Clone Name	baal11c13
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF024589.1| X Tritordeum sp. glycine decarboxylase P subunit ...	801	0.0
2	gb|U11693.1|ASU11693 Avena sativa victorin binding protein mRNA,...	698	0.0
3	ref|NM_191707.1| Oryza sativa (japonica cultivar-group), predic...	396	e-107
4	gb|AY346327.1| Oryza sativa (japonica cultivar-group) glycine de...	396	e-107
5	gb|AY495085.1| Oryza sativa (indica cultivar-group) glycine dehy...	381	e-102
6	gb|AF439729.1|AF439729 Zea mays glycine cleavage complex P-prote...	242	9e-61
7	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	192	8e-46
8	dbj|AP003626.3| Oryza sativa (japonica cultivar-group) genomic D...	192	8e-46
9	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	182	7e-43
10	dbj|AP003410.4| Oryza sativa (japonica cultivar-group) genomic D...	182	7e-43
11	dbj|AP002901.2| Oryza sativa (japonica cultivar-group) genomic D...	182	7e-43
12	gb|AY103920.1| Zea mays PCO082698 mRNA sequence	117	4e-23
13	dbj|AK111644.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	3e-14
14	emb|X59773.1|PSGDPP Pisum sativum mRNA for P protein, a part of ...	72	2e-09
15	gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ...	68	3e-08
16	ref|XM_314216.2| Anopheles gambiae str. PEST ENSANGP00000014378 ...	66	1e-07
17	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	58	3e-05
18	gb|AY462111.1| Pleurotus djamor ketopantoate reductase-like prot...	56	1e-04
19	ref|XM_741470.1| Aspergillus fumigatus Af293 glycine dehydrogena...	56	1e-04
20	emb|AL161582.2|ATCHRIV78 Arabidopsis thaliana DNA chromosome 4, ...	56	1e-04
21	emb|AL031804.1|ATF26P21 Arabidopsis thaliana DNA chromosome 4, B...	56	1e-04
22	emb|AL035525.1|ATF4I10 Arabidopsis thaliana DNA chromosome 4, BA...	56	1e-04
23	gb|AY544772.1| Brassica napus glycine decarboxylase P-protein-li...	56	1e-04
24	gb|AY544771.1| Moricandia nitens glycine decarboxylase P-protein...	56	1e-04
25	ref|NM_119455.2| Arabidopsis thaliana glycine dehydrogenase (dec...	54	4e-04
26	gb|BT000800.1| Arabidopsis thaliana At4g33010 mRNA sequence	54	4e-04
27	gb|BT000446.1| Arabidopsis thaliana P-Protein - like protein (At...	54	4e-04
28	gb|AY091186.1| Arabidopsis thaliana putative P-protein (At4g3301...	54	4e-04
29	gb|AY063903.1| Arabidopsis thaliana putative P-Protein (At4g3301...	54	4e-04
30	gb|AY128922.1| Arabidopsis thaliana P-protein-like protein (At4g...	54	4e-04
31	gb|AY065004.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, c...	54	4e-04
32	gb|AY058856.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, c...	54	4e-04
33	gb|AY042800.1| Arabidopsis thaliana P-Protein - like protein (F2...	54	4e-04
34	gb|BT001132.1| Arabidopsis thaliana At4g33010/F26P21_130 mRNA, c...	54	4e-04
35	gb|DQ226717.1| Boechera divaricarpa isolate SLW-A-A05 mRNA sequence	52	0.002
36	ref|XM_755229.1| Ustilago maydis 521 hypothetical protein (UM041...	52	0.002
37	emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete ...	52	0.002
38	gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...	50	0.007
39	gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...	50	0.007
40	emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...	50	0.007
41	gb|DQ056141.1| Coprinellus disseminatus strain IFO30972.17 glyci...	50	0.007
42	gb|DQ056140.1| Coprinellus disseminatus strain IFO30972.16 glyci...	50	0.007
43	gb|DQ056121.1| Coprinellus disseminatus strain TJ-01-05.8 glycin...	50	0.007
44	gb|DQ056120.1| Coprinellus disseminatus strain TJ-01-15.4 glycin...	50	0.007
45	gb|AE004934.1| Pseudomonas aeruginosa PAO1, section 495 of 529 o...	50	0.007
46	gb|AE004367.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	48	0.027
47	gb|DQ056139.1| Coprinellus disseminatus strain TJ-00-100.3 glyci...	48	0.027
48	gb|DQ056138.1| Coprinellus disseminatus strain TJ-00-100.1 glyci...	48	0.027
49	gb|DQ056137.1| Coprinellus disseminatus strain TJ-01-12.6 glycin...	48	0.027
50	gb|DQ056136.1| Coprinellus disseminatus strain TJ-01-06.5 glycin...	48	0.027
51	gb|DQ056135.1| Coprinellus disseminatus strain TJ-01-16.1 glycin...	48	0.027
52	gb|DQ056134.1| Coprinellus disseminatus strain TJ-00-91.2 glycin...	48	0.027
53	gb|DQ056133.1| Coprinellus disseminatus strain TJ-01-19.4 glycin...	48	0.027
54	gb|DQ056132.1| Coprinellus disseminatus strain TJ-01-17.1 glycin...	48	0.027
55	gb|DQ056131.1| Coprinellus disseminatus strain TJ-00.94.4 glycin...	48	0.027
56	gb|DQ056130.1| Coprinellus disseminatus strain TJ-01-10.3 glycin...	48	0.027
57	gb|DQ056129.1| Coprinellus disseminatus strain TJ-01-14.1 glycin...	48	0.027
58	gb|DQ056128.1| Coprinellus disseminatus strain TJ-00-99.3 glycin...	48	0.027
59	gb|DQ056127.1| Coprinellus disseminatus strain TJ-01-02.7 glycin...	48	0.027
60	gb|DQ056126.1| Coprinellus disseminatus strain TJ-01-11.2 glycin...	48	0.027
61	gb|DQ056125.1| Coprinellus disseminatus strain TJ-01-18.5 glycin...	48	0.027
62	gb|DQ056124.1| Coprinellus disseminatus strain TJ-01-19.2 glycin...	48	0.027
63	gb|DQ056123.1| Coprinellus disseminatus strain TJ-01-08.1 glycin...	48	0.027
64	gb|DQ056122.1| Coprinellus disseminatus strain TJ-01-14.2 glycin...	48	0.027
65	gb|DQ056119.1| Coprinellus disseminatus strain TJ-01-13.3 glycin...	48	0.027
66	gb|DQ056118.1| Coprinellus disseminatus strain TJ-01-13.8 glycin...	48	0.027
67	gb|DQ056117.1| Coprinellus disseminatus strain TJ-01-09.3 glycin...	48	0.027
68	gb|DQ056116.1| Coprinellus disseminatus strain TJ-00-38.6 glycin...	48	0.027
69	gb|DQ056115.1| Coprinellus disseminatus strain TJ-01-12.4 glycin...	48	0.027
70	gb|DQ056114.1| Coprinellus disseminatus strain TJ-01-07.1 glycin...	48	0.027
71	gb|DQ056113.1| Coprinellus disseminatus strain TJ-01-06.2 glycin...	48	0.027
72	gb|DQ056112.1| Coprinellus disseminatus strain TJ-00-89.2 glycin...	48	0.027
73	gb|DQ056111.1| Coprinellus disseminatus strain TJ-01-15.1 glycin...	48	0.027
74	gb|DQ056110.1| Coprinellus disseminatus strain TJ-01-07.6 glycin...	48	0.027
75	gb|DQ056109.1| Coprinellus disseminatus strain TJ-01-09.1 glycin...	48	0.027
76	gb|DQ056108.1| Coprinellus disseminatus strain TJ-01-11.5 glycin...	48	0.027
77	gb|DQ056107.1| Coprinellus disseminatus strain TJ-01-10.2 glycin...	48	0.027
78	gb|DQ056106.1| Coprinellus disseminatus strain TJ-01-16.3 glycin...	48	0.027
79	gb|DQ056105.1| Coprinellus disseminatus strain TJ-01-18.3 glycin...	48	0.027
80	gb|DQ056104.1| Coprinellus disseminatus strain TJ-00-38.3 glycin...	48	0.027
81	gb|DQ056103.1| Coprinellus disseminatus strain TJ-00-94.5 glycin...	48	0.027
82	gb|DQ056102.1| Coprinellus disseminatus strain TJ-01-17.6 glycin...	48	0.027
83	gb|DQ056101.1| Coprinellus disseminatus strain TJ-00-89.1 glycin...	48	0.027
84	gb|DQ056100.1| Coprinellus disseminatus strain TJ-01-20.6 glycin...	48	0.027
85	gb|DQ056099.1| Coprinellus disseminatus strain TJ-01-20.5 glycin...	48	0.027
86	gb|DQ056098.1| Coprinellus disseminatus strain TJ-01-05.1 glycin...	48	0.027
87	gb|DQ056097.1| Coprinellus disseminatus strain TJ-00-99.1 glycin...	48	0.027
88	gb|DQ056096.1| Coprinellus disseminatus strain TJ-01-08.2 glycin...	48	0.027
89	gb|DQ056095.1| Coprinellus disseminatus strain TJ-00-91.1 glycin...	48	0.027
90	gb|DQ056094.1| Coprinellus disseminatus strain TJ-01-04.4 glycin...	48	0.027
91	gb|DQ056093.1| Coprinellus disseminatus strain TJ-01-04.1 glycin...	48	0.027
92	gb|DQ056092.1| Coprinellus disseminatus strain TJ-01-02.5 glycin...	48	0.027
93	emb|Z99770.1|STZ99770 Solanum tuberosum cv. Desire mRNA for P-pr...	48	0.027
94	gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr...	46	0.11
95	ref|XM_569428.1| Cryptococcus neoformans var. neoformans JEC21 g...	46	0.11
96	dbj|AP004486.1| Lotus japonicus genomic DNA, chromosome 5, clone...	46	0.11
97	gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete s...	44	0.43
98	ref|NM_128167.2| Arabidopsis thaliana glycine dehydrogenase (dec...	42	1.7
99	gb|AF321274.2| Staphylococcus aureus SA2198 and disulfide bond p...	42	1.7
100	gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence	42	1.7
101	gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete...	42	1.7
102	emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g...	42	1.7
103	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	42	1.7
104	dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co...	42	1.7
105	gb|AC090968.14| Staphylococcus aureus strain NCTC 8325 clone sab...	42	1.7
106	gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete...	42	1.7
107	gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co...	42	1.7
108	gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl...	42	1.7
109	gb|AF396263.1|AF396262S2 Brucella melitensis biovar Abortus glyc...	42	1.7
110	gb|AE009691.1| Brucella melitensis 16M chromosome II, section 53...	42	1.7
111	ref|XM_219785.3| PREDICTED: Rattus norvegicus glycine dehydrogen...	42	1.7
112	dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com...	42	1.7
113	dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic...	42	1.7
114	gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	42	1.7
115	emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2...	42	1.7
116	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	42	1.7
117	gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta...	42	1.7
118	gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete...	42	1.7
119	emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II...	42	1.7
120	emb|AJ938182.1| Staphylococcus aureus RF122 complete genome	42	1.7
121	dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome	42	1.7
122	gb|CP000352.1| Ralstonia metallidurans CH34, complete genome	40	6.7
123	emb|CR381579.22| Zebrafish DNA sequence from clone CH211-229N1 i...	40	6.7
124	gb|AC138735.3| Gallus gallus clone TAM31-15F7, complete sequence	40	6.7
125	emb|CR361559.12| Zebrafish DNA sequence from clone DKEY-3P10 in ...	40	6.7
126	emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on ch...	40	6.7
127	gb|DQ056143.1| Coprinellus disseminatus strain C345.1 mating-typ...	40	6.7
128	gb|AC104232.5| Homo sapiens chromosome 8, clone RP11-1D12, compl...	40	6.7
129	gb|AC160141.2| Gallus gallus BAC clone CH261-182D6 from chromoso...	40	6.7
130	emb|BX548046.4| Zebrafish DNA sequence from clone DKEY-176G1 in ...	40	6.7
131	emb|BX005102.6| Zebrafish DNA sequence from clone CH211-105H13 i...	40	6.7
132	gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome	40	6.7
133	emb|AL807774.10| Mouse DNA sequence from clone RP23-198L2 on chr...	40	6.7
134	emb|BX005329.9| Zebrafish DNA sequence from clone DKEY-222F2, co...	40	6.7
135	gb|AC159212.3| Gallus gallus BAC clone CH261-173O18 from chromos...	40	6.7
136	emb|AL929346.5| Zebrafish DNA sequence from clone DKEY-38P12, co...	40	6.7

