ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal11i18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463609.1| Oryza sativa (japonica cultivar-group), predic... 521 e-145
2dbj|AK064782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 521 e-145
3gb|AY466159.1| Zea mays DEAD box RNA helicase (DRH1) mRNA, compl... 458 e-125
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
5dbj|AP003416.4| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
6dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
7ref|NM_125706.2| Arabidopsis thaliana ATP binding / ATP-dependen... 103 7e-19
8ref|NM_203256.1| Arabidopsis thaliana ATP binding / ATP-dependen... 103 7e-19
9gb|BT000610.1| Arabidopsis thaliana AtP-dependent RNA helicase-l... 103 7e-19
10gb|AY060589.1| Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, comp... 103 7e-19
11emb|BX832051.1|CNS09YVO Arabidopsis thaliana Full-length cDNA Co... 92 3e-15
12dbj|AB008265.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 92 3e-15
13ref|NM_004396.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypep... 66 1e-07
14ref|XM_512004.1| PREDICTED: Pan troglodytes DEAD (Asp-Glu-Ala-As... 66 1e-07
15gb|BC016027.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti... 66 1e-07
16ref|XM_448941.1| Candida glabrata CBS138, CAGL0L03846 partial mRNA 66 1e-07
17emb|X52104.1|HSP68A Human mRNA for p68 protein 66 1e-07
18emb|X15729.1|HSNP68M Human mRNA for nuclear p68 protein 66 1e-07
19emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 66 1e-07
20emb|BX571764.1|HSM806634 Homo sapiens mRNA; cDNA DKFZp686J01190 ... 66 1e-07
21gb|BT007642.1| Synthetic construct Homo sapiens DEAD/H (Asp-Glu-... 66 1e-07
22gb|BT006943.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 66 1e-07
23emb|CR607012.1| full-length cDNA clone CS0DA009YD21 of Neuroblas... 66 1e-07
24gb|AC138744.4| Homo sapiens chromosome 17, clone RP11-859E19, co... 66 1e-07
25gb|AY892740.1| Synthetic construct Homo sapiens clone FLH024742.... 66 1e-07
26gb|AY890256.1| Synthetic construct Homo sapiens clone FLH024746.... 66 1e-07
27gb|AY890255.1| Synthetic construct Homo sapiens clone FLH024745.... 66 1e-07
28gb|AF015812.1|AF015812 Homo sapiens RNA helicase p68 (HUMP68) ge... 66 1e-07
29dbj|AB209919.1| Homo sapiens mRNA for Hypothetical protein DKFZp... 66 1e-07
30gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, com... 66 1e-07
31emb|AJ010476.1|ATH010476 Arabidopsis thaliana mRNA for DEAD box ... 64 6e-07
32gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome... 64 6e-07
33gb|AF479823.1| Pantodon buchholzi DEAD box RNA helicase Vasa mRN... 64 6e-07
34dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 64 6e-07
35gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 64 6e-07
36gb|BT012961.1| Lycopersicon esculentum clone 114151R, mRNA sequence 60 9e-06
37emb|CR861259.1| Pongo pygmaeus mRNA; cDNA DKFZp459M043 (from clo... 58 4e-05
38ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 1e-04
39ref|XM_502093.1| Yarrowia lipolytica CLIB122, YALI0C21472g predi... 56 1e-04
40emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 56 1e-04
41gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 56 1e-04
42ref|NM_188251.1| Oryza sativa (japonica cultivar-group), predic... 54 6e-04
43gb|BT016697.1| Zea mays clone Contig530 mRNA sequence 54 6e-04
44gb|AY587260.1| Sparus aurata vasa-like protein mRNA, partial cds 54 6e-04
45gb|AF520608.1| Sparus aurata vasa-like mRNA, partial cds 54 6e-04
46gb|DQ399799.1| Acanthopagrus schlegelii vasa protein mRNA, parti... 54 6e-04
47dbj|AP003200.4| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
48dbj|AP003244.3| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
49dbj|AK068197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
50dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone... 54 6e-04
51ref|NM_104388.2| Arabidopsis thaliana ATP binding / ATP-dependen... 52 0.002
52ref|XR_002773.1| PREDICTED: Mus musculus hypothetical protein LO... 52 0.002
53emb|X52648.1|SPP68 Schizosaccharomyces pombe p68 gene for p68 pr... 52 0.002
54emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chro... 52 0.002
55emb|AL032684.1|SPBP8B7 S.pombe chromosome II p1 p8B7 52 0.002
56ref|NM_204708.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polype... 52 0.002
57gb|AY128786.1| Arabidopsis thaliana unknown protein (At1g55150) ... 52 0.002
58gb|AY062745.1| Arabidopsis thaliana Unknown protein (At1g55150; ... 52 0.002
59ref|NM_001022444.1| Schizosaccharomyces pombe 972h- hypothetical... 52 0.002
60emb|BX813460.1|CNS0AC9L Arabidopsis thaliana Full-length cDNA Co... 52 0.002
61gb|AC073944.6|AC073944 Arabidopsis thaliana chromosome 1 BAC T7N... 52 0.002
62emb|AJ010936.1|HSA010936 Homo sapiens ddx5-ps1 gene, partial 52 0.002
63gb|AF096248.1|AF096248 Lycopersicon esculentum ethylene-responsi... 52 0.002
64gb|L11574.1|YSPP68DBP Schizosaccharomyces pombe p68 RNA helicase... 52 0.002
65dbj|AB004836.1| Gallus gallus mRNA for Cvh, complete cds 52 0.002
66ref|NM_111523.2| Arabidopsis thaliana ATP binding / ATP-dependen... 50 0.009
67emb|CR954247.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 50 0.009
68gb|AC011623.5|ATAC011623 Arabidopsis thaliana chromosome III BAC... 50 0.009
69ref|XM_550287.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.034
70ref|XM_550286.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.034
71gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 48 0.034
72gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete... 48 0.034
73ref|XM_855709.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
74ref|XM_855680.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
75ref|XM_855640.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
76ref|XM_845027.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
77ref|XM_855575.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
78ref|XM_531736.2| PREDICTED: Canis familiaris similar to Probable... 48 0.034
79ref|XM_855514.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
80ref|XM_855481.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
81ref|XM_855444.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
82ref|XM_855416.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
83ref|XM_855385.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
84ref|XM_855349.1| PREDICTED: Canis familiaris similar to Probable... 48 0.034
85ref|XM_504478.1| Yarrowia lipolytica CLIB122, YALI0E27715g predi... 48 0.034
86ref|NM_165103.2| Drosophila melanogaster vasa CG3506-RA (vas), mRNA 48 0.034
87gb|AY084126.1| Drosophila melanogaster RE20606 full insert cDNA 48 0.034
88gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35... 48 0.034
89gb|AE009543.1| Brucella melitensis 16M chromosome I, section 100... 48 0.034
90dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.034
91gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 48 0.034
92ref|XM_320481.2| Anopheles gambiae str. PEST ENSANGP00000015773 ... 48 0.034
93dbj|AK100326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.034
94gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55... 48 0.034
95gb|AY786204.1| Monopterus albus DEAD box RNA helicase-PL10B mRNA... 48 0.034
96emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 48 0.034
97emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 48 0.034
98emb|X12946.1|DMVASA2 D.melanogaster vasa gene (exons 3 to 7) 48 0.034
99gb|M23560.1|DROVASA D.melanogaster antigen Mab46F11 (vasa) mRNA,... 48 0.034
100gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 46 0.14
101emb|CR628336.1| Legionella pneumophila str. Paris complete genome 46 0.14
102emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 46 0.14
103dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 46 0.14
104gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 46 0.14
105gb|BC086320.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.53
106ref|NM_001016781.2| Xenopus tropicalis hypothetical protein LOC5... 44 0.53
107gb|BC084159.1| Xenopus tropicalis cDNA clone IMAGE:7016603 44 0.53
108gb|BC080992.1| Xenopus laevis hypothetical protein LOC398649, mR... 44 0.53
109gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome 44 0.53
110ref|NM_007840.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep... 44 0.53
111gb|BC054236.1| Xenopus laevis hypothetical protein LOC398649, mR... 44 0.53
112gb|BC062916.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.53
113ref|XM_946895.1| Theileria annulata strain Ankara ATP-dependent ... 44 0.53
114emb|X65627.1|MMHELI M.musculus mRNA TNZ2 for p68 RNA helicase 44 0.53
115dbj|AK129022.1| Mus musculus cDNA fis, clone TRACH3036683, highl... 44 0.53
116gb|AF479821.1| Hyphessobrycon ecuadoriensis DEAD box RNA helicas... 44 0.53
117dbj|AK132779.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.53
118dbj|AK135173.1| Mus musculus 12 days embryo female ovary cDNA, R... 44 0.53
119dbj|AK166698.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 44 0.53
120dbj|AK166045.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 44 0.53
121dbj|AK088887.1| Mus musculus 2 days neonate thymus thymic cells ... 44 0.53
122gb|DQ336393.1| Elephas maximus DEAD/H box polypeptide (DBY) gene... 44 0.53
123dbj|AK044792.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 44 0.53
124dbj|AK076018.1| Mus musculus 10 days embryo whole body cDNA, RIK... 44 0.53
125ref|XM_392069.2| PREDICTED: Apis mellifera similar to ENSANGP000... 44 0.53
126gb|AY730697.1| Nematostella vectensis DEAD box helicase Vasa2 (V... 44 0.53
127ref|NM_001007613.1| Rattus norvegicus ddx5 gene (Ddx5), mRNA 44 0.53
128gb|BC079036.1| Rattus norvegicus ddx5 gene, mRNA (cDNA clone MGC... 44 0.53
129emb|AJ010940.1|RNO010940 Rattus norvegicus ddx5-ps1 pseudogene, ... 44 0.53
130emb|CR855694.2| Xenopus tropicalis finished cDNA, clone TGas068f07 44 0.53
131gb|BC046554.1| Mus musculus cDNA clone IMAGE:4973650 44 0.53
132gb|BC108369.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 44 0.53
133gb|AC149403.2| Phakopsora pachyrhizi clone JGIAFNA-61H19, comple... 42 2.1
134gb|AY391418.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid... 42 2.1
135gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 42 2.1
136ref|XM_629763.1| Dictyostelium discoideum hypothetical protein (... 42 2.1
137ref|NM_212612.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypept... 42 2.1
138gb|BC082849.1| Xenopus laevis p68 RNA helicase, mRNA (cDNA clone... 42 2.1
139gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 sect... 42 2.1
140gb|BC063223.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box pol... 42 2.1
141ref|XM_361961.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 2.1
142gb|DQ441593.1| Odontesthes hatcheri vasa-like protein mRNA, part... 42 2.1
143gb|AE009952.1| Yersinia pestis KIM, complete genome 42 2.1
144ref|XM_456137.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F23716g ... 42 2.1
145gb|BC067585.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid... 42 2.1
146gb|AC165060.2| Phakopsora pachyrhizi clone JGIAFNA-205B5, comple... 42 2.1
147gb|BC047981.1| Xenopus laevis similar to DEAD/H (Asp-Glu-Ala-Asp... 42 2.1
148ref|XM_719206.1| Plasmodium yoelii yoelii str. 17XNL U5 snRNP 10... 42 2.1
149gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 42 2.1
150ref|XM_967408.1| PREDICTED: Tribolium castaneum similar to DEAD ... 42 2.1
151emb|Z71388.1|SCYNL112W S.cerevisiae chromosome XIV reading frame... 42 2.1
152emb|Z69382.1|SCCXIV38K S.cerevisiae 37,800 bp segment of chromos... 42 2.1
153emb|X52649.1|SCP68 S.cerevisiae p68 gene 42 2.1
154emb|CR628337.1| Legionella pneumophila str. Lens complete genome 42 2.1
155emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 42 2.1
156emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 42 2.1
157emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 42 2.1
158ref|NM_203898.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box p... 42 2.1
159emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; seg... 42 2.1
160emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in... 42 2.1
161dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 42 2.1
162gb|CP000249.1| Frankia sp. CcI3, complete genome 42 2.1
163dbj|AB169223.1| Macaca fascicularis testis cDNA, clone: QtsA-181... 42 2.1
164dbj|AB169157.1| Macaca fascicularis testis cDNA, clone: QtsA-176... 42 2.1
165gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 42 2.1
166gb|AF218580.1|AF218580 Xenopus laevis p68 RNA helicase mRNA, com... 42 2.1
167ref|NM_065859.3| Caenorhabditis elegans F01F1.7 (F01F1.7) mRNA, ... 42 2.1
168gb|AY960203.1| Odontesthes bonariensis Vasa-like protein mRNA, p... 42 2.1
169dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 42 2.1
170dbj|AB051835.1| Oreochromis niloticus vas-s mRNA for vasa short ... 42 2.1
171dbj|AB032467.1| Oreochromis niloticus mRNA for vasa, complete cds 42 2.1
172emb|BX085195.5| Zebrafish DNA sequence from clone DKEY-226A5 in ... 42 2.1
173gb|AY110750.1| Zea mays CL9052_1 mRNA sequence 42 2.1
174emb|CR848548.2| Xenopus tropicalis finished cDNA, clone TEgg028e13 42 2.1
175gb|U13070.1| Caenorhabditis elegans cosmid F01F1, complete sequence 42 2.1
176gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete ge... 42 2.1
177gb|AC154130.1| Tribolium castaneum BAC T.cast_C11O3 (Clemson Un... 40 8.3
178gb|AF510054.1| Schistocerca gregaria vasa-like gene, partial cds 40 8.3
179ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (... 40 8.3
180ref|NM_177069.2| Mus musculus RIKEN cDNA E330009P21 gene (E33000... 40 8.3
181gb|AY723847.1| Saccharomyces cerevisiae clone FLH004944.01X YLR2... 40 8.3
182ref|XM_613184.2| PREDICTED: Bos taurus similar to Probable RNA-d... 40 8.3
183gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRN... 40 8.3
184ref|NM_026360.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep... 40 8.3
185ref|NM_175214.3| Mus musculus kinesin family member 27 (Kif27), ... 40 8.3
186ref|XM_705616.1| Candida albicans SC5314 putative nonsense-media... 40 8.3
187ref|XM_705602.1| Candida albicans SC5314 putative nonsense-media... 40 8.3
188ref|XM_816398.1| Trypanosoma cruzi strain CL Brener ATP-dependen... 40 8.3
189gb|BC060168.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.3
190ref|XM_651823.1| Entamoeba histolytica HM-1:IMSS DEAD/DEAH box h... 40 8.3
191ref|XM_759104.1| Theileria parva strain Muguga chromosome 4 RNA ... 40 8.3
192gb|AC136842.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.3
193gb|AY274092.1| Coccyzus erythropthalmus phosphoenolpyruvate carb... 40 8.3
194emb|AL450389.12| Human DNA sequence from clone RP5-929G5 on chro... 40 8.3
195gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 8.3
196ref|XM_505193.1| Yarrowia lipolytica CLIB122, YALI0F09141g predi... 40 8.3
197emb|CR388143.6| Zebrafish DNA sequence from clone DKEY-189O20 in... 40 8.3
198gb|AE008734.1| Salmonella typhimurium LT2, section 42 of 220 of ... 40 8.3
199gb|BC099397.1| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cD... 40 8.3
200emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 40 8.3
201emb|AL627268.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 8.3
202emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A stra... 40 8.3
203gb|BC095944.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.3
204emb|BX647482.1|HSM807628 Homo sapiens genomic DNA; cDNA DKFZp686... 40 8.3
205emb|AJ719824.1| Gallus gallus mRNA for hypothetical protein, clo... 40 8.3
206ref|NM_001007853.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box pol... 40 8.3
207gb|AC105094.6| Homo sapiens chromosome 18, clone RP11-1096D5, co... 40 8.3
208gb|AC110997.4| Homo sapiens chromosome 18, clone RP11-56J20, com... 40 8.3
209dbj|AK136136.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.3
210dbj|AK135949.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 40 8.3
211gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, comp... 40 8.3
212gb|L80215.1|HUM69DC8Z Homo sapiens (subclone 1_a7 from P1 H69) D... 40 8.3
213ref|NM_199036.1| Mus musculus F-box and WD-40 domain protein 15 ... 40 8.3
214gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.3
215dbj|AK010310.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 8.3
216gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosom... 40 8.3
217dbj|AK087902.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.3
218gb|DQ067445.1| Mus musculus early ovarian protein-1 (Eop1) mRNA,... 40 8.3
219dbj|AK087710.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.3
220dbj|AK087669.1| Mus musculus 2 days pregnant adult female ovary ... 40 8.3
221gb|BC103318.1| Bos taurus cDNA clone IMAGE:7941432, partial cds 40 8.3
222dbj|AK076982.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 8.3
223ref|NM_001039431.1| Tribolium castaneum vasa RNA helicase (vasa)... 40 8.3
224tpg|BK001056.1| TPA: TPA_exp: Mus musculus kinesin-related prote... 40 8.3
225gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 8.3
226gb|AC147286.3| Pan troglodytes BAC clone RP43-75F15 from chromos... 40 8.3
227gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 8.3
228gb|AF188678.1|AF188678 Pisum sativum P72 DEAD box protein mRNA, ... 40 8.3
229dbj|AK196692.1| Mus musculus cDNA, clone:Y1G0122J24, strand:plus... 40 8.3
230dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 8.3
231emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chr... 40 8.3
232gb|AC005534.2|AC005534 Homo sapiens PAC clone RP5-982E9 from 7q3... 40 8.3
233gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, comple... 40 8.3
234gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 8.3
235emb|AJ010934.1|RNO010934 Rattus norvegicus ddx5 gene, exons 2 to... 40 8.3
236gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 8.3
237gb|AY887136.1| Tribolium castaneum vasa RNA helicase mRNA, compl... 40 8.3
238gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, comple... 40 8.3
239gb|U17245.1|YSCL9328 Saccharomyces cerevisiae chromosome XII cos... 40 8.3
240emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 8.3
241gb|L81906.1|HSL81906 Homo sapiens (subclone 2_f8 from P1 H69) DN... 40 8.3
242gb|AC001214.1|HSAC001214 Homo sapiens (subclone 1_a7 from P1 H69... 40 8.3
243emb|AL606529.9| Human DNA sequence from clone RP4-744B2 on chrom... 40 8.3
244emb|X94313.1|MMHLR1 M.musculus Hlr1 gene 40 8.3
245dbj|D86601.1| Bombyx mori BmVLG mRNA, complete cds 40 8.3
246dbj|AB048845.1| Aurelia aurita mRNA for PL10-related protein CnP... 40 8.3
247emb|AL603664.16| Mouse DNA sequence from clone RP23-247J12 on ch... 40 8.3

