatgatgaaatcgaggaagtatcggaca 21597

                                                                         
Query: 372   atggaaaaaacccagatatgcggataattggatttgaagaggaagaacagcggctgaggc 431
             |||| ||||   ||||| | ||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 21598 atggcaaaagaacagatctacggataattggatttgaggaggaagaacaacggctgaggc 21657

                                                                         
Query: 432   aacgatcttcaggcaggccccgagtttcactgaaacttccacaggggcaatacatcttct 491
             ||||| | ||||||||||||| |||| |||| |||||||||||||| |||||||||||||
Sbjct: 21658 aacgaacatcaggcaggccccaagttccactcaaacttccacagggccaatacatcttct 21717

                             
Query: 492   gtgattttaggacact 507
             |||||||| |||||||
Sbjct: 21718 gtgattttcggacact 21733



 Score =  168 bits (85), Expect = 1e-38
 Identities = 193/229 (84%)
 Strand = Plus / Plus

                                                                         
Query: 84    agagaatagctcgaatatcggtcacttggagaggcaggcaacttgacgttgatgcagacc 143
             ||||||||||||| || |||||||||||||||||||| || || || || ||||||||||
Sbjct: 21208 agagaatagctcggatttcggtcacttggagaggcagacagctcgatgtcgatgcagacc 21267

                                                                         
Query: 144   caagatgtacgatcaaggaatttgggcaactgctccaggatttgactaatgttaaaccag 203
             | || |||||| | |||||||| ||||||||  | ||||||||||||| |||||| ||||
Sbjct: 21268 cgagctgtacggtgaaggaattcgggcaacttttgcaggatttgactagtgttaacccag 21327

                                                                         
Query: 204   agacgttgaagctcatagttccgcaatctgcaaacaaaggttccaagctgatcagtccat 263
             |||| |||||||| || |||||||| ||| |||||||||| |||||||||||||  || |
Sbjct: 21328 agacattgaagcttattgttccgcagtctacaaacaaaggctccaagctgatcacaccgt 21387

                                                              
Query: 264   tttcagacacccattcaagcttaacactgaaagaagccgctatcagtga 312
             |||| ||| | ||||||   || ||| |||||||||| ||||| |||||
Sbjct: 21388 tttccgaccctcattcagttttgacattgaaagaagctgctattagtga 21436
to top
>dbj|AP003873.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1118_A06
          Length = 92836

 Score =  111 bits (56), Expect = 2e-21
 Identities = 107/124 (86%)
 Strand = Plus / Plus

                                                                         
Query: 84    agagaatagctcgaatatcggtcacttggagaggcaggcaacttgacgttgatgcagacc 143
             ||||||||||||| || |||||||||||||||||||| || || || || ||||||||||
Sbjct: 92711 agagaatagctcggatttcggtcacttggagaggcagacagctcgatgtcgatgcagacc 92770

                                                                         
Query: 144   caagatgtacgatcaaggaatttgggcaactgctccaggatttgactaatgttaaaccag 203
             | || |||||| | |||||||| ||||||||  | ||||||||||||| |||||| ||||
Sbjct: 92771 cgagctgtacggtgaaggaattcgggcaacttttgcaggatttgactagtgttaacccag 92830

                 
Query: 204   agac 207
             ||||
Sbjct: 92831 agac 92834
to top
>gb|AF162137.2|AF162137 Mus musculus WNT-2 gene, partial cds; putative ankyrin-related protein
              and cystic fibrosis transmembrane conductance regulator
              (CFTR) genes, complete cds; and unknown gene
          Length = 357856

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 259    tccattttcagacacccattca 280
              ||||||||||||||||||||||
Sbjct: 254738 tccattttcagacacccattca 254759
to top
>gb|AC158663.2| Mus musculus  BAC RP23-16J8 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 216101

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 259   tccattttcagacacccattca 280
             ||||||||||||||||||||||
Sbjct: 59553 tccattttcagacacccattca 59574
to top
>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Plus

                                               
Query: 350    gaaattgaggaagt-atcagacaatggaaaaaa 381
              |||||||||||||| |||||| |||||||||||
Sbjct: 133450 gaaattgaggaagttatcagaaaatggaaaaaa 133482
to top
>ref|XM_635138.1| Dictyostelium discoideum hypothetical protein (DDB0204952), partial
            mRNA
          Length = 3903

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 337  tgtatttgaagatgaaattgaggaa 361
            ||||||||||||||| |||||||||
Sbjct: 3570 tgtatttgaagatgatattgaggaa 3546
to top
>dbj|AP005542.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0473D02
          Length = 146185

