ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal12f22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK066233.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 5e-67
2dbj|AK062019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 262 5e-67
3gb|AY106213.1| Zea mays PCO107956 mRNA sequence 240 2e-60
4ref|NM_193394.1| Oryza sativa (japonica cultivar-group), predic... 232 4e-58
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 157 2e-35
6dbj|AP004258.3| Oryza sativa (japonica cultivar-group) genomic D... 157 2e-35
7dbj|AP004225.2| Oryza sativa (japonica cultivar-group) genomic D... 157 2e-35
8ref|NM_113023.3| Arabidopsis thaliana UBP7 (UBIQUITIN-SPECIFIC P... 103 3e-19
9emb|BX824727.1|CNS0A6UW Arabidopsis thaliana Full-length cDNA Co... 103 3e-19
10gb|AF302661.1|AF302661 Arabidopsis thaliana ubiquitin-specific p... 103 3e-19
11gb|BT003992.1| Arabidopsis thaliana clone RAFL15-40-P05 (R20912)... 103 3e-19
12emb|BX822226.1|CNS0A7SI Arabidopsis thaliana Full-length cDNA Co... 54 2e-04
13dbj|AB023045.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 54 2e-04
14gb|BT014436.1| Lycopersicon esculentum clone 133758F, mRNA sequence 46 0.055
15ref|NM_104049.2| Arabidopsis thaliana UBP6 (UBIQUITIN-SPECIFIC P... 44 0.22
16gb|BT011830.1| Arabidopsis thaliana At1g51710 mRNA sequence 44 0.22
17gb|BT000658.1| Arabidopsis thaliana clone RAFL07-09-J05 (R10664)... 44 0.22
18gb|AY114081.1| Arabidopsis thaliana putative ubiquitin-specific ... 44 0.22
19gb|AY050817.1| Arabidopsis thaliana putative ubiquitin-specific ... 44 0.22
20emb|BX815065.1|CNS0AD0E Arabidopsis thaliana Full-length cDNA Co... 44 0.22
21emb|BX815103.1|CNS0ACY7 Arabidopsis thaliana Full-length cDNA Co... 44 0.22
22gb|AF302660.1|AF302660 Arabidopsis thaliana ubiquitin-specific p... 44 0.22
23gb|AY084730.1| Arabidopsis thaliana clone 116145 mRNA, complete ... 44 0.22
24gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 0.85
25gb|AE007288.1| Sinorhizobium meliloti 1021 plasmid pSymA section... 42 0.85
26gb|AC102806.18| Mus musculus chromosome 3, clone RP23-341B15, co... 42 0.85
27emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 0.85
28gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 0.85
29gb|AC110183.10| Mus musculus chromosome 3, clone RP24-406M9, com... 42 0.85
30dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete ge... 42 0.85
31gb|BT020530.1| Arabidopsis thaliana At3g17000 mRNA, complete cds 40 3.4
32ref|NM_112576.2| Arabidopsis thaliana ubiquitin conjugating enzy... 40 3.4
33gb|AF386935.1|AF386935 Arabidopsis thaliana Unknown protein (K14... 40 3.4
34ref|NM_182129.2| Caenorhabditis elegans F59E12.6b (F59E12.6) mRN... 40 3.4
35ref|NM_062694.3| Caenorhabditis elegans F59E12.6a (F59E12.6) mRN... 40 3.4
36emb|BX822676.1|CNS0A64H Arabidopsis thaliana Full-length cDNA Co... 40 3.4
37emb|BX823821.1|CNS0A5CS Arabidopsis thaliana Full-length cDNA Co... 40 3.4
38emb|BX825160.1|CNS0A54S Arabidopsis thaliana Full-length cDNA Co... 40 3.4
39dbj|AB026636.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 3.4
40gb|AC006961.16|AC006961 Homo sapiens chromosome 18, clone RP11-3... 40 3.4
41gb|DQ027045.1| Arabidopsis thaliana ubiquitinating enzyme (At3g1... 40 3.4
42gb|AF003386.1| Caenorhabditis elegans cosmid F59E12, complete se... 40 3.4 
>dbj|AK066233.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013056M18, full
           insert sequence
          Length = 1835

 Score =  262 bits (132), Expect = 5e-67
 Identities = 214/240 (89%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  ccgccgcgccgccgattcgccagccatgctgacggtatgcataaaatggcagaagcaggt 80
           |||||||||||||||||||| |||||||| ||| ||| || | |||||||||||| ||  
Sbjct: 107 ccgccgcgccgccgattcgc-agccatgccgaccgtaagcgtgaaatggcagaaggagac 165