>ref|XM_463609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1443

 Score =  521 bits (263), Expect = e-145
 Identities = 515/599 (85%)
 Strand = Plus / Plus

                                                                       
Query: 14  gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 73
           ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 364 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 423

                                                                       
Query: 74  cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 133
           || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 424 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 483

                                                                       
Query: 134 aactttccagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcct 193
           ||||| ||||||||||| |||||||| || ||||||   ||||| || ||||| ||||||
Sbjct: 484 aacttcccagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcct 543

                                                                       
Query: 194 atccaagctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaa 253
           || ||  | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||
Sbjct: 544 attcagtcacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaa 603

                                                                       
Query: 254 actggatctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaa 313
           ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| 
Sbjct: 604 actggctctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacag 663

                                                                       
Query: 314 cctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactg 373
           |||||||| |||||||||||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 664 cctcgactagaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactg 723

                                                                       
Query: 374 gctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactagaagcaca 433
           ||||||||||||||   |||| ||   || |||||||||||||| |||||||||||||| 
Sbjct: 724 gctgttcaaatacaacaagaatctggcaaatttggatcatactcaagaactagaagcact 783

                                                                       
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaa 493
           |||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 784 tgtatctatggtggagcacctaagggaccacaaatacgtgaccttaggagaggggttgag 843

                                                                       
Query: 494 atcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacacaaaccta 553
           || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| ||||| 
Sbjct: 844 attgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacactaacctg 903

                                                                      
Query: 554 cgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
           ||  | || |||||||| || ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 904 cgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggttttga 962



to top

>dbj|AK064782.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B12, full
            insert sequence
          Length = 3413

 Score =  521 bits (263), Expect = e-145
 Identities = 515/599 (85%)
 Strand = Plus / Plus

                                                                        
Query: 14   gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 73
            ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 510  gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 569

                                                                        
Query: 74   cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 133
            || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 570  cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 629

                                                                        
Query: 134  aactttccagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcct 193
            ||||| ||||||||||| |||||||| || ||||||   ||||| || ||||| ||||||
Sbjct: 630  aacttcccagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcct 689

                                                                        
Query: 194  atccaagctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaa 253
            || ||  | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||
Sbjct: 690  attcagtcacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaa 749

                                                                        
Query: 254  actggatctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaa 313
            ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| 
Sbjct: 750  actggctctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacag 809

                                                                        
Query: 314  cctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactg 373
            |||||||| |||||||||||||||||||||||  ||||||||||||| ||||||||||||
Sbjct: 810  cctcgactagaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactg 869

                                                                        
Query: 374  gctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactagaagcaca 433
            ||||||||||||||   |||| ||   || |||||||||||||| |||||||||||||| 
Sbjct: 870  gctgttcaaatacaacaagaatctggcaaatttggatcatactcaagaactagaagcact 929

                                                                        
Query: 434  tgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaa 493
            |||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| 
Sbjct: 930  tgtatctatggtggagcacctaagggaccacaaatacgtgaccttaggagaggggttgag 989

                                                                        
Query: 494  atcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacacaaaccta 553
            || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| ||||| 
Sbjct: 990  attgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacactaacctg 1049

                                                                       
Query: 554  cgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
            ||  | || |||||||| || ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 1050 cgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggttttga 1108



to top

>gb|AY466159.1| Zea mays DEAD box RNA helicase (DRH1) mRNA, complete cds
          Length = 2214

 Score =  458 bits (231), Expect = e-125
 Identities = 423/485 (87%), Gaps = 4/485 (0%)
 Strand = Plus / Plus

                                                                        
Query: 128  gaagccaactttccagattactgcatgcaagcgatcgccaagtccggatttgtggagcca 187
            ||||||||||| |||||||||||||||||||| || ||||| || |||||||||||||||
Sbjct: 554  gaagccaacttcccagattactgcatgcaagctattgccaa-tctggatttgtggagcca 612

                                                                        
Query: 188  acgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgattggtatt 247
            || ||||| ||| |||| |||||||| |||   |||||||| |||||| |||||||||| 
Sbjct: 613  acacctattcaatctcaaggttggcctatg---ttgaagggtagggacctgattggtatc 669

                                                                        
Query: 248  gcagaaactggatctgggaaaacactatcttacatactacctggtttggttcatgttggt 307
            ||  |||| || || ||||||||| |||||||  |  |||||||  ||||||||||||||
Sbjct: 670  gctcaaacaggctcagggaaaacattatcttatctgttacctgggctggttcatgttggt 729

                                                                        
Query: 308  gcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctccaacaaga 367
            || || ||||| || |||||||| |||||||||||||| || || || ||||| ||||||
Sbjct: 730  gcccagcctcggctagaacaaggcgatggcccaattgtattaattctcgctcccacaaga 789

                                                                        
Query: 368  gaactggctgttcaaatacaggcagaagctacaaagtttggatcatactcgagaactaga 427
            |||||||||||||||||||||| |||| ||||||| ||||||||||| || |||||||||
Sbjct: 790  gaactggctgttcaaatacaggaagaatctacaaaatttggatcatattcaagaactaga 849

                                                                        
Query: 428  agcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggagagga 487
            ||||||||| |||| ||||| ||||||||||| ||||||||||| ||||| || ||||||
Sbjct: 850  agcacatgtgtctatggtggtgcacctaagggtccacaaatacgggaccttagaagagga 909

                                                                        
Query: 488  gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 547
            |||||||| ||||||||||| || || |||||||||||||||||||||||||||||||||
Sbjct: 910  gttgaaattgtcattgcaactcctggccggttgattgatatgctggaagctggtcacaca 969

                                                                        
Query: 548  aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 607
            ||||||||| | || |||||||||||| |||||||||| ||||| ||||| |||||||| 
Sbjct: 970  aacctacgtagagtgacataccttgtgttggatgaggctgaccggatgctagatatgggg 1029

                 
Query: 608  tttga 612
            |||||
Sbjct: 1030 tttga 1034



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  206 bits (104), Expect = 6e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                            
Query: 323      gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 382
                |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 39684703 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 39684644

                                                                            
Query: 383      atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 442
                |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 39684643 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 39684584

                                                            
Query: 443      ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 486
                ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 39684583 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 39684540



 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                            
Query: 141      cagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcctatccaag 200
                |||||||||| |||||||| || ||||||   ||||| || ||||| |||||||| ||  
Sbjct: 39684965 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 39684906

                                                                            
Query: 201      ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 260
                | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 39684905 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 39684846

                                                                            
Query: 261      ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 320
                |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 39684845 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 39684786

                 
Query: 321      t 321
                |
Sbjct: 39684785 t 39684785



 Score =  113 bits (57), Expect = 7e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                            
Query: 488      gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 547
                ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 39684463 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 39684404

                                                                            
Query: 548      aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 607
                ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 39684403 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 39684344