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 348   atgaaattgaggaagtatcagacaa 372
             ||||||||||||||||| |||||||
Sbjct: 31157 atgaaattgaggaagtaacagacaa 31133
to top
>dbj|AP003911.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1368_G08
          Length = 107074

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 348   atgaaattgaggaagtatcagacaa 372
             ||||||||||||||||| |||||||
Sbjct: 81785 atgaaattgaggaagtaacagacaa 81761
to top
>gb|L07305.1|HTOHATPASE Histoplasma capsulatum (clone pMS3) H-ATPase gene, complete cds
          Length = 5584

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 329  atgatgggtgtatttgaagat 349
            |||||||||||||||||||||
Sbjct: 1139 atgatgggtgtatttgaagat 1119
to top
>gb|M64985.1|HTOPMATP Histoplasma capsulatum plasma membrane H+ ATPase gene
          Length = 5582

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 329  atgatgggtgtatttgaagat 349
            |||||||||||||||||||||
Sbjct: 1138 atgatgggtgtatttgaagat 1118
to top
>gb|BC031430.1| Mus musculus nucleotide binding protein 1, mRNA (cDNA clone
          IMAGE:3674511), containing frame-shift errors
          Length = 2154

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 96 ggcacgaggctcctcggccg 77
to top
>gb|AC109145.11| Mus musculus chromosome 1, clone RP23-109O14, complete sequence
          Length = 186661

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 343    tgaagatgaaattgaggaag 362
              ||||||||||||||||||||
Sbjct: 137938 tgaagatgaaattgaggaag 137957
to top
>gb|AC147514.12| Mus musculus chromosome 1, clone RP23-442A6, complete sequence
          Length = 187725

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 343  tgaagatgaaattgaggaag 362
            ||||||||||||||||||||
Sbjct: 1344 tgaagatgaaattgaggaag 1325
to top
>gb|AC154025.12| Mus musculus 6 BAC RP24-539J4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 165821

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 340   atttgaagatgaaattgagg 359
             ||||||||||||||||||||
Sbjct: 16566 atttgaagatgaaattgagg 16547
to top
>gb|AC091257.13| Mus musculus chromosome 6, clone RP23-154A4, complete sequence
          Length = 193889

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 340    atttgaagatgaaattgagg 359
              ||||||||||||||||||||
Sbjct: 157034 atttgaagatgaaattgagg 157015
to top
>gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosome 16, complete
            sequence
          Length = 196519

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 5    ggcacgaggctcctcggccg 24
            ||||||||||||||||||||
Sbjct: 8008 ggcacgaggctcctcggccg 7989
to top
>gb|AC132612.3| Mus musculus BAC clone RP23-388L8 from chromosome 17, complete sequence
          Length = 203810

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 400    tggatttgaagaggaagaac 419
              ||||||||||||||||||||
Sbjct: 173346 tggatttgaagaggaagaac 173365
to top
>gb|BC047926.1| Mus musculus nucleotide binding protein 1, mRNA (cDNA clone
          IMAGE:5343525), with apparent retained intron
          Length = 2442

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 84 ggcacgaggctcctcggccg 65
to top
>gb|AC126551.3| Mus musculus BAC clone RP24-505C20 from chromosome 12, complete
             sequence
          Length = 151373

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    aaatggatgaacagagaata 91
             ||||||||||||||||||||
Sbjct: 37905 aaatggatgaacagagaata 37886
to top
>gb|AC132133.1| Mus musculus BAC clone RP23-242A12 from 17, complete sequence
          Length = 174152

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 400   tggatttgaagaggaagaac 419
             ||||||||||||||||||||
Sbjct: 55392 tggatttgaagaggaagaac 55411
to top
>gb|AC124542.4| Mus musculus BAC clone RP23-259B10 from 12, complete sequence
          Length = 179046

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     aaatggatgaacagagaata 91
              ||||||||||||||||||||
Sbjct: 176726 aaatggatgaacagagaata 176707
to top
>gb|AY312533.1| Sus scrofa BAC 783D7 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1647

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312532.1| Sus scrofa BAC 667G4 porcine endogenous retrovirus envelope protein
           (env) gene, complete cds
          Length = 1803

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 306 tcagtgagggtaagcttatt 325
           ||||||||||||||||||||
Sbjct: 923 tcagtgagggtaagcttatt 904
to top
>gb|AY312531.1| Sus scrofa BAC 647G4 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1701

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312530.1| Sus scrofa BAC 534G4 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1974

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312529.1| Sus scrofa BAC 498D8 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1974