                                                                       
Query: 81  ctttccaggcatagagattgatactagccagccgcctgtggttttcaagacccagttgta 140
           ||| |||||||||||||| || || |||||||||||||| || || ||||||||| | ||
Sbjct: 166 cttcccaggcatagagatagacaccagccagccgcctgttgtctttaagacccagctata 225

                                                                       
Query: 141 cacactgactggtgtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaa 200
           ||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||
Sbjct: 226 cactctgactggtgtaccacctgaaaggcaaaaaattatggtgaagggtggaatattgaa 285

                                                                       
Query: 201 ggatgacacagattggtctactttgggactcaaagatggtcaaaagttgatgatgatagg 260
           ||||||  |||||||||||||||||||| | |||||||||||||| ||||||||||||||
Sbjct: 286 ggatgatgcagattggtctactttgggagtgaaagatggtcaaaaattgatgatgatagg 345
to top
>dbj|AK062019.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-F09, full
           insert sequence
          Length = 1629

 Score =  262 bits (132), Expect = 5e-67
 Identities = 214/240 (89%), Gaps = 1/240 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  ccgccgcgccgccgattcgccagccatgctgacggtatgcataaaatggcagaagcaggt 80
           |||||||||||||||||||| |||||||| ||| ||| || | |||||||||||| ||  
Sbjct: 34  ccgccgcgccgccgattcgc-agccatgccgaccgtaagcgtgaaatggcagaaggagac 92

                                                                       
Query: 81  ctttccaggcatagagattgatactagccagccgcctgtggttttcaagacccagttgta 140
           ||| |||||||||||||| || || |||||||||||||| || || ||||||||| | ||
Sbjct: 93  cttcccaggcatagagatagacaccagccagccgcctgttgtctttaagacccagctata 152

                                                                       
Query: 141 cacactgactggtgtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaa 200
           ||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||
Sbjct: 153 cactctgactggtgtaccacctgaaaggcaaaaaattatggtgaagggtggaatattgaa 212

                                                                       
Query: 201 ggatgacacagattggtctactttgggactcaaagatggtcaaaagttgatgatgatagg 260
           ||||||  |||||||||||||||||||| | |||||||||||||| ||||||||||||||
Sbjct: 213 ggatgatgcagattggtctactttgggagtgaaagatggtcaaaaattgatgatgatagg 272
to top
>gb|AY106213.1| Zea mays PCO107956 mRNA sequence
          Length = 1770

 Score =  240 bits (121), Expect = 2e-60
 Identities = 178/197 (90%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaatggcagaagcaggtctttccaggcatagagattgatactagccagccgcctgtggtt 123
           |||||||||||| || |||||||||||||||||||||| ||||||||||| ||  | |||
Sbjct: 79  aaatggcagaaggagctctttccaggcatagagattgacactagccagcctccgattgtt 138

                                                                       
Query: 124 ttcaagacccagttgtacacactgactggtgtaccccctgaacggcaaaaaattatggtg 183
           |||||||| |||||||||||||| |||||||| || |||||||| |||||||||||||||
Sbjct: 139 ttcaagactcagttgtacacactaactggtgtgccacctgaacgccaaaaaattatggtg 198

                                                                       
Query: 184 aagggtggaatattgaaggatgacacagattggtctactttgggactcaaagatggtcaa 243
           ||||| |||||||||||||| ||  |||||||||||||||||||| | |||||||| |||
Sbjct: 199 aagggaggaatattgaaggacgatgcagattggtctactttgggagtgaaagatggccaa 258

                            
Query: 244 aagttgatgatgatagg 260
           |||||||||||||||||
Sbjct: 259 aagttgatgatgatagg 275
to top
>ref|NM_193394.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1512

 Score =  232 bits (117), Expect = 4e-58
 Identities = 177/197 (89%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaatggcagaagcaggtctttccaggcatagagattgatactagccagccgcctgtggtt 123
           |||||||||||| ||  ||| |||||||||||||| || || |||||||||||||| || 
Sbjct: 193 aaatggcagaaggagaccttcccaggcatagagatagacaccagccagccgcctgttgtc 252

                                                                       
Query: 124 ttcaagacccagttgtacacactgactggtgtaccccctgaacggcaaaaaattatggtg 183
           || ||||||||| | ||||| |||||||||||||| |||||| |||||||||||||||||
Sbjct: 253 tttaagacccagctatacactctgactggtgtaccacctgaaaggcaaaaaattatggtg 312