                     
Query: 608      tttga 612
                |||||
Sbjct: 39684343 tttga 39684339



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                            
Query: 14       gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 73
                ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 39685208 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 39685149

                                                                            
Query: 74       cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 133
                || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 39685148 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 39685089

                          
Query: 134      aactttccag 143
                ||||| ||||
Sbjct: 39685088 aacttcccag 39685079



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 73      ccgggatatcaccgtggagggccgggaggtgcccaagcc 111
               |||||| ||||||||||||||||| || |||||||||||
Sbjct: 5249657 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 5249619



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 578     gatgaggcagaccgtatgctcgatatgggttttgaa 613
               |||||||||||||| ||||| |||||||| ||||||
Sbjct: 5248026 gatgaggcagaccggatgctggatatgggctttgaa 5247991



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                           
Query: 569     cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
               ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 3715154 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 3715111



to top

>dbj|AP003416.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0456E05
          Length = 173699

 Score =  206 bits (104), Expect = 6e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                          
Query: 323    gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 382
              |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 165659 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 165600

                                                                          
Query: 383    atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 442
              |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 165599 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 165540

                                                          
Query: 443    ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 486
              ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 165539 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 165496



 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                          
Query: 141    cagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcctatccaag 200
              |||||||||| |||||||| || ||||||   ||||| || ||||| |||||||| ||  
Sbjct: 165921 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 165862

                                                                          
Query: 201    ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 260
              | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 165861 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 165802

                                                                          
Query: 261    ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 320
              |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 165801 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 165742

               
Query: 321    t 321
              |
Sbjct: 165741 t 165741



 Score =  113 bits (57), Expect = 7e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                          
Query: 488    gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 547
              ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 165419 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 165360

                                                                          
Query: 548    aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 607
              ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 165359 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 165300

                   
Query: 608    tttga 612
              |||||
Sbjct: 165299 tttga 165295



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                          
Query: 14     gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 73
              ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 166164 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 166105

                                                                          
Query: 74     cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 133
              || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 166104 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 166045

                        
Query: 134    aactttccag 143
              ||||| ||||
Sbjct: 166044 aacttcccag 166035



to top

>dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0470A12
          Length = 185095

 Score =  206 bits (104), Expect = 6e-50
 Identities = 149/164 (90%)
 Strand = Plus / Minus

                                                                         
Query: 323   gaacaaggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaa 382
             |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||
Sbjct: 35602 gaacaaggtgatggcccaattgttctgatccttgctcctacaagagaactggctgttcaa 35543

                                                                         
Query: 383   atacaggcagaagctacaaagtttggatcatactcgagaactagaagcacatgtatctac 442
             |||||   |||| ||   || |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 35542 atacaacaagaatctggcaaatttggatcatactcaagaactagaagcacttgtatctat 35483

                                                         
Query: 443   ggtggagcacctaagggaccacaaatacgtgacctcaggagagg 486
             ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 35482 ggtggagcacctaagggaccacaaatacgtgaccttaggagagg 35439



 Score =  161 bits (81), Expect = 3e-36
 Identities = 156/181 (86%)
 Strand = Plus / Minus

                                                                         
Query: 141   cagattactgcatgcaagcgatcgccaagtccggatttgtggagccaacgcctatccaag 200
             |||||||||| |||||||| || ||||||   ||||| || ||||| |||||||| ||  
Sbjct: 35864 cagattactgtatgcaagcaatagccaagagtggattcgtagagcccacgcctattcagt 35805

                                                                         
Query: 201   ctcagggttggccgatggctttgaagggcagggacgtgattggtattgcagaaactggat 260
             | || |||||||| ||||||||||||||||||||| |||| ||||| ||| ||||||| |
Sbjct: 35804 cacaaggttggccaatggctttgaagggcagggacatgatcggtatcgcacaaactggct 35745

                                                                         
Query: 261   ctgggaaaacactatcttacatactacctggtttggttcatgttggtgcacaacctcgac 320
             |||||||||||||||||||| | || ||||| |||||||||||||||||||| |||||||
Sbjct: 35744 ctgggaaaacactatcttaccttctccctgggttggttcatgttggtgcacagcctcgac 35685

              
Query: 321   t 321
             |
Sbjct: 35684 t 35684



 Score =  113 bits (57), Expect = 7e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                         
Query: 488   gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 547
             ||||| || |||||||||||||| ||||||||||| ||||||||||||| ||||||||| 
Sbjct: 35362 gttgagattgtcattgcaacacctggtcggttgatcgatatgctggaaggtggtcacact 35303

                                                                         
Query: 548   aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 607
             ||||| ||  | || |||||||| || ||||||||||| ||||| ||||| || ||||||
Sbjct: 35302 aacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgcttgacatgggt 35243

                  
Query: 608   tttga 612
             |||||
Sbjct: 35242 tttga 35238



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                         
Query: 14    gtggaatgccccgccgtgcaggccatgtcggagacggaggtggcgcagtaccgtcagctc 73
             ||||| ||||||||||||||||||||||| || | ||| ||| ||||||| ||||  |  
Sbjct: 36107 gtggagtgccccgccgtgcaggccatgtcagacatggatgtgtcgcagtatcgtcgccag 36048

                                                                         
Query: 74    cgggatatcaccgtggagggccgggaggtgcccaagcctatccgcttcttccatgaagcc 133
             || |||||||| || || ||||  || |||||||||||  | |||| |||||| || |||
Sbjct: 36047 cgtgatatcactgttgaaggccacgacgtgcccaagccggttcgctacttccaggaggcc 35988

                       
Query: 134   aactttccag 143
             ||||| ||||
Sbjct: 35987 aacttcccag 35978



to top

>ref|NM_125706.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G63120 transcript
           variant AT5G63120.1 mRNA, complete cds
          Length = 2372

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 182 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 241
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 753 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 812

                                                                       
Query: 242 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 301
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 813 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 872

                                                                       
Query: 302 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 361
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 873 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 932

                               
Query: 362 acaagagaactggctgttca 381
           ||||||||||| ||||||||
Sbjct: 933 acaagagaactagctgttca 952



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 424  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 483
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 995  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1054

                                                                
Query: 484  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 535
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1055 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1106



to top

>ref|NM_203256.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G63120 transcript
           variant AT5G63120.2 mRNA, complete cds
          Length = 2185

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 182 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 241
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 753 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 812

                                                                       
Query: 242 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 301
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 813 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 872

                                                                       
Query: 302 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 361
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 873 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 932

                               
Query: 362 acaagagaactggctgttca 381
           ||||||||||| ||||||||
Sbjct: 933 acaagagaactagctgttca 952



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 424  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 483
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 995  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1054

                                                                
Query: 484  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 535
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1055 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1106



to top

>gb|BT000610.1| Arabidopsis thaliana AtP-dependent RNA helicase-like protein
           (At5g63120/MDC12_8) mRNA, complete cds
          Length = 1455

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 182 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 241
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 559 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 618

                                                                       
Query: 242 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 301
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 619 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 678

                                                                       
Query: 302 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 361
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 679 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 738

                               
Query: 362 acaagagaactggctgttca 381
           ||||||||||| ||||||||
Sbjct: 739 acaagagaactagctgttca 758



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 424 tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 483
           |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 801 tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 860

                                                               
Query: 484 aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 535
           ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 861 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 912



to top

>gb|AY060589.1| Arabidopsis thaliana AT5g63120/MDC12_8 mRNA, complete cds
          Length = 2366

 Score =  103 bits (52), Expect = 7e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 182 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 241
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 754 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 813

                                                                       
Query: 242 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 301
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 814 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 873

                                                                       
Query: 302 gttggtgcacaacctcgactcgaacaaggtgatggcccaattgtcttgatccttgctcca 361
           ||| |||||||||||||| | |  || | ||||||||| ||||| || ||  | ||||| 
Sbjct: 874 gttagtgcacaacctcgattaggtcaggatgatggccccattgtgttaatattagctccc 933

                               
Query: 362 acaagagaactggctgttca 381
           ||||||||||| ||||||||
Sbjct: 934 acaagagaactagctgttca 953



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 424  tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 483
            |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 996  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 1055

                                                                
Query: 484  aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 535
            ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1056 aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1107



to top

>emb|BX832051.1|CNS09YVO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH48ZH12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2119

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 115/138 (83%)
 Strand = Plus / Plus

                                                                       
Query: 182 gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 241
           |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 742 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 801

                                                                       
Query: 242 ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 301
           |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 802 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 861

                             
Query: 302 gttggtgcacaacctcga 319
           ||| ||||||||||||||
Sbjct: 862 gttagtgcacaacctcga 879



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 482  agaggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 535
            ||||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 1041 agaggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 1094



to top

>dbj|AB008265.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDC12
          Length = 81662

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                         
Query: 182   gagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggacgtgatt 241
             |||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||  |||||
Sbjct: 29983 gagccaacacctatacaagctcagggatggccgatggcgttgaagggtagggatttgatt 29924

                                                                         
Query: 242   ggtattgcagaaactggatctgggaaaacactatcttacatactacctggtttggttcat 301
             |||||||| || ||||| ||||| || ||| |  ||||| |  |||| |  |||||||| 
Sbjct: 29923 ggtattgctgagactggctctggtaagacattggcttacttgttaccagcattggttcac 29864

                               
Query: 302   gttggtgcacaacctcga 319
             ||| ||||||||||||||
Sbjct: 29863 gttagtgcacaacctcga 29846



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 500   attgcaacaccaggtcggttgattgatatgctggaa 535
             ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 29490 attgctacacctggtcgtttgattgatatgttggaa 29455



to top

>ref|NM_004396.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5), mRNA
          Length = 2325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 768 tgtatctacggtggtgctcctaagggaccacaaatacgtga 808



to top

>ref|XM_512004.1| PREDICTED: Pan troglodytes DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
           (LOC455267), mRNA
          Length = 1462

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 743 tgtatctacggtggtgctcctaagggaccacaaatacgtga 783



to top

>gb|BC016027.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:1516 IMAGE:3528578), complete cds
          Length = 2366

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 739 tgtatctacggtggtgctcctaagggaccacaaatacgtga 779



to top

>ref|XM_448941.1| Candida glabrata CBS138, CAGL0L03846 partial mRNA
          Length = 1635

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                    
Query: 328 aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 384
           ||||||||| |||||||||||| | || |||||||| |||||||| |||||||||||
Sbjct: 540 aggtgatggtccaattgtcttggttctagctccaaccagagaacttgctgttcaaat 596



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 490 tgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagc 537
           |||||| |||||||| || |||||| | |||||||||||||| |||||
Sbjct: 702 tgaaattgtcattgctaccccaggtagattgattgatatgcttgaagc 749



to top

>emb|X52104.1|HSP68A Human mRNA for p68 protein
          Length = 2330

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 773 tgtatctacggtggtgctcctaagggaccacaaatacgtga 813



to top

>emb|X15729.1|HSNP68M Human mRNA for nuclear p68 protein
          Length = 2323

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 765 tgtatctacggtggtgctcctaagggaccacaaatacgtga 805



to top

>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                       
Query: 328    aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 384
              ||||||||| |||||||||||| | || |||||||| |||||||| |||||||||||
Sbjct: 443875 aggtgatggtccaattgtcttggttctagctccaaccagagaacttgctgttcaaat 443819



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 490    tgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagc 537
              |||||| |||||||| || |||||| | |||||||||||||| |||||
Sbjct: 443713 tgaaattgtcattgctaccccaggtagattgattgatatgcttgaagc 443666



to top

>emb|BX571764.1|HSM806634 Homo sapiens mRNA; cDNA DKFZp686J01190 (from clone DKFZp686J01190)
          Length = 3572

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 769 tgtatctacggtggtgctcctaagggaccacaaatacgtga 809



to top

>gb|BT007642.1| Synthetic construct Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 5 (RNA helicase, 68kDa) mRNA, partial cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|BT006943.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA
           helicase, 68kDa) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>emb|CR607012.1| full-length cDNA clone CS0DA009YD21 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1800

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 265 tgtatctacggtggtgctcctaagggaccacaaatacgtga 305



to top

>gb|AC138744.4| Homo sapiens chromosome 17, clone RP11-859E19, complete sequence
          Length = 177325

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                       
Query: 434    tgtatctacggtggagcacctaagggaccacaaatacgtga 474
              |||||||||||||| || |||||||||||||||||||||||
Sbjct: 169364 tgtatctacggtggtgctcctaagggaccacaaatacgtga 169324



to top

>gb|AY892740.1| Synthetic construct Homo sapiens clone FLH024742.01L DEAD box
           polypeptide 5 (DDX5) mRNA, partial cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AY890256.1| Synthetic construct Homo sapiens clone FLH024746.01X DEAD box
           polypeptide 5 (DDX5) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AY890255.1| Synthetic construct Homo sapiens clone FLH024745.01X DEAD box
           polypeptide 5 (DDX5) mRNA, complete cds
          Length = 1845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 598 tgtatctacggtggtgctcctaagggaccacaaatacgtga 638



to top

>gb|AF015812.1|AF015812 Homo sapiens RNA helicase p68 (HUMP68) gene, complete cds
          Length = 7834