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312528.1| Sus scrofa BAC 484G4 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1974

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312522.1| Sus scrofa BAC 161B7 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1974

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312518.1| Sus scrofa BAC 1058D6 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1953

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AY312517.1| Sus scrofa BAC 80H6 porcine endogenous retrovirus envelope protein
            (env) gene, complete cds
          Length = 1905

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1025 tcagtgagggtaagcttatt 1006
to top
>gb|BC055436.1| Mus musculus nucleotide binding protein 1, mRNA (cDNA clone
          MGC:65267 IMAGE:3660324), complete cds
          Length = 1264

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 94 ggcacgaggctcctcggccg 75
to top
>gb|AY056027.1| Sus scrofa clone 78 porcine endogenous retrovirus envelope protein
            gene, complete cds
          Length = 2084

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1105 tcagtgagggtaagcttatt 1086
to top
>gb|AC139206.5| Mus musculus chromosome 1, clone RP23-82P18, complete sequence
          Length = 304494

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 343    tgaagatgaaattgaggaag 362
              ||||||||||||||||||||
Sbjct: 294960 tgaagatgaaattgaggaag 294941
to top
>gb|AC108710.3| Homo sapiens 3p BAC RP11-88I7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 186799

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 481   atacatcttctgtgatttta 500
             ||||||||||||||||||||
Sbjct: 64051 atacatcttctgtgatttta 64032
to top
>emb|Y17013.1|PERY17013 Porcine endogenous retrovirus gag, pol, env genes
          Length = 7808

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 6387 tcagtgagggtaagcttatt 6368
to top
>emb|Y12239.1|PERENV2 Porcine endogenous retrovirus env gene, 3482 bp
          Length = 3482

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 2004 tcagtgagggtaagcttatt 1985
to top
>emb|AL596171.1| Listeria innocua Clip11262 complete genome, segment 9/12
          Length = 258650

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 363    tatcagacaatggaaaaaac 382
              ||||||||||||||||||||
Sbjct: 207116 tatcagacaatggaaaaaac 207097
to top
>emb|AJ293657.1|PEN293657 Porcine endogenous type C retrovirus proviral gag gene, pol gene and
            env gene, class B, clone 213
          Length = 8763

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 7205 tcagtgagggtaagcttatt 7186
to top
>emb|AJ288589.1|PEN288589 Porcine endogenous retrovirus PERV-B1 env gene for envelope protein,
            genomic RNA
          Length = 1968

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1085 tcagtgagggtaagcttatt 1066
to top
>emb|AJ288588.1|PEN288588 Porcine endogenous retrovirus PERV-AB7 env gene for envelope protein,
            genomic RNA
          Length = 2000

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>emb|AJ279057.1|PEN279057 Porcine endogenous retrovirus proviral gag gene, pol gene and env
            gene
          Length = 8840

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 7243 tcagtgagggtaagcttatt 7224
to top
>emb|AJ133818.1|PEN133818 Porcine endogenous retrovirus type C proviral gag, pol and env genes
            and LTR (class B, clone 43)
          Length = 8750

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 7192 tcagtgagggtaagcttatt 7173
to top
>emb|AJ133816.1|PEN133816 Porcine endogenous retrovirus type C proviral gag, pol and env genes
            and LTR (class B, clone 33)
          Length = 8918

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 7282 tcagtgagggtaagcttatt 7263
to top
>emb|AL669826.10| Mouse DNA sequence from clone RP23-5N19 on chromosome 11 Contains a
            novel gene and a CpG island, complete sequence
          Length = 154338

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  tcagacaatggaaaaaacccagat 388
            ||||| ||||||||||||||||||
Sbjct: 7316 tcagaaaatggaaaaaacccagat 7339
to top
>gb|AY099324.1| Porcine endogenous retrovirus B gag-pol polyprotein and env protein
            genes, complete cds
          Length = 8704

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 7138 tcagtgagggtaagcttatt 7119
to top
>gb|AC068912.29| Mus musculus strain 129/Sv chromosome 11 clone ct7-326n13, complete
             sequence
          Length = 195413

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 365   tcagacaatggaaaaaacccagat 388
             ||||| ||||||||||||||||||
Sbjct: 79145 tcagaaaatggaaaaaacccagat 79122
to top
>gb|AC104704.1| Drosophila melanogaster 3L BAC RP98-8H6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 169705