                                                                       
Query: 184 aagggtggaatattgaaggatgacacagattggtctactttgggactcaaagatggtcaa 243
           |||||||||||||||||||||||  |||||||||||||||||||| | ||||||||||||
Sbjct: 313 aagggtggaatattgaaggatgatgcagattggtctactttgggagtgaaagatggtcaa 372

                            
Query: 244 aagttgatgatgatagg 260
           || ||||||||||||||
Sbjct: 373 aaattgatgatgatagg 389
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  157 bits (79), Expect = 2e-35
 Identities = 124/139 (89%)
 Strand = Plus / Minus

                                                                            
Query: 64       aaatggcagaagcaggtctttccaggcatagagattgatactagccagccgcctgtggtt 123
                |||||||||||| ||  ||| |||||||||||||| || || |||||||||||||| || 
Sbjct: 20583706 aaatggcagaaggagaccttcccaggcatagagatagacaccagccagccgcctgttgtc 20583647

                                                                            
Query: 124      ttcaagacccagttgtacacactgactggtgtaccccctgaacggcaaaaaattatggtg 183
                || ||||||||| | ||||| |||||||||||||| |||||| |||||||||||||||||
Sbjct: 20583646 tttaagacccagctatacactctgactggtgtaccacctgaaaggcaaaaaattatggtg 20583587

                                   
Query: 184      aagggtggaatattgaagg 202
                |||||||||||||||||||
Sbjct: 20583586 aagggtggaatattgaagg 20583568



 Score = 46.1 bits (23), Expect = 0.055
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 200      aggatgacacagattggtctactttgggactcaaagatg 238
                |||||||  |||||||||||||||||||| | |||||||
Sbjct: 20583466 aggatgatgcagattggtctactttgggagtgaaagatg 20583428



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                             
Query: 21       ccgccgcgccgccgattcgccagccatgc 49
                ||||||||||||||||||| |||||||||
Sbjct: 20585588 ccgccgcgccgccgattcg-cagccatgc 20585561
to top
>dbj|AP004258.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0024F24
          Length = 172642

 Score =  157 bits (79), Expect = 2e-35
 Identities = 124/139 (89%)
 Strand = Plus / Minus

                                                                         
Query: 64    aaatggcagaagcaggtctttccaggcatagagattgatactagccagccgcctgtggtt 123
             |||||||||||| ||  ||| |||||||||||||| || || |||||||||||||| || 
Sbjct: 45682 aaatggcagaaggagaccttcccaggcatagagatagacaccagccagccgcctgttgtc 45623

                                                                         
Query: 124   ttcaagacccagttgtacacactgactggtgtaccccctgaacggcaaaaaattatggtg 183
             || ||||||||| | ||||| |||||||||||||| |||||| |||||||||||||||||
Sbjct: 45622 tttaagacccagctatacactctgactggtgtaccacctgaaaggcaaaaaattatggtg 45563

                                
Query: 184   aagggtggaatattgaagg 202
             |||||||||||||||||||
Sbjct: 45562 aagggtggaatattgaagg 45544



 Score = 46.1 bits (23), Expect = 0.055
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 200   aggatgacacagattggtctactttgggactcaaagatg 238
             |||||||  |||||||||||||||||||| | |||||||
Sbjct: 45442 aggatgatgcagattggtctactttgggagtgaaagatg 45404



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                          
Query: 21    ccgccgcgccgccgattcgccagccatgc 49
             ||||||||||||||||||| |||||||||
Sbjct: 47564 ccgccgcgccgccgattcg-cagccatgc 47537
to top
>dbj|AP004225.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1156H12
          Length = 159509

 Score =  157 bits (79), Expect = 2e-35
 Identities = 124/139 (89%)
 Strand = Plus / Minus

                                                                          
Query: 64     aaatggcagaagcaggtctttccaggcatagagattgatactagccagccgcctgtggtt 123
              |||||||||||| ||  ||| |||||||||||||| || || |||||||||||||| || 
Sbjct: 107528 aaatggcagaaggagaccttcccaggcatagagatagacaccagccagccgcctgttgtc 107469

                                                                          
Query: 124    ttcaagacccagttgtacacactgactggtgtaccccctgaacggcaaaaaattatggtg 183
              || ||||||||| | ||||| |||||||||||||| |||||| |||||||||||||||||
Sbjct: 107468 tttaagacccagctatacactctgactggtgtaccacctgaaaggcaaaaaattatggtg 107409

