ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal12m14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR684394.2|CNS0FR12 Tetraodon nigroviridis full-length cDNA 40 3.6
2gb|L13200.4| Caenorhabditis elegans cosmid ZK1236, complete sequ... 40 3.6
3ref|XM_501708.1| Yarrowia lipolytica CLIB122, YALI0C11121g predi... 40 3.6
4ref|XM_501709.1| Yarrowia lipolytica CLIB122, YALI0C11132g predi... 40 3.6
5ref|NM_066460.3| Caenorhabditis elegans ZK1236.3 (ZK1236.3) mRNA... 40 3.6
6emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 3.6
7emb|AL928968.7| Zebrafish DNA sequence from clone CH211-103C14, ... 40 3.6

>emb|CR684394.2|CNS0FR12 Tetraodon nigroviridis full-length cDNA
          Length = 1095

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  ggacatgaagaaagagttgc 44
           ||||||||||||||||||||
Sbjct: 831 ggacatgaagaaagagttgc 850



to top

>gb|L13200.4| Caenorhabditis elegans cosmid ZK1236, complete sequence
          Length = 30790

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 210  tagcttttattgtgttgctc 229
            ||||||||||||||||||||
Sbjct: 8932 tagcttttattgtgttgctc 8913



to top

>ref|XM_501708.1| Yarrowia lipolytica CLIB122, YALI0C11121g predicted mRNA
          Length = 537

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 52  ggttgcggtcggcttctctg 71
           ||||||||||||||||||||
Sbjct: 269 ggttgcggtcggcttctctg 288



to top

>ref|XM_501709.1| Yarrowia lipolytica CLIB122, YALI0C11132g predicted mRNA
          Length = 369

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 52 ggttgcggtcggcttctctg 71
          ||||||||||||||||||||
Sbjct: 27 ggttgcggtcggcttctctg 46



to top

>ref|NM_066460.3| Caenorhabditis elegans ZK1236.3 (ZK1236.3) mRNA, complete cds
          Length = 3228

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 210  tagcttttattgtgttgctc 229
            ||||||||||||||||||||
Sbjct: 2455 tagcttttattgtgttgctc 2436



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 52      ggttgcggtcggcttctctg 71
               ||||||||||||||||||||
Sbjct: 1534859 ggttgcggtcggcttctctg 1534878



to top

>emb|AL928968.7| Zebrafish DNA sequence from clone CH211-103C14, complete sequence
          Length = 173210

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   caacagtagcttttattgtg 223
             ||||||||||||||||||||
Sbjct: 74693 caacagtagcttttattgtg 74712


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,758,741
Number of Sequences: 3902068
Number of extensions: 1758741
Number of successful extensions: 32988
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32980
Number of HSP's gapped (non-prelim): 8
length of query: 278
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 256
effective length of database: 17,147,199,772
effective search space: 4389683141632
effective search space used: 4389683141632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top