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 406   tgaagaggaagaacagcggc 425
             ||||||||||||||||||||
Sbjct: 84525 tgaagaggaagaacagcggc 84544
to top
>gb|AF426946.1| Sus scrofa Taq-9 porcine endogenous retrovirus envelope protein (env)
            gene, partial cds
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426940.1| Sus scrofa Taq-4 porcine endogenous retrovirus envelope protein (env)
            gene, partial cds
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426939.1| Sus scrofa Taq-3 porcine endogenous retrovirus nonfunctional envelope
            protein gene, partial sequence
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426938.1| Sus scrofa Taq-29 porcine endogenous retrovirus nonfunctional
            envelope protein gene, partial sequence
          Length = 1774

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AF426937.1| Sus scrofa Taq-24 porcine endogenous retrovirus envelope protein
            (env) gene, partial cds
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426935.1| Sus scrofa Taq-20 porcine endogenous retrovirus envelope protein
            (env) gene, partial cds
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426933.1| Sus scrofa Taq-14 porcine endogenous retrovirus envelope protein
            (env) gene, partial cds
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426932.1| Sus scrofa Taq-12 porcine endogenous retrovirus nonfunctional
            envelope protein gene, partial sequence
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AF426916.1| Sus scrofa Pfu-1 porcine endogenous retrovirus envelope protein (env)
            gene, partial cds
          Length = 1775

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|AC024890.20| Homo sapiens 3 BAC RP11-389A20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 172117

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 481   atacatcttctgtgatttta 500
             ||||||||||||||||||||
Sbjct: 61603 atacatcttctgtgatttta 61584
to top
>gb|AC069536.4| Homo sapiens chromosome 10 clone RP11-112J5, complete sequence
          Length = 170941

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 480  aatacatcttctgtgatttt 499
            ||||||||||||||||||||
Sbjct: 4638 aatacatcttctgtgatttt 4619
to top
>gb|AY056035.1| Porcine endogenous retrovirus clone 78 gag, pol and env genes,
            complete cds
          Length = 8763

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 7205 tcagtgagggtaagcttatt 7186
to top
>dbj|AK157212.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
          library, clone:F830206N12 product:nucleotide binding
          protein 1, full insert sequence
          Length = 1219

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 98 ggcacgaggctcctcggccg 79
to top
>gb|AY056031.1| Porcine endogenous retrovirus clone 65321 3' LTR, complete sequence
          Length = 1741

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 306 tcagtgagggtaagcttatt 325
           ||||||||||||||||||||
Sbjct: 315 tcagtgagggtaagcttatt 296
to top
>gb|AY056030.1| Porcine endogenous retrovirus clone 73414 3' LTR, complete sequence
          Length = 1734

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1446 tcagtgagggtaagcttatt 1465
to top
>gb|AY056028.1| Sus scrofa clone 2441 porcine endogenous retrovirus envelope protein
            gene, partial cds
          Length = 1913

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1064 tcagtgagggtaagcttatt 1045
to top
>gb|AY056026.1| Sus scrofa clone 73414 porcine endogenous retrovirus envelope protein
            gene, partial cds
          Length = 1929

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1070 tcagtgagggtaagcttatt 1051
to top
>gb|AY056025.1| Sus scrofa clone 35121 porcine endogenous retrovirus envelope protein
            gene, partial cds
          Length = 1925

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1067 tcagtgagggtaagcttatt 1048
to top
>gb|AY056024.1| Sus scrofa clone 21321 porcine endogenous retrovirus envelope protein
            gene, partial cds
          Length = 1917

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1068 tcagtgagggtaagcttatt 1049
to top
>dbj|AK020876.1| Mus musculus adult retina cDNA, RIKEN full-length enriched
          library, clone:A930019G03 product:nucleotide binding
          protein 1, full insert sequence
          Length = 682

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 91 ggcacgaggctcctcggccg 72
to top
>gb|DQ011798.1| Sus scrofa isolate T24 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011797.1| Sus scrofa isolate T23 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1594

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1091 tcagtgagggtaagcttatt 1072
to top
>gb|DQ011795.1| Sus scrofa isolate T18 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1567

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1084 tcagtgagggtaagcttatt 1065
to top
>gb|DQ011793.1| Sus scrofa isolate T13 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011792.1| Sus scrofa isolate T11 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011790.1| Sus scrofa isolate T7 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1598

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|DQ011789.1| Sus scrofa isolate T6 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011787.1| Sus scrofa isolate M33 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1596

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1093 tcagtgagggtaagcttatt 1074
to top
>gb|DQ011786.1| Sus scrofa isolate M31 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1587

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1084 tcagtgagggtaagcttatt 1065
to top
>gb|DQ011785.1| Sus scrofa isolate M29 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1594

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1091 tcagtgagggtaagcttatt 1072
to top
>gb|DQ011784.1| Sus scrofa isolate M28 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1570