                                 
Query: 184    aagggtggaatattgaagg 202
              |||||||||||||||||||
Sbjct: 107408 aagggtggaatattgaagg 107390



 Score = 46.1 bits (23), Expect = 0.055
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 200    aggatgacacagattggtctactttgggactcaaagatg 238
              |||||||  |||||||||||||||||||| | |||||||
Sbjct: 107288 aggatgatgcagattggtctactttgggagtgaaagatg 107250



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                           
Query: 21     ccgccgcgccgccgattcgccagccatgc 49
              ||||||||||||||||||| |||||||||
Sbjct: 109410 ccgccgcgccgccgattcg-cagccatgc 109383
to top
>ref|NM_113023.3| Arabidopsis thaliana UBP7 (UBIQUITIN-SPECIFIC PROTEASE 7);
           cysteine-type endopeptidase/ ubiquitin thiolesterase/
           ubiquitin-specific protease AT3G21280 (UBP7) mRNA,
           complete cds
          Length = 1811

 Score =  103 bits (52), Expect = 3e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 94  gagattgatactagccagccgcctgtggttttcaagacccagttgtacacactgactggt 153
           |||||||||||||||||||| ||| | ||||||||| | ||||||||     ||| ||| 
Sbjct: 247 gagattgatactagccagcctccttttgttttcaaggctcagttgtatgatttgagtgga 306

                                                                       
Query: 154 gtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaaggatgacacagat 213
           || || ||||| |||||||| || ||||| || |||||  | |||||||||||  |||||
Sbjct: 307 gttccgcctgagcggcaaaagatcatggtcaaaggtggccttttgaaggatgatgcagat 366

                                                       
Query: 214 tggtctactttgggactcaaagatggtcaaaagttgatgatgat 257
           |||||||| |||||||| ||| |||||||||| |||||||||||
Sbjct: 367 tggtctacgttgggactgaaaaatggtcaaaaattgatgatgat 410
to top
>emb|BX824727.1|CNS0A6UW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH68ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1809

 Score =  103 bits (52), Expect = 3e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 94  gagattgatactagccagccgcctgtggttttcaagacccagttgtacacactgactggt 153
           |||||||||||||||||||| ||| | ||||||||| | ||||||||     ||| ||| 
Sbjct: 248 gagattgatactagccagcctccttttgttttcaaggctcagttgtatgatttgagtgga 307

                                                                       
Query: 154 gtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaaggatgacacagat 213
           || || ||||| |||||||| || ||||| || |||||  | |||||||||||  |||||
Sbjct: 308 gttccgcctgagcggcaaaagatcatggtcaaaggtggccttttgaaggatgatgcagat 367

                                                       
Query: 214 tggtctactttgggactcaaagatggtcaaaagttgatgatgat 257
           |||||||| |||||||| ||| |||||||||| |||||||||||
Sbjct: 368 tggtctacgttgggactgaaaaatggtcaaaaattgatgatgat 411
to top
>gb|AF302661.1|AF302661 Arabidopsis thaliana ubiquitin-specific protease 7 (UBP7) gene,
           complete cds
          Length = 1587

 Score =  103 bits (52), Expect = 3e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 94  gagattgatactagccagccgcctgtggttttcaagacccagttgtacacactgactggt 153
           |||||||||||||||||||| ||| | ||||||||| | ||||||||     ||| ||| 
Sbjct: 124 gagattgatactagccagcctccttttgttttcaaggctcagttgtatgatttgagtgga 183

                                                                       
Query: 154 gtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaaggatgacacagat 213
           || || ||||| |||||||| || ||||| || |||||  | |||||||||||  |||||
Sbjct: 184 gttccgcctgagcggcaaaagatcatggtcaaaggtggccttttgaaggatgatgcagat 243

                                                       
Query: 214 tggtctactttgggactcaaagatggtcaaaagttgatgatgat 257
           |||||||| |||||||| ||| |||||||||| |||||||||||
Sbjct: 244 tggtctacgttgggactgaaaaatggtcaaaaattgatgatgat 287
to top
>gb|BT003992.1| Arabidopsis thaliana clone RAFL15-40-P05 (R20912) putative
           ubiquitin-specific protease 7 (UBP7) (At3g21280) mRNA,
           complete cds
          Length = 1685

 Score =  103 bits (52), Expect = 3e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 94  gagattgatactagccagccgcctgtggttttcaagacccagttgtacacactgactggt 153
           |||||||||||||||||||| ||| | ||||||||| | ||||||||     ||| ||| 
Sbjct: 123 gagattgatactagccagcctccttttgttttcaaggctcagttgtatgatttgagtgga 182