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 434  tgtatctacggtggagcacctaagggaccacaaatacgtga 474
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 3767 tgtatctacggtggtgctcctaagggaccacaaatacgtga 3807



to top

>dbj|AB209919.1| Homo sapiens mRNA for Hypothetical protein DKFZp686J01190 variant
           protein
          Length = 3539

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 752 tgtatctacggtggtgctcctaagggaccacaaatacgtga 792



to top

>gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, complete sequence
          Length = 188552

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                       
Query: 434    tgtatctacggtggagcacctaagggaccacaaatacgtga 474
              |||||||||||||| || |||||||||||||||||||||||
Sbjct: 149714 tgtatctacggtggtgctcctaagggaccacaaatacgtga 149754



to top

>emb|AJ010476.1|ATH010476 Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH30
          Length = 790

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 424 tagaagcacatgtatctacggtggagcacctaagggaccacaaatacgtgacctcaggag 483
           |||||| || |||||||| ||||| || ||||| ||||| || || ||||| || || ||
Sbjct: 34  tagaagtacttgtatctatggtggtgctcctaaaggacctcagattcgtgatcttagaag 93

                                                               
Query: 484 aggagttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaa 535
           ||| ||||| || || ||||| ||||| ||||| |||||||||||| |||||
Sbjct: 94  aggtgttgagattgtaattgctacacctggtcgtttgattgatatgttggaa 145



to top

>gb|AC145395.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0047M04, complete sequence
          Length = 109523

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 569   cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
             |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 77215 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 77258



to top

>gb|AF479823.1| Pantodon buchholzi DEAD box RNA helicase Vasa mRNA, complete cds
          Length = 1512

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 566 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
           |||||||| ||||||||||||||||| ||| | |||||||||||||||
Sbjct: 340 taccttgtactggatgaggcagaccgcatgttggatatgggttttgaa 387



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 569      cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
                |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 27126162 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 27126205



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 578      gatgaggcagaccgtatgctcgatatgggttttgaa 613
                |||||||||||  | ||||| |||||||||||||||
Sbjct: 22097173 gatgaggcagatagaatgcttgatatgggttttgaa 22097208



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 569      cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
                |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 27453215 cttgtgcttgatgaggctgaccgtatgcttgatatgggttttga 27453258



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                    
Query: 578      gatgaggcagaccgtatgctcgatatgggttttgaa 613
                |||||||||||  | ||||| |||||||||||||||
Sbjct: 22407120 gatgaggcagatagaatgcttgatatgggttttgaa 22407155



to top

>gb|BT012961.1| Lycopersicon esculentum clone 114151R, mRNA sequence
          Length = 1763

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 102/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 488 gttgaaatcgtcattgcaacaccaggtcggttgattgatatgctggaagctggtcacaca 547
           |||||||| || ||||| ||||| ||  |||||||||||||| | ||| ||  ||| |||
Sbjct: 701 gttgaaattgttattgccacacctggaaggttgattgatatgttagaatctaatcataca 760

                                                                       
Query: 548 aacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgatatgggt 607
           || || ||  | || ||||| || |||||||||||||| ||||| ||||| || ||||||
Sbjct: 761 aatcttcgaagagtgacatatctcgtgctggatgaggctgaccgcatgctagacatgggt 820

                 
Query: 608 tttgaa 613
           ||||||
Sbjct: 821 tttgaa 826



to top

>emb|CR861259.1| Pongo pygmaeus mRNA; cDNA DKFZp459M043 (from clone DKFZp459M043)
          Length = 3724

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||| ||||| || |||||||||||||||||||||||
Sbjct: 768 tgtatctatggtggtgctcctaagggaccacaaatacgtga 808



to top

>ref|XM_658443.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5931.2), mRNA
          Length = 1692

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 521 attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 580
           ||||||||||| |||||||| | ||| ||||| || || ||||| ||||| || || || 
Sbjct: 823 attgatatgctcgaagctggccgcaccaaccttcgccgagttacttacctcgttcttgac 882

                                           
Query: 581 gaggcagaccgtatgctcgatatgggttttga 612
           ||||| ||||| ||| | ||||||||||||||
Sbjct: 883 gaggccgaccgcatgttggatatgggttttga 914



to top

>ref|XM_502093.1| Yarrowia lipolytica CLIB122, YALI0C21472g predicted mRNA
          Length = 1857

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
            |||||||| || |||||||| ||||| |||||||||||||||||
Sbjct: 961  taccttgtccttgatgaggccgaccgaatgctcgatatgggttt 1004



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                           
Query: 566     taccttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
               |||||||| || |||||||| ||||| |||||||||||||||||
Sbjct: 2869924 taccttgtccttgatgaggccgaccgaatgctcgatatgggttt 2869881



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 575     ctggatgaggcagaccgtatgctcgatatgggtttt 610
               ||||||||||||||||| |||||||| |||||||||
Sbjct: 3049759 ctggatgaggcagaccggatgctcgacatgggtttt 3049724



to top

>ref|NM_188251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1485

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 73  ccgggatatcaccgtggagggccgggaggtgcccaagcc 111
           |||||| ||||||||||||||||| || |||||||||||
Sbjct: 228 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 266



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 578 gatgaggcagaccgtatgctcgatatgggttttgaa 613
           |||||||||||||| ||||| |||||||| ||||||
Sbjct: 733 gatgaggcagaccggatgctggatatgggctttgaa 768



to top

>gb|BT016697.1| Zea mays clone Contig530 mRNA sequence
          Length = 1750

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 176 tttgtggagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggac 235
           |||||||| || || ||||||||| | || |||||||||||||| ||||  ||| | |||
Sbjct: 253 tttgtggaacctacccctatccaatcgcaaggttggccgatggcattgagaggccgcgac 312

                                              
Query: 236 gtgattggtattgcagaaactggatctgggaaaac 270
            | ||||| |||||||| || ||||| ||||||||
Sbjct: 313 cttattggcattgcagagacaggatcagggaaaac 347



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 332 gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacaggca 391
           ||||| |||||||||||| |  | ||||| ||| | ||||| |||||||| ||||||  |
Sbjct: 409 gatggtccaattgtcttggtgttagctcctacacgtgaacttgctgttcagatacagcaa 468

                            
Query: 392 gaagctacaaagtttgg 408
           ||||| || ||||||||
Sbjct: 469 gaagcaaccaagtttgg 485



to top

>gb|AY587260.1| Sparus aurata vasa-like protein mRNA, partial cds
          Length = 594

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 570 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 371 ttgtgctggatgaggctgaccggatgttggatatgggttttga 413



to top

>gb|AF520608.1| Sparus aurata vasa-like mRNA, partial cds
          Length = 1586

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 570 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 344 ttgtgctggatgaggctgaccggatgttggatatgggttttga 386



to top

>gb|DQ399799.1| Acanthopagrus schlegelii vasa protein mRNA, partial cds
          Length = 780

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 570 ttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
           |||||||||||||||| ||||| ||| | ||||||||||||||
Sbjct: 200 ttgtgctggatgaggctgaccggatgttggatatgggttttga 242



to top

>dbj|AP003200.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:B1046G12
          Length = 163533

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 73   ccgggatatcaccgtggagggccgggaggtgcccaagcc 111
            |||||| ||||||||||||||||| || |||||||||||
Sbjct: 1001 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 963



to top

>dbj|AP003244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0419B01
          Length = 149610

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 73    ccgggatatcaccgtggagggccgggaggtgcccaagcc 111
             |||||| ||||||||||||||||| || |||||||||||
Sbjct: 44908 ccgggagatcaccgtggagggccgcgacgtgcccaagcc 44870



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                 
Query: 578   gatgaggcagaccgtatgctcgatatgggttttgaa 613
             |||||||||||||| ||||| |||||||| ||||||
Sbjct: 43277 gatgaggcagaccggatgctggatatgggctttgaa 43242



to top

>dbj|AK068197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013140N02, full
           insert sequence
          Length = 4012

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 538 tggtcacacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgct 597
           ||||||||| ||||| ||  | || |||||||| || ||||||||||| ||||| |||||
Sbjct: 2   tggtcacactaacctgcgaagagtaacatacctcgtcctggatgaggctgaccgcatgct 61

                          
Query: 598 cgatatgggttttga 612
            || |||||||||||
Sbjct: 62  tgacatgggttttga 76



to top

>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172,
              complete sequence
          Length = 127731

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 176    tttgtggagccaacgcctatccaagctcagggttggccgatggctttgaagggcagggac 235
              ||||| ||||| || || ||||| |||||||||||||| |||||| ||| ||| ||||| 
Sbjct: 104909 tttgttgagcccactccaatccaggctcagggttggcccatggctctgacgggtagggat 104850

                                     
Query: 236    gtgattggtattgcagaaactgg 258
               ||||||| ||||| || |||||
Sbjct: 104849 ttgattggcattgctgagactgg 104827



to top

>ref|NM_104388.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT1G55150 mRNA, complete
           cds
          Length = 1825

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 543 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 602
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 872 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 931

                     
Query: 603 tgggttttga 612
           |||| |||||
Sbjct: 932 tggggtttga 941



to top

>ref|XR_002773.1| PREDICTED: Mus musculus hypothetical protein LOC670055 (LOC670055),
            mRNA
          Length = 2773

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 254  actggatctgggaaaacactatctta 279
            ||||||||||||||||||||||||||
Sbjct: 1070 actggatctgggaaaacactatctta 1095



to top

>emb|X52648.1|SPP68 Schizosaccharomyces pombe p68 gene for p68 protein
          Length = 2742

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 572  gtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            ||||||||||| || ||||| ||||| |||||||||||||||
Sbjct: 1102 gtgctggatgaagccgaccgaatgcttgatatgggttttgaa 1143



to top

>emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chromosome 11 Contains a
             DEAD box polypeptide 5 (Ddx5) pseudogene, the Gnb2-rs1
             gene for guanine nucleotide binding protein, beta 2
             related sequence 1, the Trim41 gene for tripartite
             motif-containing 41, a novel protein similar to CDK2
             (cyclin-dependent kinase 2)-associated protein 1 (Cdkap1),
             the Trim7 gene for tripartite motif protein 7, the Ifi1
             gene for interferon inducible protein 1, a novel gene
             (LOC277018), two novel genes and four CpG islands,
             complete sequence
          Length = 202559

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 254   actggatctgggaaaacactatctta 279
             ||||||||||||||||||||||||||
Sbjct: 13020 actggatctgggaaaacactatctta 12995



to top

>emb|AL032684.1|SPBP8B7 S.pombe chromosome II p1 p8B7
          Length = 71000

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 572   gtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
             ||||||||||| || ||||| ||||| |||||||||||||||
Sbjct: 31858 gtgctggatgaagccgaccgaatgcttgatatgggttttgaa 31817



to top

>ref|NM_204708.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 (DDX4), mRNA
          Length = 1989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 578  gatgaggcagaccgtatgctcgatatgggttttg 611
            ||||| |||||||| |||||||||||||||||||
Sbjct: 1177 gatgaagcagaccgcatgctcgatatgggttttg 1210



to top

>gb|AY128786.1| Arabidopsis thaliana unknown protein (At1g55150) mRNA, complete cds
          Length = 1539

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 543 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 602
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 722 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 781

                     
Query: 603 tgggttttga 612
           |||| |||||
Sbjct: 782 tggggtttga 791



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 329 ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 388
           ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 508 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 567



to top

>gb|AY062745.1| Arabidopsis thaliana Unknown protein (At1g55150; T7N22.9) mRNA,
           complete cds
          Length = 1814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 543 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 602
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 872 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 931

                     
Query: 603 tgggttttga 612
           |||| |||||
Sbjct: 932 tggggtttga 941



to top

>ref|NM_001022444.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBP8B7.16c),
           partial mRNA
          Length = 1653

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 572 gtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
           ||||||||||| || ||||| ||||| |||||||||||||||
Sbjct: 820 gtgctggatgaagccgaccgaatgcttgatatgggttttgaa 861



to top

>emb|BX813460.1|CNS0AC9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZH04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1731

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 543 acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 602
           |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 850 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 909

                     
Query: 603 tgggttttga 612
           |||| |||||
Sbjct: 910 tggggtttga 919



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 329 ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 388
           ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 636 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 695



to top

>gb|AC073944.6|AC073944 Arabidopsis thaliana chromosome 1 BAC T7N22 genomic sequence, complete
             sequence
          Length = 44540