---

>gb|AF024589.1| X Tritordeum sp. glycine decarboxylase P subunit mRNA, complete cds
          Length = 3487

 Score =  801 bits (404), Expect = 0.0
 Identities = 473/495 (95%), Gaps = 1/495 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
            ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 1247 accagcaacat-ctgcaccgcgcaggcgttgctcgccaacatggcagcgatgtatgctgt 1305

                                                                        
Query: 61   ctaccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtac 120
            ||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1306 ctaccatgggcctgctggcctgaaggcgatcgccgaccgtgtccatggcctggctggtac 1365

                                                                        
Query: 121  tttcgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttga 180
            |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||
Sbjct: 1366 tttcgcccatggtttgaagaagctcgggacagtgacggtgcaagagctgccctacttcga 1425

                                                                        
Query: 181  cacggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacga 240
            ||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1426 cacggtcaagatcacttgcgctgatgctaatgcgattgccgaggaggcccgcaaaaacga 1485

                                                                        
Query: 241  gatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagaccaccac 300
            |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1486 gatgaaccttcgcgttgtcgacgcgaacacgatcaccgttgccttcgatgagaccaccac 1545

                                                                        
Query: 301  cttggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcac 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1546 cttggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtggacttcac 1605

                                                                        
Query: 361  agctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgcgacag 420
            |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1606 agctgaatccatcgcacctgaggtctcaagctcaattcctcctagccttgtgcgcgacag 1665

                                                                        
Query: 421  cccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctncgtta 480
            |||||||||||| |||||||||||||||||||||||||| |||||| ||||||| |||||
Sbjct: 1666 cccctacttgactcacccaatctttagcatgtaccacactgagcacgagctcctccgtta 1725

                           
Query: 481  cctgcacaagttgca 495
            |||||| ||||||||
Sbjct: 1726 cctgcataagttgca 1740

---

>gb|U11693.1|ASU11693 Avena sativa victorin binding protein mRNA, complete cds
          Length = 3408

 Score =  698 bits (352), Expect = 0.0
 Identities = 460/495 (92%), Gaps = 1/495 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
            ||||||||||| ||||||||||||||| ||||||||||||||||| || |||||||| ||
Sbjct: 1241 accagcaacat-ctgcaccgcgcaggccttgctcgccaacatggcagccatgtatgctgt 1299

                                                                        
Query: 61   ctaccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtac 120
            |||||||||||| ||||| || ||||| |||||||||||||||||||| |||||||||||
Sbjct: 1300 ctaccatggtcctgctgggctcaaggctatcgccgaccgtgtccatggcctggctggtac 1359

                                                                        
Query: 121  tttcgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttga 180
            |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1360 tttcgcccatgggttgaagaagctcgggacagtgaccgtgcaggagctgccctactttga 1419

                                                                        
Query: 181  cacggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacga 240
            ||| ||||||||||||||||| ||||| ||||| |||||||||||||| |||||||||||
Sbjct: 1420 caccgtcaagatcacttgcgctgatgccaatgctattgctgaggaggctcgcaaaaacga 1479

                                                                        
Query: 241  gatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagaccaccac 300
            ||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1480 gatgaaccttcgcgtcgtagacgcaaacacgatcaccgttgcctttgatgagacaaccac 1539

                                                                        
Query: 301  cttggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcac 360
            |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||
Sbjct: 1540 cttggaggatgttgacaagctgttcaaggtgttctctggtggcaagccagtggacttcac 1599

                                                                        
Query: 361  agctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgcgacag 420
            ||| ||||||||||| ||||| ||||||||||| ||||||   |||||||||||||||||
Sbjct: 1600 agccgaatccattgcacctgaagtctcaagctccattcctagcagccttgtgcgcgacag 1659

                                                                        
Query: 421  cccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctncgtta 480
            ||||||| | || ||||||||||||||||||||||||||||||||| |||| || |||||
Sbjct: 1660 cccctacctaactcacccaatctttagcatgtaccacacagagcacgagcttctccgtta 1719

                           
Query: 481  cctgcacaagttgca 495
            |||||||||||||||
Sbjct: 1720 cctgcacaagttgca 1734