                                                                       
Query: 154 gtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaaggatgacacagat 213
           || || ||||| |||||||| || ||||| || |||||  | |||||||||||  |||||
Sbjct: 183 gttccgcctgagcggcaaaagatcatggtcaaaggtggccttttgaaggatgatgcagat 242

                                                       
Query: 214 tggtctactttgggactcaaagatggtcaaaagttgatgatgat 257
           |||||||| |||||||| ||| |||||||||| |||||||||||
Sbjct: 243 tggtctacgttgggactgaaaaatggtcaaaaattgatgatgat 286
to top
>emb|BX822226.1|CNS0A7SI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1357

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 94  gagattgatactagccagccgcctgtggttttcaagacccagttgta 140
           |||||||||||||||||||| ||| | ||||||||| | ||||||||
Sbjct: 103 gagattgatactagccagcctccttttgttttcaaggctcagttgta 149



 Score = 52.0 bits (26), Expect = 9e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 216 gtctactttgggactcaaagatggtcaaaagttgatgatgat 257
           |||||| |||||||| ||| |||||||||| |||||||||||
Sbjct: 228 gtctacgttgggactgaaaaatggtcaaaaattgatgatgat 269
to top
>dbj|AB023045.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8
          Length = 85599

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 94    gagattgatactagccagccgcctgtggttttcaagacccagttgta 140
             |||||||||||||||||||| ||| | ||||||||| | ||||||||
Sbjct: 63363 gagattgatactagccagcctccttttgttttcaaggctcagttgta 63317
to top
>gb|BT014436.1| Lycopersicon esculentum clone 133758F, mRNA sequence
          Length = 1301

 Score = 46.1 bits (23), Expect = 0.055
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 154 gtaccccctgaacggcaaaaaattatggtgaagggtggaatattgaaggatgacacagat 213
           ||||| |||||| ||||||| || ||||| || |||||  || ||||||||||| | |||
Sbjct: 253 gtaccacctgaaaggcaaaagataatggtcaaaggtggtttactgaaggatgacgctgat 312

                  
Query: 214 tggtcta 220
           |||||||
Sbjct: 313 tggtcta 319
to top
>ref|NM_104049.2| Arabidopsis thaliana UBP6 (UBIQUITIN-SPECIFIC PROTEASE 6);
           ubiquitin-specific protease AT1G51710 (UBP6) mRNA,
           complete cds
          Length = 1678

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 256 aaagatggtcaaaaattgatgatgat 281
to top
>gb|BT011830.1| Arabidopsis thaliana At1g51710 mRNA sequence
          Length = 1446

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 184 aaagatggtcaaaaattgatgatgat 209
to top
>gb|BT000658.1| Arabidopsis thaliana clone RAFL07-09-J05 (R10664) putative
           ubiquitin-specific protease 6 (UBP6) (At1g51710) mRNA,
           complete cds
          Length = 1689

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 257 aaagatggtcaaaaattgatgatgat 282
to top
>gb|AY114081.1| Arabidopsis thaliana putative ubiquitin-specific protease UBP6
           (At1g51710) mRNA, complete cds
          Length = 1480

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 187 aaagatggtcaaaaattgatgatgat 212
to top
>gb|AY050817.1| Arabidopsis thaliana putative ubiquitin-specific protease UBP6
           (At1g51710) mRNA, complete cds
          Length = 1659

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 252 aaagatggtcaaaaattgatgatgat 277
to top
>emb|BX815065.1|CNS0AD0E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZG04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1615

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 223 aaagatggtcaaaaattgatgatgat 248
to top
>emb|BX815103.1|CNS0ACY7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS32ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1608

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 244 aaagatggtcaaaaattgatgatgat 269
to top
>gb|AF302660.1|AF302660 Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene,
           complete cds
          Length = 1675

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 253 aaagatggtcaaaaattgatgatgat 278
to top
>gb|AY084730.1| Arabidopsis thaliana clone 116145 mRNA, complete sequence
          Length = 1658

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 232 aaagatggtcaaaagttgatgatgat 257
           |||||||||||||| |||||||||||
Sbjct: 256 aaagatggtcaaaaattgatgatgat 281
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 21     ccgccgcgccgccgattcgcc 41
              |||||||||||||||||||||
Sbjct: 821964 ccgccgcgccgccgattcgcc 821984
to top
>gb|AE007288.1| Sinorhizobium meliloti 1021 plasmid pSymA section 94 of 121 of the
            complete plasmid sequence
          Length = 10943