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                         
Query: 543   acacaaacctacgtcgggttacataccttgtgctggatgaggcagaccgtatgctcgata 602
             |||||||||||||  ||||||| || |||||  |||||||||| || || ||||| ||||
Sbjct: 35818 acacaaacctacgaagggttacttatcttgttttggatgaggctgatcgaatgcttgata 35877

                       
Query: 603   tgggttttga 612
             |||| |||||
Sbjct: 35878 tggggtttga 35887



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                         
Query: 329   ggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacag 388
             ||||| |||||||| |||||| | |||||||| ||  | ||||||||||| || ||||||
Sbjct: 35499 ggtgacggcccaatcgtcttggttcttgctcccactcgtgaactggctgtgcagatacag 35558



to top

>emb|AJ010936.1|HSA010936 Homo sapiens ddx5-ps1 gene, partial
          Length = 334

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           ||||||||||||||||||||||||||
Sbjct: 262 actggatctgggaaaacactatctta 287



to top

>gb|AF096248.1|AF096248 Lycopersicon esculentum ethylene-responsive RNA helicase (ER68)
           mRNA, complete cds
          Length = 1752

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 572 gtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
           |||||||||||||| ||||| ||||| || ||||||||||||
Sbjct: 824 gtgctggatgaggctgaccgcatgctagacatgggttttgaa 865



to top

>gb|L11574.1|YSPP68DBP Schizosaccharomyces pombe p68 RNA helicase (dbp2) mRNA, complete
           cds
          Length = 1780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 572 gtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
           ||||||||||| || ||||| ||||| |||||||||||||||
Sbjct: 820 gtgctggatgaagccgaccgaatgcttgatatgggttttgaa 861



to top

>dbj|AB004836.1| Gallus gallus mRNA for Cvh, complete cds
          Length = 1989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 578  gatgaggcagaccgtatgctcgatatgggttttg 611
            ||||| |||||||| |||||||||||||||||||
Sbjct: 1177 gatgaagcagaccgcatgctcgatatgggttttg 1210



to top

>ref|NM_111523.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ helicase/
            nucleic acid binding AT3G06480 mRNA, complete cds
          Length = 3605

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 569  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| || ||||||||||| ||||| || ||||||||||||
Sbjct: 1849 cttgtgcttgacgaggcagaccgaatgcttgacatgggttttgaa 1893



to top

>emb|CR954247.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome II, complete
              sequence
          Length = 635328

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 578    gatgaggcagaccgtatgctcgatatggg 606
              ||||| |||||||||||||||||||||||
Sbjct: 468000 gatgaagcagaccgtatgctcgatatggg 468028



to top

>gb|AC011623.5|ATAC011623 Arabidopsis thaliana chromosome III BAC F24P17 genomic sequence,
            complete sequence
          Length = 86022

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 569  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| || ||||||||||| ||||| || ||||||||||||
Sbjct: 4902 cttgtgcttgacgaggcagaccgaatgcttgacatgggttttgaa 4946



to top

>ref|XM_550287.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2864

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 569  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1356 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1399



to top

>ref|XM_550286.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2127

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 569  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 988  cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1031



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 578    gatgaggcagaccgtatgctcgatatgggttt 609
              ||||| || |||||||||||||||||||||||
Sbjct: 912330 gatgaagccgaccgtatgctcgatatgggttt 912361



to top

>gb|AC092238.2| Drosophila melanogaster clone BACR03D18, complete sequence
          Length = 184681

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 570 ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
           |||||||||||||||| || || ||||| |||||||||||
Sbjct: 152 ttgtgctggatgaggccgatcgcatgctagatatgggttt 113



to top

>ref|XM_855709.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 14 (LOC474508), mRNA
          Length = 4759

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855680.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 13 (LOC474508), mRNA
          Length = 4789

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 980  taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1027



to top

>ref|XM_855640.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 12 (LOC474508), mRNA
          Length = 4885

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_845027.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 2 (LOC474508), mRNA
          Length = 4873

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855575.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 11 (LOC474508), mRNA
          Length = 4870

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_531736.2| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 1 (LOC474508), mRNA
          Length = 4909

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855514.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 10 (LOC474508), mRNA
          Length = 4882

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855481.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 9 (LOC474508), mRNA
          Length = 1645

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855444.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 8 (LOC474508), mRNA
          Length = 1946

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855416.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 7 (LOC474508), mRNA
          Length = 1637

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855385.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 6 (LOC474508), mRNA
          Length = 1887

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_855349.1| PREDICTED: Canis familiaris similar to Probable RNA-dependent
            helicase p72 (DEAD-box protein p72) (DEAD-box protein
            17), transcript variant 5 (LOC474508), mRNA
          Length = 4807

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 566  taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||| ||||||||||| ||| | ||||| |||||||| ||||||
Sbjct: 1058 taccttgtactggatgaggctgacaggatgcttgatatgggctttgaa 1105



to top

>ref|XM_504478.1| Yarrowia lipolytica CLIB122, YALI0E27715g predicted mRNA
          Length = 1659

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 578 gatgaggcagaccgtatgctcgatatgggttt 609
           |||||||| ||||| |||||||||||||||||
Sbjct: 808 gatgaggccgaccgaatgctcgatatgggttt 839



to top

>ref|NM_165103.2| Drosophila melanogaster vasa CG3506-RA (vas), mRNA
          Length = 2285

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 570  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1338 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1377



to top

>gb|AY084126.1| Drosophila melanogaster RE20606 full insert cDNA
          Length = 2252

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 570  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1333 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1372



to top

>gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
             BACR06I01, complete sequence
          Length = 175167

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 570   ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
             |||||||||||||||| || || ||||| |||||||||||
Sbjct: 27903 ttgtgctggatgaggccgatcgcatgctagatatgggttt 27942



to top

>gb|AE009543.1| Brucella melitensis 16M chromosome I, section 100 of 195 of the
            complete sequence
          Length = 14857

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 578  gatgaggcagaccgtatgctcgatatgggttt 609
            ||||| || |||||||||||||||||||||||
Sbjct: 6366 gatgaagccgaccgtatgctcgatatgggttt 6335



to top

>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0583G08
          Length = 135295

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 569    cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
              ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 123634 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 123591



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 578    gatgaggcagaccgtatgctcgatatgggttt 609
              ||||| || |||||||||||||||||||||||
Sbjct: 934021 gatgaagccgaccgtatgctcgatatgggttt 934052



to top

>ref|XM_320481.2| Anopheles gambiae str. PEST ENSANGP00000015773
           (ENSANGG00000013284), partial mRNA
          Length = 1587

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 563 acataccttgtgctggatgaggcagaccgtatgctcgatatggg 606
           |||||||| |||||||||||||| ||||| ||||| || |||||
Sbjct: 736 acatacctcgtgctggatgaggccgaccggatgctggacatggg 779



to top

>dbj|AK100326.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079L21, full
            insert sequence
          Length = 2864

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 569  cttgtgctggatgaggcagaccgtatgctcgatatgggttttga 612
            ||||| || |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1356 cttgttcttgatgaggctgaccgcatgcttgatatgggttttga 1399



to top

>gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55 of 83 of the complete
             sequence
          Length = 265413

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 570   ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
             |||||||||||||||| || || ||||| |||||||||||
Sbjct: 72956 ttgtgctggatgaggccgatcgcatgctagatatgggttt 72995



to top

>gb|AY786204.1| Monopterus albus DEAD box RNA helicase-PL10B mRNA, partial cds
          Length = 1127

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 566 taccttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
           ||||| || |||||||||||||| |||||||| || ||||| ||||||
Sbjct: 571 tacctggtcctggatgaggcagatcgtatgcttgacatgggctttgaa 618



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 578    gatgaggcagaccgtatgctcgatatgggttt 609
              ||||| || |||||||||||||||||||||||
Sbjct: 931143 gatgaagccgaccgtatgctcgatatgggttt 931174



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 578     gatgaggcagaccgtatgctcgatatgggttt 609
               |||||||| ||||| |||||||||||||||||
Sbjct: 3273532 gatgaggccgaccgaatgctcgatatgggttt 3273501



to top

>emb|X12946.1|DMVASA2 D.melanogaster vasa gene (exons 3 to 7)
          Length = 1904

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 570 ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
           |||||||||||||||| || || ||||| |||||||||||
Sbjct: 864 ttgtgctggatgaggccgatcgcatgctagatatgggttt 903



to top

>gb|M23560.1|DROVASA D.melanogaster antigen Mab46F11 (vasa) mRNA, complete cds
          Length = 2225

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                    
Query: 570  ttgtgctggatgaggcagaccgtatgctcgatatgggttt 609
            |||||||||||||||| || || ||||| |||||||||||
Sbjct: 1279 ttgtgctggatgaggccgatcgcatgctagatatgggttt 1318



to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 576     tggatgaggcagaccgtatgctcgatatgggtttt 610
               |||||||||||||| | ||||| ||||||||||||
Sbjct: 2367638 tggatgaggcagacagaatgctggatatgggtttt 2367672



to top

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 576     tggatgaggcagaccgtatgctcgatatgggtttt 610
               |||||||||||||| | ||||| ||||||||||||
Sbjct: 2307879 tggatgaggcagacagaatgctggatatgggtttt 2307913



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 572     gtgctggatgaggcagaccgtatgctcgatatggg 606
               ||||||||||| |||||||| ||||| ||||||||
Sbjct: 3146658 gtgctggatgaagcagaccggatgctggatatggg 3146624



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 572    gtgctggatgaggcagaccgtatgctcgatatggg 606
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 387945 gtgctggatgaagcagaccgcatgctggatatggg 387911



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 572     gtgctggatgaggcagaccgtatgctcgatatgggtttt 610
               |||||||||||||| |||||| |||| || |||||||||
Sbjct: 1177879 gtgctggatgaggctgaccgtttgctggagatgggtttt 1177917



to top

>gb|BC086320.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone IMAGE:6466882), partial cds
          Length = 2275

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 519 actggatctgggaaaacattatctta 544



to top

>ref|NM_001016781.2| Xenopus tropicalis hypothetical protein LOC549535 (LOC549535), mRNA
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacg 471
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC084159.1| Xenopus tropicalis cDNA clone IMAGE:7016603
          Length = 4542

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacg 471
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC080992.1| Xenopus laevis hypothetical protein LOC398649, mRNA (cDNA clone
           MGC:80019 IMAGE:3401294), complete cds
          Length = 2818

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacg 471
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 672 tgtatctatggtggggctcctaaaggaccacaaatacg 709



to top

>gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome
          Length = 2650701

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 578     gatgaggcagaccgtatgctcgatatgggttttg 611
               ||||| || ||||||||||| |||||||||||||
Sbjct: 1292737 gatgaagctgaccgtatgctagatatgggttttg 1292770



to top

>ref|NM_007840.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (Ddx5), mRNA
          Length = 3521

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|BC054236.1| Xenopus laevis hypothetical protein LOC398649, mRNA (cDNA clone
           IMAGE:6880238), partial cds
          Length = 1336

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacg 471
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 651 tgtatctatggtggggctcctaaaggaccacaaatacg 688



to top

>gb|BC062916.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone IMAGE:6827275), partial cds
          Length = 3645

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 581 actggatctgggaaaacattatctta 606



to top

>ref|XM_946895.1| Theileria annulata strain Ankara ATP-dependent RNA helicase
           (TA14795) partial mRNA
          Length = 1368

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 347 ttgatccttgctccaacaagagaact 372
           ||||||||||||||||| ||||||||
Sbjct: 337 ttgatccttgctccaactagagaact 362



to top

>emb|X65627.1|MMHELI M.musculus mRNA TNZ2 for p68 RNA helicase
          Length = 2318

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 578 actggatctgggaaaacattatctta 603



to top

>dbj|AK129022.1| Mus musculus cDNA fis, clone TRACH3036683, highly similar to
           Probable RNA-dependent helicase p68
          Length = 3602

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 596 actggatctgggaaaacattatctta 621



to top

>gb|AF479821.1| Hyphessobrycon ecuadoriensis DEAD box RNA helicase Vasa mRNA,
           complete cds
          Length = 1730

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 575 ctggatgaggcagaccgtatgctcgatatgggttttga 612
           ||||||||||| || ||||||||||| ||||| |||||
Sbjct: 349 ctggatgaggctgatcgtatgctcgacatgggatttga 386



to top

>dbj|AK132779.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4922505M03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 2375

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 643 actggatctgggaaaacattatctta 668



to top

>dbj|AK135173.1| Mus musculus 12 days embryo female ovary cDNA, RIKEN full-length
           enriched library, clone:6620402N06 product:DEAD
           (Asp-Glu-Ala-Asp) box polypeptide 5, full insert
           sequence
          Length = 3522