---

>ref|NM_191707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3102

 Score =  396 bits (200), Expect = e-107
 Identities = 422/495 (85%), Gaps = 1/495 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
            ||||||||||| |||||| || ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 1174 accagcaacat-ctgcactgcccaggccttgctcgccaacatggcagcgatgtatgctgt 1232

                                                                        
Query: 61   ctaccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtac 120
            |||||||||||| |  || || ||||| || ||||||||||| || || |||||||||||
Sbjct: 1233 ctaccatggtcccgaggggctaaaggcaattgccgaccgtgtacacggcctggctggtac 1292

                                                                        
Query: 121  tttcgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttga 180
             || ||||||||  ||||||||||||| |||||||| |||||||| ||||| | ||||||
Sbjct: 1293 ctttgcccatggactgaagaagctcggaacagtgactgtgcaggaactgccgttctttga 1352

                                                                        
Query: 181  cacggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacga 240
            ||| |||||| |||    ||| ||||| ||||| |||||  |||||||| |||| |||||
Sbjct: 1353 cactgtcaaggtcaaggtcgctgatgcgaatgcgattgcccaggaggcctgcaagaacga 1412

                                                                        
Query: 241  gatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagaccaccac 300
            |||||||||||| ||||| || |||| |||||| ||||| ||||||||||||||||| ||
Sbjct: 1413 gatgaaccttcgtgttgttgatgcaaccacgataaccgtggcctttgatgagaccacaac 1472

                                                                        
Query: 301  cttggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcac 360
            ||| |||||||| ||||||||||||||||| |||  ||||||||||||||||  ||||||
Sbjct: 1473 cttagaggatgtcgacaagctgttcaaggtgttcaatggtggcaagccagtgaacttcac 1532

                                                                        
Query: 361  agctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgcgacag 420
             ||||||||| | ||  | ||||| ||||||||||||||   ||||||||||||| | ||
Sbjct: 1533 tgctgaatccctcgcatcagaggtgtcaagctcaattccgagtagccttgtgcgcaagag 1592

                                                                        
Query: 421  cccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctncgtta 480
            ||||||||| || ||||| ||||||| ||||||||| ||||||||| |||| || || ||
Sbjct: 1593 cccctacttaacacacccgatctttaacatgtaccatacagagcacgagcttctccgata 1652

                           
Query: 481  cctgcacaagttgca 495
            |||||||||||||||
Sbjct: 1653 cctgcacaagttgca 1667

---

>gb|AY346327.1| Oryza sativa (japonica cultivar-group) glycine dehydrogenase P
            protein mRNA, complete cds
          Length = 3102

 Score =  396 bits (200), Expect = e-107
 Identities = 422/495 (85%), Gaps = 1/495 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
            ||||||||||| |||||| || ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 1174 accagcaacat-ctgcactgcccaggccttgctcgccaacatggcagcgatgtatgctgt 1232

                                                                        
Query: 61   ctaccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtac 120
            |||||||||||| |  || || ||||| || ||||||||||| || || |||||||||||
Sbjct: 1233 ctaccatggtcccgaggggctaaaggcaattgccgaccgtgtacacggcctggctggtac 1292

                                                                        
Query: 121  tttcgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttga 180
             || ||||||||  ||||||||||||| |||||||| |||||||| ||||| | ||||||
Sbjct: 1293 ctttgcccatggactgaagaagctcggaacagtgactgtgcaggaactgccgttctttga 1352

                                                                        
Query: 181  cacggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacga 240
            ||| |||||| |||    ||| ||||| ||||| |||||  |||||||| |||| |||||
Sbjct: 1353 cactgtcaaggtcaaggtcgctgatgcgaatgcgattgcccaggaggcctgcaagaacga 1412

                                                                        
Query: 241  gatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagaccaccac 300
            |||||||||||| ||||| || |||| |||||| ||||| ||||||||||||||||| ||
Sbjct: 1413 gatgaaccttcgtgttgttgatgcaaccacgataaccgtggcctttgatgagaccacaac 1472

                                                                        
Query: 301  cttggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcac 360
            ||| |||||||| ||||||||||||||||| |||  ||||||||||||||||  ||||||
Sbjct: 1473 cttagaggatgtcgacaagctgttcaaggtgttcaatggtggcaagccagtgaacttcac 1532

                                                                        
Query: 361  agctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgcgacag 420
             ||||||||| | ||  | ||||| ||||||||||||||   ||||||||||||| | ||
Sbjct: 1533 tgctgaatccctcgcatcagaggtgtcaagctcaattccgagtagccttgtgcgcaagag 1592

                                                                        
Query: 421  cccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctncgtta 480
            ||||||||| || ||||| ||||||| ||||||||| ||||||||| |||| || || ||
Sbjct: 1593 cccctacttaacacacccgatctttaacatgtaccatacagagcacgagcttctccgata 1652

                           
Query: 481  cctgcacaagttgca 495
            |||||||||||||||
Sbjct: 1653 cctgcacaagttgca 1667

---

>gb|AY495085.1| Oryza sativa (indica cultivar-group) glycine dehydrogenase P protein
            (GDC) mRNA, complete cds
          Length = 2679

 Score =  381 bits (192), Expect = e-102
 Identities = 420/495 (84%), Gaps = 1/495 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
            ||||||||||| |||||| || ||||| ||||||||||||||||| ||||||||||| ||
Sbjct: 1168 accagcaacat-ctgcactgcccaggccttgctcgccaacatggcagcgatgtatgctgt 1226

                                                                        
Query: 61   ctaccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtac 120
            |||||||||||| |  || || ||||| || ||||||||||| || || |||||||||||
Sbjct: 1227 ctaccatggtcccgaggggctaaaggcaattgccgaccgtgtacacggcctggctggtac 1286

                                                                        
Query: 121  tttcgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttga 180
             || ||||||||  ||||||||||||| |||||||| |||||||| ||||| | ||||||
Sbjct: 1287 ctttgcccatggactgaagaagctcggaacagtgactgtgcaggaactgccgttctttga 1346

                                                                        
Query: 181  cacggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacga 240
            ||| |||||| |||    ||| ||||| ||||| |||||  |||||||| |||| |||||
Sbjct: 1347 cactgtcaaggtcaaggacgctgatgcgaatgcgattgcccaggaggcctgcaagaacga 1406

                                                                        
Query: 241  gatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagaccaccac 300
            |||||||||||| ||||| || |||| |||||| ||||| ||||||||||||||||| ||
Sbjct: 1407 gatgaaccttcgtgttgttgatgcaaccacgataaccgtggcctttgatgagaccacaac 1466

                                                                        
Query: 301  cttggaggatgttgacaagctgttcaaggttttctctggtggcaagccagtgggcttcac 360
            ||| |||||||| ||||||||||||||||| |||  ||||||||||||||||  ||||||
Sbjct: 1467 cttagaggatgtcgacaagctgttcaaggtgttcaatggtggcaagccagtgaacttcac 1526

                                                                        
Query: 361  agctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgcgacag 420
             ||||||||| | |   | ||||| ||||||||||||||   ||||||||||||| | ||
Sbjct: 1527 tgctgaatccctcgtatcagaggtgtcaagctcaattccgagtagccttgtgcgcaagag 1586

                                                                        
Query: 421  cccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctncgtta 480
            ||||||||| || ||||| ||||||| ||||||||| ||||||||  |||| || || ||
Sbjct: 1587 cccctacttaacacacccgatctttaacatgtaccatacagagcatgagcttctccgata 1646

                           
Query: 481  cctgcacaagttgca 495
            |||||||||||||||
Sbjct: 1647 cctgcacaagttgca 1661

---

>gb|AF439729.1|AF439729 Zea mays glycine cleavage complex P-protein mRNA, partial cds
          Length = 1109

 Score =  242 bits (122), Expect = 9e-61
 Identities = 279/330 (84%), Gaps = 1/330 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
           ||||||||||| |||||| || ||||| ||||||||||||||||| || ||||| || ||
Sbjct: 46  accagcaacat-ctgcactgcccaggccttgctcgccaacatggctgccatgtacgctgt 104

                                                                       
Query: 61  ctaccatggtccggctggcctgaaggcgatcgccgaccgtgtccatggactggctggtac 120
           ||||||||| || || || |||||||||||||| ||||| || ||||| |||||||| ||
Sbjct: 105 ctaccatggcccagcggggctgaaggcgatcgctgaccgggttcatggcctggctggcac 164

                                                                       
Query: 121 tttcgcccatggtttgaagaagctcgggacagtgacagtgcaggagctgccctactttga 180
            |||||||| ||  | |||||||||||||||||||| |||||||| ||||||| ||| ||
Sbjct: 165 cttcgcccacggcctcaagaagctcgggacagtgacggtgcaggacctgcccttcttcga 224