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 13   ccaccgntccgccgcgccgccgat 36
            |||||| |||||||||||||||||
Sbjct: 3210 ccaccgatccgccgcgccgccgat 3233
to top
>gb|AC102806.18| Mus musculus chromosome 3, clone RP23-341B15, complete sequence
          Length = 229984

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 231    caaagatggtcaaaagttgat 251
              |||||||||||||||||||||
Sbjct: 200450 caaagatggtcaaaagttgat 200430
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 21      ccgccgcgccgccgattcgcc 41
               |||||||||||||||||||||
Sbjct: 2142192 ccgccgcgccgccgattcgcc 2142212
to top
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 21      ccgccgcgccgccgattcgcc 41
               |||||||||||||||||||||
Sbjct: 1715459 ccgccgcgccgccgattcgcc 1715479
to top
>gb|AC110183.10| Mus musculus chromosome 3, clone RP24-406M9, complete sequence
          Length = 171452

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 231    caaagatggtcaaaagttgat 251
              |||||||||||||||||||||
Sbjct: 170111 caaagatggtcaaaagttgat 170131
to top
>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome
          Length = 3630528

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 56     tatgcataaaatggcagaagc 76
              |||||||||||||||||||||
Sbjct: 137451 tatgcataaaatggcagaagc 137471
to top
>gb|BT020530.1| Arabidopsis thaliana At3g17000 mRNA, complete cds
          Length = 930

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 466 cctgaacggcaaaaaattat 485
to top
>ref|NM_112576.2| Arabidopsis thaliana ubiquitin conjugating enzyme AT3G17000 mRNA,
           complete cds
          Length = 1263

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 583 cctgaacggcaaaaaattat 602
to top
>gb|AF386935.1|AF386935 Arabidopsis thaliana Unknown protein (K14A17.7) mRNA, complete cds
          Length = 1194

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 582 cctgaacggcaaaaaattat 601
to top
>ref|NM_182129.2| Caenorhabditis elegans F59E12.6b (F59E12.6) mRNA, complete cds
          Length = 1516

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 237  tggtcaaaagttgatgatgatagg 260
            ||||||||| ||||||||||||||
Sbjct: 1082 tggtcaaaatttgatgatgatagg 1105
to top
>ref|NM_062694.3| Caenorhabditis elegans F59E12.6a (F59E12.6) mRNA, complete cds
          Length = 2601

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 237  tggtcaaaagttgatgatgatagg 260
            ||||||||| ||||||||||||||
Sbjct: 1325 tggtcaaaatttgatgatgatagg 1348
to top
>emb|BX822676.1|CNS0A64H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1158

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 515 cctgaacggcaaaaaattat 534
to top
>emb|BX823821.1|CNS0A5CS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS7ZD11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 528 cctgaacggcaaaaaattat 547
to top
>emb|BX825160.1|CNS0A54S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL17ZE04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1195

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 547 cctgaacggcaaaaaattat 566
to top
>dbj|AB026636.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17
          Length = 92620

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   cctgaacggcaaaaaattat 179
             ||||||||||||||||||||
Sbjct: 30286 cctgaacggcaaaaaattat 30305
to top
>gb|AC006961.16|AC006961 Homo sapiens chromosome 18, clone RP11-31P16, complete sequence
          Length = 171419

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 80   tctttccaggcatagagatt 99
            ||||||||||||||||||||
Sbjct: 3290 tctttccaggcatagagatt 3309
to top
>gb|DQ027045.1| Arabidopsis thaliana ubiquitinating enzyme (At3g17000) mRNA,
           complete cds
          Length = 822

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 160 cctgaacggcaaaaaattat 179
           ||||||||||||||||||||
Sbjct: 466 cctgaacggcaaaaaattat 485
to top
>gb|AF003386.1| Caenorhabditis elegans cosmid F59E12, complete sequence
          Length = 42430

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tggtcaaaagttgatgatgatagg 260
             ||||||||| ||||||||||||||
Sbjct: 10245 tggtcaaaatttgatgatgatagg 10222


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,425,195
Number of Sequences: 3902068
Number of extensions: 2425195
Number of successful extensions: 45387
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45075
Number of HSP's gapped (non-prelim): 310
length of query: 260
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 238
effective length of database: 17,147,199,772
effective search space: 4081033545736
effective search space used: 4081033545736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top