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>dbj|AK166698.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0003N03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 2461

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 729 actggatctgggaaaacattatctta 754



to top

>dbj|AK166045.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730030M03 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5, full insert sequence
          Length = 3521

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>dbj|AK088887.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029P14
           product:DEAD (aspartate-glutamate-alanine-aspartate) box
           polypeptide 5, full insert sequence
          Length = 2329

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 597 actggatctgggaaaacattatctta 622



to top

>gb|DQ336393.1| Elephas maximus DEAD/H box polypeptide (DBY) gene, partial sequence
          Length = 458

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 359 ccaacaagagaactggctgttcaaat 384
           |||||||||||||||||||| |||||
Sbjct: 284 ccaacaagagaactggctgtacaaat 309



to top

>dbj|AK044792.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
           clone:A930106P08 product:DEAD
           (aspartate-glutamate-alanine-aspartate) box polypeptide
           5, full insert sequence
          Length = 2329

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 596 actggatctgggaaaacattatctta 621



to top

>dbj|AK076018.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610035N22 product:DEAD
           (aspartate-glutamate-alanine-aspartate) box polypeptide
           5, full insert sequence
          Length = 2338

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 598 actggatctgggaaaacattatctta 623



to top

>ref|XM_392069.2| PREDICTED: Apis mellifera similar to ENSANGP00000017814 (LOC408524),
            mRNA
          Length = 2743

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 576  tggatgaggcagaccgtatgctcgatatgggttttgaa 613
            ||||||| || || |||||| |||||||||||||||||
Sbjct: 1778 tggatgaagcggatcgtatgatcgatatgggttttgaa 1815



to top

>gb|AY730697.1| Nematostella vectensis DEAD box helicase Vasa2 (Vas2) mRNA, partial
           cds
          Length = 844

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 576 tggatgaggcagaccgtatgctcgatatgggttttgaa 613
           ||||||| |||||||||||||| || ||||| ||||||
Sbjct: 315 tggatgaagcagaccgtatgctggacatgggctttgaa 352



to top

>ref|NM_001007613.1| Rattus norvegicus ddx5 gene (Ddx5), mRNA
          Length = 2508

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 648 actggatctgggaaaacattatctta 673



to top

>gb|BC079036.1| Rattus norvegicus ddx5 gene, mRNA (cDNA clone MGC:93965
           IMAGE:7114313), complete cds
          Length = 2508

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 648 actggatctgggaaaacattatctta 673



to top

>emb|AJ010940.1|RNO010940 Rattus norvegicus ddx5-ps1 pseudogene, partial
          Length = 336

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 264 actggatctgggaaaacattatctta 289



to top

>emb|CR855694.2| Xenopus tropicalis finished cDNA, clone TGas068f07
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacg 471
           |||||||| ||||| || ||||| ||||||||||||||
Sbjct: 704 tgtatctatggtggggctcctaaaggaccacaaatacg 741



to top

>gb|BC046554.1| Mus musculus cDNA clone IMAGE:4973650
          Length = 2321

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 574 actggatctgggaaaacattatctta 599



to top

>gb|BC108369.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:118083 IMAGE:6312791), complete cds
          Length = 2236

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 254 actggatctgggaaaacactatctta 279
           |||||||||||||||||| |||||||
Sbjct: 441 actggatctgggaaaacattatctta 466



to top

>gb|AC149403.2| Phakopsora pachyrhizi clone JGIAFNA-61H19, complete sequence
          Length = 36597

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 332   gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 384
             |||||||| ||||| |||||| | || || ||| | |||||||||||||||||
Sbjct: 23701 gatggccctattgtattgatcttagcacccacacgggaactggctgttcaaat 23649



to top

>gb|AY391418.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5) mRNA,
           complete cds
          Length = 2482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 ccaacgcctatccaagctcagggttggcc 213
           ||||| ||||||||||||||||| |||||
Sbjct: 417 ccaacccctatccaagctcaggggtggcc 445



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 581     gaggcagaccgtatgctcgatatgggttt 609
               ||||||||||| |||||||| ||||||||
Sbjct: 3430699 gaggcagaccggatgctcgacatgggttt 3430727



to top

>ref|XM_629763.1| Dictyostelium discoideum hypothetical protein (DDB0184159), partial
            mRNA
          Length = 2334

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 490  tgaaatcgtcattgcaacaccaggtcggttgattgat 526
            ||||||| ||||||||||||| ||||| ||| |||||
Sbjct: 1314 tgaaatcatcattgcaacaccgggtcgtttggttgat 1350



to top

>ref|NM_212612.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (ddx5), mRNA
          Length = 2482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 ccaacgcctatccaagctcagggttggcc 213
           ||||| ||||||||||||||||| |||||
Sbjct: 417 ccaacccctatccaagctcaggggtggcc 445



to top

>gb|BC082849.1| Xenopus laevis p68 RNA helicase, mRNA (cDNA clone MGC:81559
           IMAGE:6862986), complete cds
          Length = 2177

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 482 agaggagttgaaatcgtcattgcaacacc 510
           |||||||||||||||  ||||||||||||
Sbjct: 679 agaggagttgaaatctgcattgcaacacc 707



to top

>gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 section 10 of 16 of the
              complete genome
          Length = 290294

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 575    ctggatgaggcagaccgtatgctcgatatgggttttg 611
              |||||||| || ||||||||||| || ||||||||||
Sbjct: 168361 ctggatgaagctgaccgtatgctggacatgggttttg 168325



to top

>gb|BC063223.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA
           (cDNA clone MGC:76265 IMAGE:5379210), complete cds
          Length = 2192

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 446 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 505
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 622 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 681

                
Query: 506 acacc 510
           |||||
Sbjct: 682 acacc 686



to top

>ref|XM_361961.1| Magnaporthe grisea 70-15 hypothetical protein (MG04406.4) partial cds
          Length = 7962

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  gaaactggatctgggaaaaca 271
            |||||||||||||||||||||
Sbjct: 1288 gaaactggatctgggaaaaca 1308



to top

>gb|DQ441593.1| Odontesthes hatcheri vasa-like protein mRNA, partial cds
          Length = 287

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 572 gtgctggatgaggcagaccgtatgctcgatatgggttttga 612
           ||||||||||| ||||| || ||| | ||||||||||||||
Sbjct: 192 gtgctggatgaagcagatcgcatgttggatatgggttttga 232



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 575     ctggatgaggcagaccgtatgctcgatatgggttttg 611
               |||||||| || ||||||||||| || ||||||||||
Sbjct: 1430731 ctggatgaagctgaccgtatgctggacatgggttttg 1430695



to top

>ref|XM_456137.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F23716g predicted mRNA
          Length = 1665

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 328 aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 384
           ||||||||| |||||||| ||| |  | |||||||| |||||| | |||||||||||
Sbjct: 549 aggtgatggtccaattgttttggtattggctccaaccagagaattagctgttcaaat 605



to top

>gb|BC067585.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA (cDNA
           clone MGC:85704 IMAGE:6963939), complete cds
          Length = 2245

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 ccaacgcctatccaagctcagggttggcc 213
           ||||| ||||||||||||||||| |||||
Sbjct: 438 ccaacccctatccaagctcaggggtggcc 466



to top

>gb|AC165060.2| Phakopsora pachyrhizi clone JGIAFNA-205B5, complete sequence
          Length = 44829

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 332   gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 384
             |||||||| ||||| |||||| | || || ||| | |||||||||||||||||
Sbjct: 20583 gatggccctattgtattgatcttagcacccacacgggaactggctgttcaaat 20635



to top

>gb|BC047981.1| Xenopus laevis similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 5 (RNA helicase, 68kDa), mRNA (cDNA clone
           MGC:53795 IMAGE:5541855), complete cds
          Length = 2158

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 482 agaggagttgaaatcgtcattgcaacacc 510
           |||||||||||||||  ||||||||||||
Sbjct: 663 agaggagttgaaatctgcattgcaacacc 691



to top

>ref|XM_719206.1| Plasmodium yoelii yoelii str. 17XNL U5 snRNP 100 kD protein (PY04051)
            partial mRNA
          Length = 2904

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 239  attggtattgcagaaactggatctgggaaaaca 271
            ||||| ||||| |||||||||||||| ||||||
Sbjct: 1750 attggaattgctgaaactggatctggaaaaaca 1782



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 578     gatgaggcagaccgtatgctcgatatggg 606
               ||||| |||||||| ||||||||||||||
Sbjct: 1814632 gatgaagcagaccgcatgctcgatatggg 1814604



to top

>ref|XM_967408.1| PREDICTED: Tribolium castaneum similar to DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 5 (LOC661233), mRNA
          Length = 1623

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 581 gaggcagaccgtatgctcgatatgggttttgaa 613
           |||||||| || ||||| |||||||||||||||
Sbjct: 736 gaggcagatcggatgcttgatatgggttttgaa 768



to top

>emb|Z71388.1|SCYNL112W S.cerevisiae chromosome XIV reading frame ORF YNL112w
          Length = 3740

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 356  gctccaacaagagaactggctgttcaaat 384
            |||||||| |||||| |||||||||||||
Sbjct: 1016 gctccaactagagaattggctgttcaaat 1044



to top

>emb|Z69382.1|SCCXIV38K S.cerevisiae 37,800 bp segment of chromosome XIV
          Length = 37800

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 356   gctccaacaagagaactggctgttcaaat 384
             |||||||| |||||| |||||||||||||
Sbjct: 30156 gctccaactagagaattggctgttcaaat 30184



to top

>emb|X52649.1|SCP68 S.cerevisiae p68 gene
          Length = 2733

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 356 gctccaacaagagaactggctgttcaaat 384
           |||||||| |||||| |||||||||||||
Sbjct: 637 gctccaactagagaattggctgttcaaat 665



to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 578     gatgaggcagaccgtatgctcgatatgggtttt 610
               |||||||||||| | ||||| ||||||||||||
Sbjct: 2284659 gatgaggcagacagaatgctggatatgggtttt 2284691



to top

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 578     gatgaggcagaccgtatgctcgatatggg 606
               ||||| |||||||||||||| ||||||||
Sbjct: 2788064 gatgaagcagaccgtatgcttgatatggg 2788036



to top

>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2602197

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                        
Query: 328     aggtgatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaat 384
               ||||||||| |||||||| ||| |  | |||||||| |||||| | |||||||||||
Sbjct: 2217581 aggtgatggtccaattgttttggtattggctccaaccagagaattagctgttcaaat 2217525



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                    
Query: 575     ctggatgaggcagaccgtatgctcgatatgggttttg 611
               |||||||| || ||||||||||| || ||||||||||
Sbjct: 3431694 ctggatgaagctgaccgtatgctggacatgggttttg 3431730



to top

>ref|NM_203898.1| Xenopus tropicalis DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (ddx5),
           mRNA
          Length = 2192

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 446 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 505
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 622 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 681

                
Query: 506 acacc 510
           |||||
Sbjct: 682 acacc 686



to top

>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20
          Length = 258050

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 575    ctggatgaggcagaccgtatgctcgatatgggttttg 611
              |||||||| || ||||||||||| || ||||||||||
Sbjct: 122801 ctggatgaagctgaccgtatgctggacatgggttttg 122765



to top

>emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in linkage group 3,
             complete sequence
          Length = 154312

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 185   ccaacgcctatccaagctcagggttggcc 213
             ||||| ||||||||||||||||| |||||
Sbjct: 58048 ccaacccctatccaagctcaggggtggcc 58020



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                           
Query: 521     attgatatgctggaagctggtcacacaaacctacgtcgggttacataccttgtgctggat 580
               ||||||||||| || ||||| | ||| ||||| || || || || |||||||| || || 
Sbjct: 1421874 attgatatgctcgaggctggccgcactaacctccgccgtgtcacttaccttgttcttgac 1421933

                                            
Query: 581     gaggcagaccgtatgctcgatatgggttt 609
               ||||| ||||| ||||| || ||||||||
Sbjct: 1421934 gaggccgaccgcatgctggacatgggttt 1421962



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 81      tcaccgtggagggccgggaggtgcc 105
               ||||||||||||||||| |||||||
Sbjct: 2793394 tcaccgtggagggccggcaggtgcc 2793418



to top

>dbj|AB169223.1| Macaca fascicularis testis cDNA, clone: QtsA-18104, similar to
           human DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5),
           mRNA, RefSeq: NM_004396.2
          Length = 2182

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 569 cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
           ||||| || ||||| |||||| | ||||| |||||||||||||||
Sbjct: 737 cttgtccttgatgaagcagacagaatgcttgatatgggttttgaa 781



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 602 tgtatctatggtggtgctcccaagggaccccaaatacgtga 642



to top

>dbj|AB169157.1| Macaca fascicularis testis cDNA, clone: QtsA-17658, similar to human
            DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 (DDX5), mRNA,
            RefSeq: NM_004396.2
          Length = 2416