                                                                       
Query: 181 cacggtcaagatcacttgcgccgatgctaatgccattgctgaggaggcccgcaaaaacga 240
           |||||||| | |||| ||| |||||||   ||| || ||  |||| ||   ||| |||||
Sbjct: 225 cacggtcagggtcacgtgctccgatgcacgtgcaatcgccaaggaagctgtcaagaacga 284

                                                                       
Query: 241 gatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagaccaccac 300
           |||||||||||| || ||||| || ||||||||||| || || |||||||||||| ||||
Sbjct: 285 gatgaaccttcgggtcgtcgatgccaacacgatcactgtagcatttgatgagacctccac 344

                                         
Query: 301 cttggaggatgttgacaagctgttcaaggt 330
           | ||||||||||||||||||||||||||||
Sbjct: 345 cctggaggatgttgacaagctgttcaaggt 374



 Score =  113 bits (57), Expect = 6e-22
 Identities = 119/140 (85%)
 Strand = Plus / Plus

                                                                       
Query: 356 ttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgc 415
           ||||||||||||||||| || || |||||||||||||||||||||   |||||||  |||
Sbjct: 400 ttcacagctgaatccatcgcaccagaggtctcaagctcaattcctagcagccttgctcgc 459

                                                                       
Query: 416 gacagcccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctn 475
           || ||||||||| | || || ||| |||| | ||||||||||||||||||  |||| || 
Sbjct: 460 gagagcccctacctaacgcatccagtcttcaacatgtaccacacagagcatgagcttctt 519

                               
Query: 476 cgttacctgcacaagttgca 495
           ||||||||||| ||||||||
Sbjct: 520 cgttacctgcataagttgca 539

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  192 bits (97), Expect = 8e-46
 Identities = 196/229 (85%)
 Strand = Plus / Minus

                                                                            
Query: 24       aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 83
                |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 24020954 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 24020895

                                                                            
Query: 84       aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 143
                |||| || ||||||||||| ||||||||||||||||| || ||||| || ||||||||||
Sbjct: 24020894 aggcaattgccgaccgtgtacatggactggctggtacatttgcccaaggattgaagaagc 24020835

                                                                            
Query: 144      tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 203
                |||| |||||||| |||||||||||||||| ||| ||||| |||||| |||    ||| |
Sbjct: 24020834 tcggaacagtgacggtgcaggagctgcccttcttcgacactgtcaaggtcaaggtcgctg 24020775

                                                                 
Query: 204      atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcg 252
                | || ||||| |||||  |||||||| |||| |||||||||||||||||
Sbjct: 24020774 acgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcg 24020726



 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                            
Query: 275      accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 334
                ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 24020607 accgttgcctttgatgagaccacaaccttggaggatgtcgacaagctgttcaaggtgttc 24020548

                                 
Query: 335      tctggtggcaagccagt 351
                  |||||||||||||||
Sbjct: 24020547 aatggtggcaagccagt 24020531



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                            
Query: 355      cttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcg 414
                |||||| ||||||||| | || || ||||||||||||||||||||   ||||||||||||
Sbjct: 24020433 cttcactgctgaatccctcgcaccagaggtctcaagctcaattccgagtagccttgtgcg 24020374

                                                       
Query: 415      cgacagcccctacttgacccacccaatctttagcatgta 453
                | | ||||||||||| |||||||| ||||||| ||||||
Sbjct: 24020373 caagagcccctacttaacccacccgatctttaacatgta 24020335

---

>dbj|AP003626.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0429G06
          Length = 158321

 Score =  192 bits (97), Expect = 8e-46
 Identities = 196/229 (85%)
 Strand = Plus / Minus

                                                                         
Query: 24    aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 83
             |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 30647 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 30588

                                                                         
Query: 84    aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 143
             |||| || ||||||||||| ||||||||||||||||| || ||||| || ||||||||||
Sbjct: 30587 aggcaattgccgaccgtgtacatggactggctggtacatttgcccaaggattgaagaagc 30528

                                                                         
Query: 144   tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 203
             |||| |||||||| |||||||||||||||| ||| ||||| |||||| |||    ||| |
Sbjct: 30527 tcggaacagtgacggtgcaggagctgcccttcttcgacactgtcaaggtcaaggtcgctg 30468

                                                              
Query: 204   atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcg 252
             | || ||||| |||||  |||||||| |||| |||||||||||||||||
Sbjct: 30467 acgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcg 30419



 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                         
Query: 275   accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 334
             ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 30300 accgttgcctttgatgagaccacaaccttggaggatgtcgacaagctgttcaaggtgttc 30241

                              
Query: 335   tctggtggcaagccagt 351
               |||||||||||||||
Sbjct: 30240 aatggtggcaagccagt 30224



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                         
Query: 355   cttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcg 414
             |||||| ||||||||| | || || ||||||||||||||||||||   ||||||||||||
Sbjct: 30126 cttcactgctgaatccctcgcaccagaggtctcaagctcaattccgagtagccttgtgcg 30067

                                                    
Query: 415   cgacagcccctacttgacccacccaatctttagcatgta 453
             | | ||||||||||| |||||||| ||||||| ||||||
Sbjct: 30066 caagagcccctacttaacccacccgatctttaacatgta 30028

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  182 bits (92), Expect = 7e-43
 Identities = 209/248 (84%)
 Strand = Plus / Plus

                                                                            
Query: 24       aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 83
                |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 29555049 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 29555108

                                                                            
Query: 84       aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 143
                |||| || ||||||||||| || || ||||||||||| || ||||||||  |||||||||
Sbjct: 29555109 aggcaattgccgaccgtgtacacggcctggctggtacctttgcccatggactgaagaagc 29555168

                                                                            
Query: 144      tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 203
                |||| |||||||| |||||||| ||||| | ||||||||| |||||| |||    ||| |
Sbjct: 29555169 tcggaacagtgactgtgcaggaactgccgttctttgacactgtcaaggtcaaggtcgctg 29555228

                                                                            
Query: 204      atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgtcgacg 263
                |||| ||||| |||||  |||||||| |||| ||||||||||||||||| ||||| || |
Sbjct: 29555229 atgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgttgttgatg 29555288

                        
Query: 264      caaacacg 271
                ||| ||||
Sbjct: 29555289 caaccacg 29555296



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                            
Query: 275      accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 334
                ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 29555390 accgtggcctttgatgagaccacaaccttagaggatgtcgacaagctgttcaaggtgttc 29555449

                                 
Query: 335      tctggtggcaagccagt 351
                  |||||||||||||||
Sbjct: 29555450 aatggtggcaagccagt 29555466



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                            
Query: 355      cttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcg 414
                |||||| ||||||||| | ||  | ||||| ||||||||||||||   ||||||||||||
Sbjct: 29555562 cttcactgctgaatccctcgcatcagaggtgtcaagctcaattccgagtagccttgtgcg 29555621

                                                       
Query: 415      cgacagcccctacttgacccacccaatctttagcatgta 453
                | | ||||||||||| || ||||| ||||||| ||||||
Sbjct: 29555622 caagagcccctacttaacacacccgatctttaacatgta 29555660



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                             
Query: 451      gtaccacacagagcactagctcctncgttacctgcacaagttgca 495
                |||||| ||||||||| |||| || || |||||||||||||||||
Sbjct: 29555745 gtaccatacagagcacgagcttctccgatacctgcacaagttgca 29555789

---

>dbj|AP003410.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1142C05
          Length = 151457

 Score =  182 bits (92), Expect = 7e-43
 Identities = 209/248 (84%)
 Strand = Plus / Plus

                                                                         
Query: 24    aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 83
             |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 24869 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 24928

                                                                         
Query: 84    aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 143
             |||| || ||||||||||| || || ||||||||||| || ||||||||  |||||||||
Sbjct: 24929 aggcaattgccgaccgtgtacacggcctggctggtacctttgcccatggactgaagaagc 24988

                                                                         
Query: 144   tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 203
             |||| |||||||| |||||||| ||||| | ||||||||| |||||| |||    ||| |
Sbjct: 24989 tcggaacagtgactgtgcaggaactgccgttctttgacactgtcaaggtcaaggtcgctg 25048

                                                                         
Query: 204   atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgtcgacg 263
             |||| ||||| |||||  |||||||| |||| ||||||||||||||||| ||||| || |
Sbjct: 25049 atgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgttgttgatg 25108