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1067 tcagtgagggtaagcttatt 1048
to top
>gb|DQ011783.1| Sus scrofa isolate M27 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1601

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1098 tcagtgagggtaagcttatt 1079
to top
>gb|DQ011782.1| Sus scrofa isolate M26 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011781.1| Sus scrofa isolate M25 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011779.1| Sus scrofa isolate M20 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1557

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1054 tcagtgagggtaagcttatt 1035
to top
>gb|DQ011775.1| Sus scrofa isolate M8 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1559

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1056 tcagtgagggtaagcttatt 1037
to top
>gb|DQ011774.1| Sus scrofa isolate M2 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1605

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1102 tcagtgagggtaagcttatt 1083
to top
>gb|DQ011773.1| Sus scrofa isolate T12 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011770.1| Sus scrofa isolate Y28 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|DQ011769.1| Sus scrofa isolate Y20 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1594

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1090 tcagtgagggtaagcttatt 1071
to top
>gb|DQ011766.1| Sus scrofa isolate Y16 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1593

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1090 tcagtgagggtaagcttatt 1071
to top
>gb|DQ011765.1| Sus scrofa isolate Y13 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1593

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1090 tcagtgagggtaagcttatt 1071
to top
>gb|DQ011764.1| Sus scrofa isolate Y11 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011763.1| Sus scrofa isolate Y4 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1598

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|DQ011762.1| Sus scrofa isolate Y1 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1578

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1077 tcagtgagggtaagcttatt 1058
to top
>gb|DQ011761.1| Sus scrofa isolate L28 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1595

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011760.1| Sus scrofa isolate L27 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011759.1| Sus scrofa isolate L26 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1591

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1088 tcagtgagggtaagcttatt 1069
to top
>gb|DQ011758.1| Sus scrofa isolate L23 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1596

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1093 tcagtgagggtaagcttatt 1074
to top
>gb|DQ011757.1| Sus scrofa isolate L17 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011752.1| Sus scrofa isolate D17 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1590

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1092 tcagtgagggtaagcttatt 1073
to top
>gb|DQ011751.1| Sus scrofa isolate D7 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1593

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1090 tcagtgagggtaagcttatt 1071
to top
>gb|DQ011747.1| Sus scrofa isolate B20 endogenous virus Porcine endogenous retrovirus
            B env gene, partial sequence
          Length = 1598

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1095 tcagtgagggtaagcttatt 1076
to top
>gb|DQ011744.1| Sus scrofa isolate Y22 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011743.1| Sus scrofa isolate Y19 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011742.1| Sus scrofa isolate L21 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011741.1| Sus scrofa isolate L10 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011740.1| Sus scrofa isolate D21 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011739.1| Sus scrofa isolate D14 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011738.1| Sus scrofa isolate D10 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011737.1| Sus scrofa isolate D6 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|DQ011735.1| Sus scrofa isolate B9 endogenous virus Porcine endogenous retrovirus
            B envelope glycoprotein (env) gene, partial cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1094 tcagtgagggtaagcttatt 1075
to top
>gb|AF114170.1|AF114170 Mus musculus nucleotide-binding protein long form (Nubp1) mRNA,
          complete cds
          Length = 1276

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 83 ggcacgaggctcctcggccg 64
to top
>gb|AE003527.3| Drosophila melanogaster chromosome 3L, section 58 of 83 of the complete
              sequence
          Length = 279904

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 406    tgaagaggaagaacagcggc 425
              ||||||||||||||||||||
Sbjct: 202291 tgaagaggaagaacagcggc 202310
to top
>gb|AF014162.1|AF014162 Porcine endogenous retrovirus envelope protein (env) mRNA, complete
            cds
          Length = 1971

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  tcagtgagggtaagcttatt 325
            ||||||||||||||||||||
Sbjct: 1091 tcagtgagggtaagcttatt 1072
to top
>ref|NM_011955.1| Mus musculus nucleotide binding protein 1 (Nubp1), mRNA
          Length = 1276

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 5  ggcacgaggctcctcggccg 24
          ||||||||||||||||||||
Sbjct: 83 ggcacgaggctcctcggccg 64


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,836,999
Number of Sequences: 3902068
Number of extensions: 4836999
Number of successful extensions: 91808
Number of sequences better than 10.0: 116
Number of HSP's better than 10.0 without gapping: 116
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 91612
Number of HSP's gapped (non-prelim): 196
length of query: 507
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 485
effective length of database: 17,147,199,772
effective search space: 8316391889420
effective search space used: 8316391889420
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top