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 569  cttgtgctggatgaggcagaccgtatgctcgatatgggttttgaa 613
            ||||| || ||||| |||||| | ||||| |||||||||||||||
Sbjct: 985  cttgtccttgatgaagcagacagaatgcttgatatgggttttgaa 1029



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 434 tgtatctacggtggagcacctaagggaccacaaatacgtga 474
           |||||||| ||||| || || |||||||| |||||||||||
Sbjct: 850 tgtatctatggtggtgctcccaagggaccccaaatacgtga 890



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 570     ttgtgctggatgaggcagaccgtatgctcgatatggg 606
               |||| ||||| || |||||||||||||| ||||||||
Sbjct: 2372992 ttgttctggacgaagcagaccgtatgcttgatatggg 2372956



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 575     ctggatgaggcagaccgtatgctcgatatggg 606
               ||||| || |||||||||||||| ||||||||
Sbjct: 1026523 ctggacgaagcagaccgtatgcttgatatggg 1026492



to top

>gb|AF218580.1|AF218580 Xenopus laevis p68 RNA helicase mRNA, complete cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 482 agaggagttgaaatcgtcattgcaacacc 510
           |||||||||||||||  ||||||||||||
Sbjct: 705 agaggagttgaaatctgcattgcaacacc 733



to top

>ref|NM_065859.3| Caenorhabditis elegans F01F1.7 (F01F1.7) mRNA, complete cds
          Length = 2282

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 488  gttgaaatcgtcattgcaacaccaggtcg 516
            |||||| | ||||||||||||||||||||
Sbjct: 1286 gttgaagtggtcattgcaacaccaggtcg 1314



to top

>gb|AY960203.1| Odontesthes bonariensis Vasa-like protein mRNA, partial cds
          Length = 287

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 572 gtgctggatgaggcagaccgtatgctcgatatgggttttga 612
           ||||||||||| ||||| || ||| | ||||||||||||||
Sbjct: 192 gtgctggatgaagcagatcgcatgttggatatgggttttga 232



to top

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 578     gatgaggcagaccgtatgctcgatatggg 606
               ||||| |||||||||||||| ||||||||
Sbjct: 2673286 gatgaagcagaccgtatgcttgatatggg 2673258



to top

>dbj|AB051835.1| Oreochromis niloticus vas-s mRNA for vasa short form, complete cds
          Length = 2058

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 572  gtgctggatgaggcagaccgtatgctcgatatgggttttga 612
            |||||||||||||| ||||| ||| | |||||||| |||||
Sbjct: 1062 gtgctggatgaggctgaccgcatgttggatatggggtttga 1102



to top

>dbj|AB032467.1| Oreochromis niloticus mRNA for vasa, complete cds
          Length = 2130

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 572  gtgctggatgaggcagaccgtatgctcgatatgggttttga 612
            |||||||||||||| ||||| ||| | |||||||| |||||
Sbjct: 1134 gtgctggatgaggctgaccgcatgttggatatggggtttga 1174



to top

>emb|BX085195.5| Zebrafish DNA sequence from clone DKEY-226A5 in linkage group 3, complete
              sequence
          Length = 227111

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 185    ccaacgcctatccaagctcagggttggcc 213
              ||||| ||||||||||||||||| |||||
Sbjct: 155137 ccaacccctatccaagctcaggggtggcc 155165



to top

>gb|AY110750.1| Zea mays CL9052_1 mRNA sequence
          Length = 1387

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                        
Query: 332  gatggcccaattgtcttgatccttgctccaacaagagaactggctgttcaaatacaggca 391
            ||||| |||||||||||| |  | ||||| ||| | ||||| |||||||| ||||||  |
Sbjct: 1297 gatggtccaattgtcttggtgttagctcctacacgtgaacttgctgttcagatacagcaa 1238

                             
Query: 392  gaagctacaaagtttgg 408
            ||||| || ||||||||
Sbjct: 1237 gaagcaaccaagtttgg 1221



to top

>emb|CR848548.2| Xenopus tropicalis finished cDNA, clone TEgg028e13
          Length = 2152

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 446 ggagcacctaagggaccacaaatacgtgacctcaggagaggagttgaaatcgtcattgca 505
           ||||| || ||||||||||| |||||||| ||    |||||||||||||||  |||||| 
Sbjct: 631 ggagctccaaagggaccacagatacgtgatctagaaagaggagttgaaatctgcattgct 690

                
Query: 506 acacc 510
           |||||
Sbjct: 691 acacc 695



to top

>gb|U13070.1| Caenorhabditis elegans cosmid F01F1, complete sequence
          Length = 40824

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 488  gttgaaatcgtcattgcaacaccaggtcg 516
            |||||| | ||||||||||||||||||||
Sbjct: 9533 gttgaagtggtcattgcaacaccaggtcg 9505



to top

>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 578     gatgaggcagaccgtatgctcgatatggg 606
               |||||||| ||||| ||||||||||||||
Sbjct: 1238678 gatgaggctgaccggatgctcgatatggg 1238706



to top

>gb|AC154130.1| Tribolium castaneum  BAC T.cast_C11O3 (Clemson University Genomics
             Institute Tribolium castaneum BAC Library (Red Flour
             Beetle)) complete sequence
          Length = 148539

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 247   tgcagaaactggatctgggaaaac 270
             |||| |||||||||||||||||||
Sbjct: 37474 tgcacaaactggatctgggaaaac 37497



to top

>gb|AF510054.1| Schistocerca gregaria vasa-like gene, partial cds
          Length = 1764

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 578  gatgaggcagaccgtatgctcgatatgggttt 609
            ||||| ||||| |||||||| |||||||||||
Sbjct: 973  gatgaagcagatcgtatgctagatatgggttt 1004



to top

>ref|XM_635505.1| Dictyostelium discoideum hypothetical protein (DDB0204625), partial
           mRNA
          Length = 2352

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 497 gtcattgcaacaccaggtcg 516
           ||||||||||||||||||||
Sbjct: 943 gtcattgcaacaccaggtcg 962



to top

>ref|NM_177069.2| Mus musculus RIKEN cDNA E330009P21 gene (E330009P21Rik), mRNA
          Length = 1487

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 638 gatggcccaattgtcttgat 657



to top

>gb|AY723847.1| Saccharomyces cerevisiae clone FLH004944.01X YLR276C gene, complete
           cds
          Length = 1785

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 353 cttgctccaacaagagaactggct 376
           |||| |||||||||||||||||||
Sbjct: 298 cttgttccaacaagagaactggct 321



to top

>ref|XM_613184.2| PREDICTED: Bos taurus similar to Probable RNA-dependent helicase
           p68 (DEAD-box protein p68) (DEAD-box protein 5),
           transcript variant 1 (LOC533700), mRNA
          Length = 2468

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 455 aagggaccacaaatacgtga 474
           ||||||||||||||||||||
Sbjct: 921 aagggaccacaaatacgtga 940



to top

>gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRNA (cDNA clone
           MGC:81281 IMAGE:6631829), complete cds
          Length = 3614

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 gaaactggatctgggaaaac 270
           ||||||||||||||||||||
Sbjct: 458 gaaactggatctgggaaaac 477



to top

>ref|NM_026360.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 (Ddx47),
           mRNA
          Length = 1752

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           |||||||| |||||||||||||||
Sbjct: 225 gcagaaacgggatctgggaaaaca 248



to top

>ref|NM_175214.3| Mus musculus kinesin family member 27 (Kif27), mRNA
          Length = 4462

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 252 aaactggatctgggaaaaca 271
           ||||||||||||||||||||
Sbjct: 254 aaactggatctgggaaaaca 273



to top

>ref|XM_705616.1| Candida albicans SC5314 putative nonsense-mediated decay helicase
           Dbp2 (CaO19.171), mRNA
          Length = 1332

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 206 ggttggccgatggctttgaagggcagggacgtgattggtattgc 249
           |||||||| ||||||||||  || |||||  |||||||||||||
Sbjct: 469 ggttggcctatggctttgagtggtagggatatgattggtattgc 512



to top

>ref|XM_705602.1| Candida albicans SC5314 putative nonsense-mediated decay helicase
           Dbp2 (CaO19.7804), mRNA
          Length = 1332

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 206 ggttggccgatggctttgaagggcagggacgtgattggtattgc 249
           |||||||| ||||||||||  || |||||  |||||||||||||
Sbjct: 469 ggttggcctatggctttgagtggtagggatatgattggtattgc 512



to top

>ref|XM_816398.1| Trypanosoma cruzi strain CL Brener ATP-dependent DEAD/H RNA
           helicase (Tc00.1047053510187.290) partial mRNA
          Length = 1788

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 581 gaggcagaccgtatgctcgatatgggttttga 612
           ||||| || ||||||||||||||||| |||||
Sbjct: 796 gaggccgatcgtatgctcgatatggggtttga 827



to top

>gb|BC060168.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47, mRNA (cDNA
           clone IMAGE:6826538), partial cds
          Length = 4039

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           |||||||| |||||||||||||||
Sbjct: 212 gcagaaacgggatctgggaaaaca 235



to top

>ref|XM_651823.1| Entamoeba histolytica HM-1:IMSS DEAD/DEAH box helicase, putative
           (6.t00035) partial mRNA
          Length = 1608

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 240 ttggtattgcagaaactggatctgggaaaaca 271
           ||||||||||||| |||||||| || ||||||
Sbjct: 581 ttggtattgcagagactggatcaggtaaaaca 612



to top

>ref|XM_759104.1| Theileria parva strain Muguga chromosome 4 RNA helicase (TP04_0562)
           partial mRNA
          Length = 1908

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 attgcagaaactggatctgg 264
           ||||||||||||||||||||
Sbjct: 757 attgcagaaactggatctgg 776



to top

>gb|AC136842.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBa0085C16, complete sequence
          Length = 156069

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 578    gatgaggcagaccgtatgctcgatatgggttttgaa 613
              |||||||||||  | ||||| |||||||||||||||
Sbjct: 135169 gatgaggcagatagaatgcttgatatgggttttgaa 135204



to top

>gb|AY274092.1| Coccyzus erythropthalmus phosphoenolpyruvate carboxykinase (PEPCK)
           gene, exon 9, intron 9, exon 10 and partial cds
          Length = 658

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 447 gagcacctaagggaccacaaatac 470
           ||||| ||||||||||||||||||
Sbjct: 485 gagcagctaagggaccacaaatac 508



to top

>emb|AL450389.12| Human DNA sequence from clone RP5-929G5 on chromosome 1 Contains the
             VANGL1 gene for vang-like 1 (van gogh, Drosophila), the 3'
             end of the CASQ2 gene for calsequestrin 2 (cardiac muscle)
             and one CpG island, complete sequence
          Length = 101623

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   ggctgttcaaatacaggcag 392
             ||||||||||||||||||||
Sbjct: 48002 ggctgttcaaatacaggcag 48021



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 575     ctggatgaggcagaccgtatgctcgatatggg 606
               ||||||||||||||||| ||||| || |||||
Sbjct: 1145913 ctggatgaggcagaccgcatgctggacatggg 1145882



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 575     ctggatgaggcagaccgtatgctcgatatggg 606
               ||||||||||||||||| ||||| || |||||
Sbjct: 1002881 ctggatgaggcagaccgcatgctggacatggg 1002850



to top

>ref|XM_505193.1| Yarrowia lipolytica CLIB122, YALI0F09141g predicted mRNA
          Length = 3660

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 222  tgaagggcagggacgtgattggta 245
            ||||||||||||||| ||||||||
Sbjct: 1018 tgaagggcagggacgagattggta 995



to top

>emb|CR388143.6| Zebrafish DNA sequence from clone DKEY-189O20 in linkage group 21,
              complete sequence
          Length = 243457

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 365    agagaactggctgttcaaatacag 388
              |||||||| |||||||||||||||
Sbjct: 118236 agagaacttgctgttcaaatacag 118213



to top

>gb|AE008734.1| Salmonella typhimurium LT2, section 42 of 220 of the complete
           genome
          Length = 21522

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 575 ctggatgaggcagaccgtatgctcgatatggg 606
           |||||||| || ||||||||||| ||||||||
Sbjct: 608 ctggatgaagccgaccgtatgctggatatggg 639



to top

>gb|BC099397.1| Mus musculus RIKEN cDNA E330009P21 gene, mRNA (cDNA clone
           MGC:117557 IMAGE:30936381), complete cds
          Length = 1497

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 619 gatggcccaattgtcttgat 638



to top

>emb|BX897699.1| Bartonella henselae strain Houston-1, complete genome
          Length = 1931047