                     
Query: 264   caaacacg 271
             ||| ||||
Sbjct: 25109 caaccacg 25116



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                         
Query: 275   accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 334
             ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 25210 accgtggcctttgatgagaccacaaccttagaggatgtcgacaagctgttcaaggtgttc 25269

                              
Query: 335   tctggtggcaagccagt 351
               |||||||||||||||
Sbjct: 25270 aatggtggcaagccagt 25286



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                         
Query: 355   cttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcg 414
             |||||| ||||||||| | ||  | ||||| ||||||||||||||   ||||||||||||
Sbjct: 25382 cttcactgctgaatccctcgcatcagaggtgtcaagctcaattccgagtagccttgtgcg 25441

                                                    
Query: 415   cgacagcccctacttgacccacccaatctttagcatgta 453
             | | ||||||||||| || ||||| ||||||| ||||||
Sbjct: 25442 caagagcccctacttaacacacccgatctttaacatgta 25480



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                          
Query: 451   gtaccacacagagcactagctcctncgttacctgcacaagttgca 495
             |||||| ||||||||| |||| || || |||||||||||||||||
Sbjct: 25565 gtaccatacagagcacgagcttctccgatacctgcacaagttgca 25609

---

>dbj|AP002901.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0456F08
          Length = 156850

 Score =  182 bits (92), Expect = 7e-43
 Identities = 209/248 (84%)
 Strand = Plus / Plus

                                                                          
Query: 24     aggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccggctggcctga 83
              |||| ||||||||||||||||| ||||||||||| |||||||||||||| |  || || |
Sbjct: 121323 aggccttgctcgccaacatggcagcgatgtatgctgtctaccatggtcccgaggggctaa 121382

                                                                          
Query: 84     aggcgatcgccgaccgtgtccatggactggctggtactttcgcccatggtttgaagaagc 143
              |||| || ||||||||||| || || ||||||||||| || ||||||||  |||||||||
Sbjct: 121383 aggcaattgccgaccgtgtacacggcctggctggtacctttgcccatggactgaagaagc 121442

                                                                          
Query: 144    tcgggacagtgacagtgcaggagctgccctactttgacacggtcaagatcacttgcgccg 203
              |||| |||||||| |||||||| ||||| | ||||||||| |||||| |||    ||| |
Sbjct: 121443 tcggaacagtgactgtgcaggaactgccgttctttgacactgtcaaggtcaaggtcgctg 121502

                                                                          
Query: 204    atgctaatgccattgctgaggaggcccgcaaaaacgagatgaaccttcgcgttgtcgacg 263
              |||| ||||| |||||  |||||||| |||| ||||||||||||||||| ||||| || |
Sbjct: 121503 atgcgaatgcgattgcccaggaggcctgcaagaacgagatgaaccttcgtgttgttgatg 121562

                      
Query: 264    caaacacg 271
              ||| ||||
Sbjct: 121563 caaccacg 121570



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                          
Query: 275    accgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttc 334
              ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||
Sbjct: 121664 accgtggcctttgatgagaccacaaccttagaggatgtcgacaagctgttcaaggtgttc 121723

                               
Query: 335    tctggtggcaagccagt 351
                |||||||||||||||
Sbjct: 121724 aatggtggcaagccagt 121740



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                          
Query: 355    cttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcg 414
              |||||| ||||||||| | ||  | ||||| ||||||||||||||   ||||||||||||
Sbjct: 121836 cttcactgctgaatccctcgcatcagaggtgtcaagctcaattccgagtagccttgtgcg 121895

                                                     
Query: 415    cgacagcccctacttgacccacccaatctttagcatgta 453
              | | ||||||||||| || ||||| ||||||| ||||||
Sbjct: 121896 caagagcccctacttaacacacccgatctttaacatgta 121934



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                           
Query: 451    gtaccacacagagcactagctcctncgttacctgcacaagttgca 495
              |||||| ||||||||| |||| || || |||||||||||||||||
Sbjct: 122019 gtaccatacagagcacgagcttctccgatacctgcacaagttgca 122063

---

>gb|AY103920.1| Zea mays PCO082698 mRNA sequence
          Length = 2092

 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Plus

                                                                       
Query: 236 aacgagatgaaccttcgcgttgtcgacgcaaacacgatcaccgttgcctttgatgagacc 295
           ||||||||||||||||| || ||||| || ||||||||||| || || ||||||||||||
Sbjct: 58  aacgagatgaaccttcgggtcgtcgatgccaacacgatcactgtagcatttgatgagacc 117

                                              
Query: 296 accaccttggaggatgttgacaagctgttcaaggt 330
            ||||| ||||||||||||||||||||||||||||
Sbjct: 118 tccaccctggaggatgttgacaagctgttcaaggt 152



 Score =  105 bits (53), Expect = 1e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 356 ttcacagctgaatccattgcgcctgaggtctcaagctcaattcctcctagccttgtgcgc 415
           |||||||| |||||||| || || |||||||||||||||||||||   |||||||  |||
Sbjct: 178 ttcacagccgaatccatcgcaccagaggtctcaagctcaattcctagcagccttgctcgc 237

                                                                       
Query: 416 gacagcccctacttgacccacccaatctttagcatgtaccacacagagcactagctcctn 475
           || ||||||||| | || || ||| |||| | ||||||||||||||||||  |||| || 
Sbjct: 238 gagagcccctacctaacgcatccagtcttcaacatgtaccacacagagcatgagcttctt 297

                               
Query: 476 cgttacctgcacaagttgca 495
           ||||||||||| ||||||||
Sbjct: 298 cgttacctgcataagttgca 317

---

>dbj|AK111644.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013129F05, full
           insert sequence
          Length = 1836

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 405 gccttgtgcgcgacagcccctacttgacccacccaatctttagcatgtaccacacagagc 464
           ||||||||||| | ||||||||||| |||||||| ||||||| ||||||||| |||||||
Sbjct: 1   gccttgtgcgcaagagcccctacttaacccacccgatctttaacatgtaccatacagagc 60

                                          
Query: 465 actagctcctncgttacctgcacaagttgca 495
           |  |||| || || |||||| ||||||||||
Sbjct: 61  atgagcttctccgctacctgtacaagttgca 91

---

>emb|X59773.1|PSGDPP Pisum sativum mRNA for P protein, a part of glycine cleavage complex
          Length = 3404

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                        
Query: 265  aaacacgatcaccgttgcctttgatgagaccaccaccttggaggatgttgacaagctgtt 324
            |||||| ||||||| ||| ||||| || || ||||| || ||||||||||| ||||| ||
Sbjct: 1588 aaacactatcaccgctgcttttgacgaaacaaccacgttagaggatgttgataagctttt 1647

                                    
Query: 325  caaggttttctctggtggcaagcc 348
            ||| |||||| |||||||||||||
Sbjct: 1648 caaagttttcgctggtggcaagcc 1671

---

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                           
Query: 13      ctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 72
               |||||||||||||| | | ||||||  |||||| |||||||| ||||||||||| |||||
Sbjct: 1711634 ctgcaccgcgcaggtgctcctcgccgtcatggccgcgatgtacgccgtctaccacggtcc 1711575

                         
Query: 73      ggctggcctg 82
               ||| ||||||
Sbjct: 1711574 ggcgggcctg 1711565

---

>ref|XM_314216.2| Anopheles gambiae str. PEST ENSANGP00000014378 (ENSANGG00000011889),
            partial mRNA
          Length = 2895

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 61/69 (88%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                        
Query: 4    agcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtcta 63
            |||||||| ||||||||| |||||| |||||||||||||||| |||||||| ||  ||||
Sbjct: 994  agcaacat-ctgcaccgcccaggcgctgctcgccaacatggccgcgatgtacgcgatcta 1052

                     
Query: 64   ccatggtcc 72
            ||| |||||
Sbjct: 1053 ccacggtcc 1061

---

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                               
Query: 13     ctgcaccgcgcaggcgttgctcgccaacatggc 45
              |||||||||||||||| ||||||||||||||||
Sbjct: 710382 ctgcaccgcgcaggcgctgctcgccaacatggc 710414