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 575     ctggatgaggcagaccgtatgctcgatatggg 606
               |||||||||||||| |||||| | ||||||||
Sbjct: 1176903 ctggatgaggcagatcgtatgttagatatggg 1176872



to top

>emb|AL627268.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
             complete chromosome; segment 4/20
          Length = 294050

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 575   ctggatgaggcagaccgtatgctcgatatggg 606
             |||||||| || ||||||||||| ||||||||
Sbjct: 90847 ctggatgaagccgaccgtatgctggatatggg 90878



to top

>emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              5/7
          Length = 329861

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 587    gaccgtatgctcgatatgggtttt 610
              ||||||||||| ||||||||||||
Sbjct: 207992 gaccgtatgctggatatgggtttt 208015



to top

>gb|BC095944.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47, mRNA (cDNA
           clone MGC:106325 IMAGE:4935970), complete cds
          Length = 1762

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           |||||||| |||||||||||||||
Sbjct: 209 gcagaaacgggatctgggaaaaca 232



to top

>emb|BX647482.1|HSM807628 Homo sapiens genomic DNA; cDNA DKFZp686L02110 (from clone
            DKFZp686L02110)
          Length = 8436

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 214  gatggctttgaagggcaggg 233
            ||||||||||||||||||||
Sbjct: 2589 gatggctttgaagggcaggg 2608



to top

>emb|AJ719824.1| Gallus gallus mRNA for hypothetical protein, clone 6o10
          Length = 2510

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           ||||||||||| ||||||||||||
Sbjct: 224 gcagaaactggctctgggaaaaca 247



to top

>ref|NM_001007853.1| Gallus gallus DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 (DDX47),
           mRNA
          Length = 2510

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           ||||||||||| ||||||||||||
Sbjct: 224 gcagaaactggctctgggaaaaca 247



to top

>gb|AC105094.6| Homo sapiens chromosome 18, clone RP11-1096D5, complete sequence
          Length = 210317

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 464    caaatacgtgacctcaggag 483
              ||||||||||||||||||||
Sbjct: 102923 caaatacgtgacctcaggag 102942



to top

>gb|AC110997.4| Homo sapiens chromosome 18, clone RP11-56J20, complete sequence
          Length = 160456

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 464    caaatacgtgacctcaggag 483
              ||||||||||||||||||||
Sbjct: 116420 caaatacgtgacctcaggag 116439



to top

>dbj|AK136136.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420462A02 product:Similar to
           F-box protein FBX12 homolog [Mus musculus], full insert
           sequence
          Length = 1755

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 634 gatggcccaattgtcttgat 653



to top

>dbj|AK135949.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420440J21 product:Similar to
           F-box protein FBX12 homolog [Mus musculus], full insert
           sequence
          Length = 2244

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 638 gatggcccaattgtcttgat 657



to top

>gb|AC106746.2| Homo sapiens chromosome 5 clone RP11-149E17, complete sequence
          Length = 179868

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 397    tacaaagtttggatcatact 416
              ||||||||||||||||||||
Sbjct: 173426 tacaaagtttggatcatact 173445



to top

>gb|L80215.1|HUM69DC8Z Homo sapiens (subclone 1_a7 from P1 H69) DNA sequence
          Length = 3296

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 397 tacaaagtttggatcatact 416
           ||||||||||||||||||||
Sbjct: 28  tacaaagtttggatcatact 47



to top

>ref|NM_199036.1| Mus musculus F-box and WD-40 domain protein 15 (Fbxw15), mRNA
          Length = 1488

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 637 gatggcccaattgtcttgat 656



to top

>gb|AC118347.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0043E10, complete sequence
          Length = 124591

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 578   gatgaggcagaccgtatgctcgatatgggttttgaa 613
             |||||||||||  | ||||| |||||||||||||||
Sbjct: 97495 gatgaggcagatagaatgcttgatatgggttttgaa 97460



to top

>dbj|AK010310.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2400010F03 product:DEAD BOX PROTEIN homolog [Homo
           sapiens], full insert sequence
          Length = 1752

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           |||||||| |||||||||||||||
Sbjct: 225 gcagaaacgggatctgggaaaaca 248



to top

>gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosome 13, complete
             sequence
          Length = 180558

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   aaactggatctgggaaaaca 271
             ||||||||||||||||||||
Sbjct: 95822 aaactggatctgggaaaaca 95803



to top

>dbj|AK087902.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330038M07
           product:similar to F-box protein FBX12 (Fragment) [Mus
           musculus], full insert sequence
          Length = 910

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 636 gatggcccaattgtcttgat 655



to top

>gb|DQ067445.1| Mus musculus early ovarian protein-1 (Eop1) mRNA, complete cds
          Length = 1401

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 604 gatggcccaattgtcttgat 623



to top

>dbj|AK087710.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330009P21
           product:similar to F-BOX PROTEIN FBX12 (FRAGMENT) [Mus
           musculus], full insert sequence
          Length = 1487

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 638 gatggcccaattgtcttgat 657



to top

>dbj|AK087669.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330001M05
           product:similar to F-BOX PROTEIN FBX12 (FRAGMENT) [Mus
           musculus], full insert sequence
          Length = 1488

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 332 gatggcccaattgtcttgat 351
           ||||||||||||||||||||
Sbjct: 637 gatggcccaattgtcttgat 656



to top

>gb|BC103318.1| Bos taurus cDNA clone IMAGE:7941432, partial cds
          Length = 2409

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 455 aagggaccacaaatacgtga 474
           ||||||||||||||||||||
Sbjct: 790 aagggaccacaaatacgtga 809



to top

>dbj|AK076982.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930588A18 product:DEAD BOX PROTEIN
           homolog [Homo sapiens], full insert sequence
          Length = 1748

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           |||||||| |||||||||||||||
Sbjct: 217 gcagaaacgggatctgggaaaaca 240



to top

>ref|NM_001039431.1| Tribolium castaneum vasa RNA helicase (vasa), mRNA
          Length = 2183

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 247 tgcagaaactggatctgggaaaac 270
           |||| |||||||||||||||||||
Sbjct: 701 tgcacaaactggatctgggaaaac 724



to top

>tpg|BK001056.1| TPA: TPA_exp: Mus musculus kinesin-related protein KIF27A mRNA,
           complete cds
          Length = 4462

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 252 aaactggatctgggaaaaca 271
           ||||||||||||||||||||
Sbjct: 254 aaactggatctgggaaaaca 273



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 587     gaccgtatgctcgatatgggtttt 610
               ||||||||||| ||||||||||||
Sbjct: 1457322 gaccgtatgctggatatgggtttt 1457345



to top

>gb|AC147286.3| Pan troglodytes BAC clone RP43-75F15 from chromosome 7, complete
             sequence
          Length = 167461

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 214   gatggctttgaagggcaggg 233
             ||||||||||||||||||||
Sbjct: 54303 gatggctttgaagggcaggg 54284



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 575     ctggatgaggcagaccgtatgctcgatatggg 606
               |||||||| || ||||||||||| ||||||||
Sbjct: 2014820 ctggatgaagccgaccgtatgctggatatggg 2014789



to top

>gb|AF188678.1|AF188678 Pisum sativum P72 DEAD box protein mRNA, complete cds
          Length = 2924

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 578  gatgaggcagaccgtatgctcgatatgggttttgaa 613
            |||||||||||| | ||||| || ||||||||||||
Sbjct: 1100 gatgaggcagacaggatgctggacatgggttttgaa 1135



to top

>dbj|AK196692.1| Mus musculus cDNA, clone:Y1G0122J24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000032326, based on BLAT search
          Length = 387

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 gcagaaactggatctgggaaaaca 271
           |||||||| |||||||||||||||
Sbjct: 151 gcagaaacgggatctgggaaaaca 174



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 532     ggaagctggtcacacaaacc 551
               ||||||||||||||||||||
Sbjct: 5296703 ggaagctggtcacacaaacc 5296722



to top

>emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chromosome X, complete
              sequence
          Length = 216656

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 384    tacaggcagaagctacaaag 403
              ||||||||||||||||||||
Sbjct: 146934 tacaggcagaagctacaaag 146953



to top

>gb|AC005534.2|AC005534 Homo sapiens PAC clone RP5-982E9 from 7q35-q36, complete sequence
          Length = 158219

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 214   gatggctttgaagggcaggg 233
             ||||||||||||||||||||
Sbjct: 85135 gatggctttgaagggcaggg 85154



to top

>gb|AC131718.5| Mus musculus BAC clone RP23-171B16 from 6, complete sequence
          Length = 199299

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 248    gcagaaactggatctgggaaaaca 271
              |||||||| |||||||||||||||
Sbjct: 196376 gcagaaacgggatctgggaaaaca 196353



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 575     ctggatgaggcagaccgtatgctcgatatggg 606
               |||||||| || ||||||||||| ||||||||
Sbjct: 2131230 ctggatgaagccgaccgtatgctggatatggg 2131199



to top

>emb|AJ010934.1|RNO010934 Rattus norvegicus ddx5 gene, exons 2 to 5, partial
          Length = 894

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 254 actggatctgggaaaacactatct 277
           |||||||||||||||||| |||||
Sbjct: 719 actggatctgggaaaacattatct 742



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
              complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 575    ctggatgaggcagaccgtatgctcgatatggg 606
              |||||||| || ||||||||||| ||||||||
Sbjct: 914644 ctggatgaagccgaccgtatgctggatatggg 914675



to top

>gb|AY887136.1| Tribolium castaneum vasa RNA helicase mRNA, complete cds
          Length = 2183

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 247 tgcagaaactggatctgggaaaac 270
           |||| |||||||||||||||||||
Sbjct: 701 tgcacaaactggatctgggaaaac 724



to top

>gb|AC140287.3| Mus musculus BAC clone RP23-346L16 from 6, complete sequence
          Length = 213473

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 248    gcagaaactggatctgggaaaaca 271
              |||||||| |||||||||||||||
Sbjct: 110852 gcagaaacgggatctgggaaaaca 110829



to top

>gb|U17245.1|YSCL9328 Saccharomyces cerevisiae chromosome XII cosmid 9328
          Length = 14827

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 353   cttgctccaacaagagaactggct 376
             |||| |||||||||||||||||||
Sbjct: 10486 cttgttccaacaagagaactggct 10463



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     tgaagggcagggacgtgattggta 245
               ||||||||||||||| ||||||||
Sbjct: 1276550 tgaagggcagggacgagattggta 1276527



to top

>gb|L81906.1|HSL81906 Homo sapiens (subclone 2_f8 from P1 H69) DNA sequence, complete
            sequence
          Length = 4059

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 397  tacaaagtttggatcatact 416
            ||||||||||||||||||||
Sbjct: 4006 tacaaagtttggatcatact 4025



to top

>gb|AC001214.1|HSAC001214 Homo sapiens (subclone 1_a7 from P1 H69) DNA sequence, complete
           sequence
          Length = 3296

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 397 tacaaagtttggatcatact 416
           ||||||||||||||||||||
Sbjct: 28  tacaaagtttggatcatact 47



to top

>emb|AL606529.9| Human DNA sequence from clone RP4-744B2 on chromosome 1, complete
             sequence
          Length = 66822

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   ggctgttcaaatacaggcag 392
             ||||||||||||||||||||
Sbjct: 15927 ggctgttcaaatacaggcag 15946



to top

>emb|X94313.1|MMHLR1 M.musculus Hlr1 gene
          Length = 4670

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 254  actggatctgggaaaacactatct 277
            |||||||||||||||||| |||||
Sbjct: 4078 actggatctgggaaaacattatct 4101



to top

>dbj|D86601.1| Bombyx mori BmVLG mRNA, complete cds
          Length = 2790

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 575  ctggatgaggcagaccgtatgctcgatatggg 606
            ||||||||||| ||||||||| | ||||||||
Sbjct: 1096 ctggatgaggctgaccgtatgttagatatggg 1127



to top

>dbj|AB048845.1| Aurelia aurita mRNA for PL10-related protein CnPL10, partial cds
          Length = 364

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 cttgctccaacaagagaact 372
           ||||||||||||||||||||
Sbjct: 131 cttgctccaacaagagaact 150



to top

>emb|AL603664.16| Mouse DNA sequence from clone RP23-247J12 on chromosome 11, complete
              sequence
          Length = 158098

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 254    actggatctgggaaaacactatct 277
              |||||||||||||||||| |||||
Sbjct: 141812 actggatctgggaaaacattatct 141789


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,287,012
Number of Sequences: 3902068
Number of extensions: 4287012
Number of successful extensions: 98070
Number of sequences better than 10.0: 247
Number of HSP's better than 10.0 without gapping: 247
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 96854
Number of HSP's gapped (non-prelim): 1208
length of query: 613
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 590
effective length of database: 17,143,297,704
effective search space: 10114545645360
effective search space used: 10114545645360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top