---

>gb|AY462111.1| Pleurotus djamor ketopantoate reductase-like protein (KPAR), GDP-fucose
             transporter-like protein (GDPF), glycine
             dehydrogenase-like protein (GLYDH), hypothetical protein
             PDUPA1 (PDUPA1) genes, complete cds; HD2 homeodomain
             mating-type protein (a2) gene, a2-A7 allele, complete cds;
             HD1 homeodomain mating-type protein (a1) gene, a1-A7
             allele, complete cds; mitochondrial intermediate peptidase
             (MIP) gene, complete cds, nuclear gene for mitochondrial
             protein; hypothetical protein PDUPA2 (UPA2), hypothetical
             protein PDUPA3 (UPA3), putative glycogenin protein
             (GLGEN), putative NADH:flavin oxidoreductase 1 (FMNOR1),
             putative NADH:flavin oxidoreductase 2 (FMNOR2), and
             hypothetical protein PDUPA4 (UPA4) genes, complete cds
          Length = 75294

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 35    gccaacatggcggcgatgtatgccgtctaccatggtccgg 74
             ||||||||||| ||||||||||| ||||| ||||||||||
Sbjct: 21385 gccaacatggctgcgatgtatgctgtctatcatggtccgg 21424

---

>ref|XM_741470.1| Aspergillus fumigatus Af293 glycine dehydrogenase (Afu4g03760)
            partial mRNA
          Length = 3183

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                        
Query: 14   tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtccg 73
            |||||||| |||||  |||| |||||||||   || ||||||||||| ||||| ||||||
Sbjct: 1285 tgcaccgctcaggctctgcttgccaacatgagtgccatgtatgccgtttaccacggtccg 1344

                                
Query: 74   gctggcctgaaggcgatcgc 93
            || ||||| ||| |||||||
Sbjct: 1345 gccggcctcaagtcgatcgc 1364

---

>emb|AL161582.2|ATCHRIV78 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 78
          Length = 198669

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 22     gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
              |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 151576 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 151529

---

>emb|AL031804.1|ATF26P21 Arabidopsis thaliana DNA chromosome 4, BAC clone F26P21 (ESSA project)
          Length = 94482

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 22    gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
             |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 60880 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 60833

---

>emb|AL035525.1|ATF4I10 Arabidopsis thaliana DNA chromosome 4, BAC clone F4I10 (ESSA project)
          Length = 111876

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 22   gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 4116 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 4069

---

>gb|AY544772.1| Brassica napus glycine decarboxylase P-protein-like gene, partial
            sequence
          Length = 3254

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 22   gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 2921 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 2968

---

>gb|AY544771.1| Moricandia nitens glycine decarboxylase P-protein gene, partial cds
          Length = 2966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 22   gcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 2632 gcaggcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 2679

---

>ref|NM_119455.2| Arabidopsis thaliana glycine dehydrogenase (decarboxylating)
            AT4G33010 mRNA, complete cds
          Length = 3478

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1803 acccacccaatcttcaacatgtaccacacagagca 1837



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1398 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1441

---

>gb|BT000800.1| Arabidopsis thaliana At4g33010 mRNA sequence
          Length = 3377

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1719 acccacccaatcttcaacatgtaccacacagagca 1753



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1313 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1356

---

>gb|BT000446.1| Arabidopsis thaliana P-Protein - like protein (At4g33010) mRNA,
            complete cds
          Length = 3344

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1704 acccacccaatcttcaacatgtaccacacagagca 1738



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1299 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1342

---

>gb|AY091186.1| Arabidopsis thaliana putative P-protein (At4g33010) mRNA, complete
            cds
          Length = 3145

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1621 acccacccaatcttcaacatgtaccacacagagca 1655



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1216 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1259

---

>gb|AY063903.1| Arabidopsis thaliana putative P-Protein (At4g33010) mRNA, complete
            cds
          Length = 3420

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1771 acccacccaatcttcaacatgtaccacacagagca 1805



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1366 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1409

---

>gb|AY128922.1| Arabidopsis thaliana P-protein-like protein (At4g33010) mRNA,
            complete cds
          Length = 3153

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1621 acccacccaatcttcaacatgtaccacacagagca 1655



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1216 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1259

---

>gb|AY065004.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, complete cds
          Length = 3429

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1803 acccacccaatcttcaacatgtaccacacagagca 1837



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1398 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1441

---

>gb|AY058856.1| Arabidopsis thaliana AT4g33010/F26P21_130 mRNA, complete cds
          Length = 2249

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 431 acccacccaatctttagcatgtaccacacagagca 465
           |||||||||||||| | ||||||||||||||||||
Sbjct: 609 acccacccaatcttcaacatgtaccacacagagca 643



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 26  gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 204 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 247

---

>gb|AY042800.1| Arabidopsis thaliana P-Protein - like protein (F26P21.130) mRNA,
            complete cds
          Length = 3423

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1797 acccacccaatcttcaacatgtaccacacagagca 1831



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1392 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1435

---

>gb|BT001132.1| Arabidopsis thaliana At4g33010/F26P21_130 mRNA, complete cds
          Length = 3114

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 431  acccacccaatctttagcatgtaccacacagagca 465
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1621 acccacccaatcttcaacatgtaccacacagagca 1655



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 26   gcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            |||||||| ||||||||||| || |||||||| || ||||||||
Sbjct: 1216 gcgttgcttgccaacatggctgccatgtatgctgtttaccatgg 1259

---

>gb|DQ226717.1| Boechera divaricarpa isolate SLW-A-A05 mRNA sequence
          Length = 436

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                            
Query: 23 caggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 72
          ||||||||||| || |||||| | ||||||||||| || |||||||||||
Sbjct: 7  caggcgttgcttgcaaacatgactgcgatgtatgctgtttaccatggtcc 56



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 419 agcccctacttgacccacccaatctt 444
           ||||| ||||||||||||||||||||
Sbjct: 403 agcccttacttgacccacccaatctt 428

---

>ref|XM_755229.1| Ustilago maydis 521 hypothetical protein (UM04175.1) partial mRNA
          Length = 3240

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 13   ctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctacca 66
            |||||| || |||||| | |||||||||||| |||| ||||| |||||||||||
Sbjct: 1239 ctgcactgcccaggcgcttctcgccaacatgtcggccatgtacgccgtctacca 1292

---

>emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete genome; segment 5/29
          Length = 339650

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 57/66 (86%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                          
Query: 1      accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
              ||||||||||| |||||||||||||| | ||||||||  |||||| |  ||||| |||||
Sbjct: 254257 accagcaacat-ctgcaccgcgcaggtgctgctcgccgtcatggccggcatgtacgccgt 254199

                    
Query: 61     ctacca 66
              ||||||
Sbjct: 254198 ctacca 254193

---

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                           
Query: 13      ctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 72
               |||||||||||||||| ||||||| | |||||||   ||||| || |||||||| || ||
Sbjct: 3098096 ctgcaccgcgcaggcgctgctcgcgatcatggcgagcatgtacgcggtctaccacggccc 3098037

                                    
Query: 73      ggctggcctgaaggcgatcgc 93
               |   ||||||||| |||||||
Sbjct: 3098036 gcgcggcctgaagacgatcgc 3098016

---

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                          
Query: 13     ctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 72
              |||||||||||||||| ||||||| | |||||||   ||||| || |||||||| || ||
Sbjct: 135988 ctgcaccgcgcaggcgctgctcgcgatcatggcgagcatgtacgcggtctaccacggccc 136047

                                   
Query: 73     ggctggcctgaaggcgatcgc 93
              |   ||||||||| |||||||
Sbjct: 136048 gcgcggcctgaagacgatcgc 136068

---

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                           
Query: 13      ctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 72
               |||||||||||||||| ||||||| | |||||||   ||||| || |||||||| || ||
Sbjct: 3987607 ctgcaccgcgcaggcgctgctcgcgatcatggcgagcatgtacgcggtctaccacggccc 3987666

                                    
Query: 73      ggctggcctgaaggcgatcgc 93
               |   ||||||||| |||||||
Sbjct: 3987667 gcgcggcctgaagacgatcgc 3987687

---

>gb|DQ056141.1| Coprinellus disseminatus strain IFO30972.17 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 29  ttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           ||||||||||||||||| || |||||||| || ||||||||
Sbjct: 111 ttgctcgccaacatggctgctatgtatgcggtataccatgg 151

---

>gb|DQ056140.1| Coprinellus disseminatus strain IFO30972.16 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 29  ttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           ||||||||||||||||| || |||||||| || ||||||||
Sbjct: 111 ttgctcgccaacatggctgctatgtatgcagtataccatgg 151

---

>gb|DQ056121.1| Coprinellus disseminatus strain TJ-01-05.8 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 59/69 (85%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
           |||||||||||  |||||||| || || ||||||||||||||||| || ||||| || ||
Sbjct: 84  accagcaacatt-tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagt 142

                    
Query: 61  ctaccatgg 69
            ||||||||
Sbjct: 143 gtaccatgg 151

---

>gb|DQ056120.1| Coprinellus disseminatus strain TJ-01-15.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 59/69 (85%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
           |||||||||||  |||||||| || || ||||||||||||||||| || ||||| || ||
Sbjct: 84  accagcaacatt-tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagt 142

                    
Query: 61  ctaccatgg 69
            ||||||||
Sbjct: 143 gtaccatgg 151

---

>gb|AE004934.1| Pseudomonas aeruginosa PAO1, section 495 of 529 of the complete
            genome
          Length = 12908

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 13   ctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            ||||||||| |||| | |||| |||||||| ||  || |||||||||||||||||||
Sbjct: 6319 ctgcaccgcccaggtgctgctggccaacattgcttcgctgtatgccgtctaccatgg 6263

---

>gb|AE004367.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 24
            of 93 of the complete chromosome
          Length = 10069

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 17   accgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatggtcc 72
            |||||||| ||| |||| ||||||||||| ||| | ||||| || |||||||||||
Sbjct: 6041 accgcgcaagcgctgctggccaacatggctgcgttttatgcggtgtaccatggtcc 5986

---

>gb|DQ056139.1| Coprinellus disseminatus strain TJ-00-100.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056138.1| Coprinellus disseminatus strain TJ-00-100.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056137.1| Coprinellus disseminatus strain TJ-01-12.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056136.1| Coprinellus disseminatus strain TJ-01-06.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 94  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 149

---

>gb|DQ056135.1| Coprinellus disseminatus strain TJ-01-16.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056134.1| Coprinellus disseminatus strain TJ-00-91.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056133.1| Coprinellus disseminatus strain TJ-01-19.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056132.1| Coprinellus disseminatus strain TJ-01-17.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056131.1| Coprinellus disseminatus strain TJ-00.94.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056130.1| Coprinellus disseminatus strain TJ-01-10.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056129.1| Coprinellus disseminatus strain TJ-01-14.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056128.1| Coprinellus disseminatus strain TJ-00-99.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056127.1| Coprinellus disseminatus strain TJ-01-02.7 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056126.1| Coprinellus disseminatus strain TJ-01-11.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056125.1| Coprinellus disseminatus strain TJ-01-18.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 94  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 149

---

>gb|DQ056124.1| Coprinellus disseminatus strain TJ-01-19.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 94  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 149

---

>gb|DQ056123.1| Coprinellus disseminatus strain TJ-01-08.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 94  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 149

---

>gb|DQ056122.1| Coprinellus disseminatus strain TJ-01-14.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 94  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 149

---

>gb|DQ056119.1| Coprinellus disseminatus strain TJ-01-13.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056118.1| Coprinellus disseminatus strain TJ-01-13.8 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056117.1| Coprinellus disseminatus strain TJ-01-09.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056116.1| Coprinellus disseminatus strain TJ-00-38.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056115.1| Coprinellus disseminatus strain TJ-01-12.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056114.1| Coprinellus disseminatus strain TJ-01-07.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056113.1| Coprinellus disseminatus strain TJ-01-06.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056112.1| Coprinellus disseminatus strain TJ-00-89.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056111.1| Coprinellus disseminatus strain TJ-01-15.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056110.1| Coprinellus disseminatus strain TJ-01-07.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056109.1| Coprinellus disseminatus strain TJ-01-09.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056108.1| Coprinellus disseminatus strain TJ-01-11.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056107.1| Coprinellus disseminatus strain TJ-01-10.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056106.1| Coprinellus disseminatus strain TJ-01-16.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056105.1| Coprinellus disseminatus strain TJ-01-18.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056104.1| Coprinellus disseminatus strain TJ-00-38.3 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056103.1| Coprinellus disseminatus strain TJ-00-94.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056102.1| Coprinellus disseminatus strain TJ-01-17.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056101.1| Coprinellus disseminatus strain TJ-00-89.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056100.1| Coprinellus disseminatus strain TJ-01-20.6 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056099.1| Coprinellus disseminatus strain TJ-01-20.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056098.1| Coprinellus disseminatus strain TJ-01-05.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056097.1| Coprinellus disseminatus strain TJ-00-99.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056096.1| Coprinellus disseminatus strain TJ-01-08.2 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056095.1| Coprinellus disseminatus strain TJ-00-91.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagccttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056094.1| Coprinellus disseminatus strain TJ-01-04.4 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 94  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 149

---

>gb|DQ056093.1| Coprinellus disseminatus strain TJ-01-04.1 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>gb|DQ056092.1| Coprinellus disseminatus strain TJ-01-02.5 glycine dehydrogenase
           (GLYDH) gene, partial cds
          Length = 617

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 14  tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
           |||||||| || || ||||||||||||||||| || ||||| || || ||||||||
Sbjct: 96  tgcaccgcccaagctttgctcgccaacatggctgccatgtacgcagtgtaccatgg 151

---

>emb|Z99770.1|STZ99770 Solanum tuberosum cv. Desire mRNA for P-protein
          Length = 3381

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 14   tgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgtctaccatgg 69
            ||||| || ||||| ||||| ||||||||||| || |||||||| ||||| |||||
Sbjct: 1239 tgcacagcacaggctttgcttgccaacatggctgccatgtatgctgtctatcatgg 1294

---

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
              sequence
          Length = 2105742

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 32     ctcgccaacatggcggcgatgtatgccgtctacca 66
              |||||||||||||| || ||||| |||||||||||
Sbjct: 307127 ctcgccaacatggccgccatgtacgccgtctacca 307161

---

>ref|XM_569428.1| Cryptococcus neoformans var. neoformans JEC21 glycine dehydrogenase
            mitochondrial precursor (CNC01070) partial mRNA
          Length = 3385

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 32   ctcgccaacatggcggcgatgtatgccgtctacca 66
            |||||||||||||| || ||||| |||||||||||
Sbjct: 1262 ctcgccaacatggccgccatgtacgccgtctacca 1296

---

>dbj|AP004486.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT05B20, TM0019a,
            complete sequence
          Length = 73833

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 278  gttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggttttctct 337
            ||||| |||||||| || | ||| || ||||||||||||||||| ||| | || ||  ||
Sbjct: 7773 gttgcttttgatgaaacaatcacattagaggatgttgacaagcttttccaagtgtttgct 7714

                       
Query: 338  ggtggcaagcc 348
            |||||||||||
Sbjct: 7713 ggtggcaagcc 7703

---

>gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete sequence
          Length = 106968

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                         
Query: 271   gatcaccgttgcctttgatgagaccaccaccttggaggatgttgacaagctgttcaaggt 330
             |||||| | ||| |||||||| || || || || ||||||||||| ||||| ||||| ||
Sbjct: 72163 gatcactgctgcgtttgatgaaacaactacattagaggatgttgataagcttttcaaagt 72104

                               
Query: 331   tttctctggtggcaagcc 348
             |||  | |||||||||||
Sbjct: 72103 ttttgccggtggcaagcc 72086

---

>ref|NM_128167.2| Arabidopsis thaliana glycine dehydrogenase (decarboxylating)
            AT2G26080 mRNA, complete cds
          Length = 3487

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 429  tgacccacccaatctttagcatgtaccacacagagca 465
            ||||||| |||||||| | |||||||||||| |||||
Sbjct: 1679 tgacccatccaatcttcaacatgtaccacacggagca 1715

---

>gb|AF321274.2| Staphylococcus aureus SA2198 and disulfide bond protein A (dsbA)
           genes, complete cds
          Length = 1076

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 266 aacacgatcaccgttgccttt 286
           |||||||||||||||||||||
Sbjct: 243 aacacgatcaccgttgccttt 223

---

>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence
          Length = 1207381

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 13     ctgcaccgcgcaggcgttgctcgccaacatggc 45
              |||||||||||||||| | || |||||||||||
Sbjct: 710724 ctgcaccgcgcaggcgcttctggccaacatggc 710692

---

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 61/73 (83%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                           
Query: 1       accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
               ||||||||||| ||||||||| |||| | | || |||||||| ||    ||||| |||||
Sbjct: 1240477 accagcaacat-ctgcaccgcacaggtgctactggccaacatcgccagcatgtacgccgt 1240419

                            
Query: 61      ctaccatggtccg 73
               |||||||||||||
Sbjct: 1240418 ctaccatggtccg 1240406

---

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2460197 aacacgatcaccgttgccttt 2460217

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 15      gcaccgcgcaggcgttgctcg 35
               |||||||||||||||||||||
Sbjct: 2534182 gcaccgcgcaggcgttgctcg 2534162

---

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2538641 aacacgatcaccgttgccttt 2538661

---

>gb|AC090968.14| Staphylococcus aureus strain NCTC 8325 clone sabac-126, complete
            sequence
          Length = 39425

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 266  aacacgatcaccgttgccttt 286
            |||||||||||||||||||||
Sbjct: 5449 aacacgatcaccgttgccttt 5429

---

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2468137 aacacgatcaccgttgccttt 2468157

---

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2478802 aacacgatcaccgttgccttt 2478822

---

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2531700 aacacgatcaccgttgccttt 2531720

---

>gb|AF396263.1|AF396262S2 Brucella melitensis biovar Abortus glycine cleavage system P
           protein (gcvP) gene, complete cds
          Length = 2800

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 13  ctgcaccgcgcaggcgttgctcgccaacatggc 45
           |||||||||||||||| | || |||||||||||
Sbjct: 967 ctgcaccgcgcaggcgcttctggccaacatggc 999

---

>gb|AE009691.1| Brucella melitensis 16M chromosome II, section 53 of 107 of the
             complete sequence
          Length = 12340

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 13    ctgcaccgcgcaggcgttgctcgccaacatggc 45
             |||||||||||||||| | || |||||||||||
Sbjct: 10084 ctgcaccgcgcaggcgcttctggccaacatggc 10116

---

>ref|XM_219785.3| PREDICTED: Rattus norvegicus glycine dehydrogenase (decarboxylating;
            glycine decarboxylase, glycine cleavage system protein P)
            (predicted) (Gldc_predicted), mRNA
          Length = 3087

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 58/69 (84%), Gaps = 1/69 (1%)
 Strand = Plus / Plus

                                                                        
Query: 1    accagcaacatgctgcaccgcgcaggcgttgctcgccaacatggcggcgatgtatgccgt 60
            ||||||||||| ||||||||| |||||  || | ||||||||||| || |||| |||| |
Sbjct: 1156 accagcaacat-ctgcaccgctcaggccctgttagccaacatggccgccatgtttgccat 1214

                     
Query: 61   ctaccatgg 69
             ||||||||
Sbjct: 1215 ttaccatgg 1223

---

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2481028 aacacgatcaccgttgccttt 2481048

---

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2467622 aacacgatcaccgttgccttt 2467642

---

>gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome II, complete sequence
          Length = 1162204

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 13     ctgcaccgcgcaggcgttgctcgccaacatggc 45
              |||||||||||||||| | || |||||||||||
Sbjct: 506419 ctgcaccgcgcaggcgcttctggccaacatggc 506451

---

>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2572785 aacacgatcaccgttgccttt 2572805

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 15      gcaccgcgcaggcgttgctcg 35
               |||||||||||||||||||||
Sbjct: 2556038 gcaccgcgcaggcgttgctcg 2556018

---

>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 281     gcctttgatgagaccaccacc 301
               |||||||||||||||||||||
Sbjct: 1189768 gcctttgatgagaccaccacc 1189788

---

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 13      ctgcaccgcgcaggcgttgctcgccaacatggc 45
               |||||||||||||||| |||| || ||||||||
Sbjct: 1836532 ctgcaccgcgcaggcgctgctggcgaacatggc 1836500

---

>emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II, complete sequence,
              strain 2308
          Length = 1156948

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 13     ctgcaccgcgcaggcgttgctcgccaacatggc 45
              |||||||||||||||| | || |||||||||||
Sbjct: 506407 ctgcaccgcgcaggcgcttctggccaacatggc 506439

---

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 266     aacacgatcaccgttgccttt 286
               |||||||||||||||||||||
Sbjct: 2420437 aacacgatcaccgttgccttt 2420457

---

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 22      gcaggcgttgctcgccaacat 42
               |||||||||||||||||||||
Sbjct: 1957176 gcaggcgttgctcgccaacat 1957156

---

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 41      atggcggcgatgtatgccgtctaccatggtcc 72
               |||||| ||||||| || ||||||||||||||
Sbjct: 3764402 atggcgtcgatgtacgcggtctaccatggtcc 3764433

---

>emb|CR381579.22| Zebrafish DNA sequence from clone CH211-229N1 in linkage group 15,
             complete sequence
          Length = 130841

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 381   aggtctcaagctcaattcct 400
             ||||||||||||||||||||
Sbjct: 48111 aggtctcaagctcaattcct 48130

---

>gb|AC138735.3| Gallus gallus clone TAM31-15F7, complete sequence
          Length = 144409

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   tgttcaaggttttctctggt 340
             ||||||||||||||||||||
Sbjct: 44593 tgttcaaggttttctctggt 44574

---

>emb|CR361559.12| Zebrafish DNA sequence from clone DKEY-3P10 in linkage group 23,
             complete sequence
          Length = 246041

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 381   aggtctcaagctcaattcct 400
             ||||||||||||||||||||
Sbjct: 66870 aggtctcaagctcaattcct 66851

---

>emb|AL445492.10| Human DNA sequence from clone RP11-137O18 on chromosome 10 Contains
             part of the gene for VPS10 domain receptor protein SORCS 3
             (SORCS3), complete sequence
          Length = 149248

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 323   ttcaaggttttctctggtgg 342
             ||||||||||||||||||||
Sbjct: 12777 ttcaaggttttctctggtgg 12796

---

>gb|DQ056143.1| Coprinellus disseminatus strain C345.1 mating-type gene locus, complete
             sequence, and flanking genomic region
          Length = 75497

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 14    tgcaccgcgcaggcgttgctcgccaacatggc 45
             |||||||| || || |||||||||||||||||
Sbjct: 16220 tgcaccgcccaagctttgctcgccaacatggc 16251

---

>gb|AC104232.5| Homo sapiens chromosome 8, clone RP11-1D12, complete sequence
          Length = 148933

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   cttggaggatgttgacaagc 320
             ||||||||||||||||||||
Sbjct: 90354 cttggaggatgttgacaagc 90335

---

>gb|AC160141.2| Gallus gallus BAC clone CH261-182D6 from chromosome unknown, complete
              sequence
          Length = 240564

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    tgttcaaggttttctctggt 340
              ||||||||||||||||||||
Sbjct: 178751 tgttcaaggttttctctggt 178732

---

>emb|BX548046.4| Zebrafish DNA sequence from clone DKEY-176G1 in linkage group 17,
              complete sequence
          Length = 168695

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 441    tctttagcatgtaccacaca 460
              ||||||||||||||||||||
Sbjct: 137777 tctttagcatgtaccacaca 137758

---

>emb|BX005102.6| Zebrafish DNA sequence from clone CH211-105H13 in linkage group 8,
             complete sequence
          Length = 154770

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 381   aggtctcaagctcaattcct 400
             ||||||||||||||||||||
Sbjct: 32602 aggtctcaagctcaattcct 32583

---

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 226     ggcccgcaaaaacgagatga 245
               ||||||||||||||||||||
Sbjct: 2548576 ggcccgcaaaaacgagatga 2548595

---

>emb|AL807774.10| Mouse DNA sequence from clone RP23-198L2 on chromosome 4, complete
            sequence
          Length = 67374

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 376  gcctgaggtctcaagctcaa 395
            ||||||||||||||||||||
Sbjct: 7153 gcctgaggtctcaagctcaa 7172

---

>emb|BX005329.9| Zebrafish DNA sequence from clone DKEY-222F2, complete sequence
          Length = 186928

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 381    aggtctcaagctcaattcct 400
              ||||||||||||||||||||
Sbjct: 103546 aggtctcaagctcaattcct 103527

---

>gb|AC159212.3| Gallus gallus BAC clone CH261-173O18 from chromosome unknown, complete
              sequence
          Length = 236827

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    tgttcaaggttttctctggt 340
              ||||||||||||||||||||
Sbjct: 149471 tgttcaaggttttctctggt 149490

---

>emb|AL929346.5| Zebrafish DNA sequence from clone DKEY-38P12, complete sequence
          Length = 232537

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 381   aggtctcaagctcaattcct 400
             ||||||||||||||||||||
Sbjct: 52701 aggtctcaagctcaattcct 52682


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,348,417
Number of Sequences: 3902068
Number of extensions: 3348417
Number of successful extensions: 57527
Number of sequences better than 10.0: 136
Number of HSP's better than 10.0 without gapping: 135
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 56707
Number of HSP's gapped (non-prelim): 812
length of query: 495
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 473
effective length of database: 17,147,199,772
effective search space: 8110625492156
effective search space used: 8110625492156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---