ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baal11b01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009171.1| Triticum aestivum clone wl1n.pk0105.h9:fis, full ... 593 e-166
2gb|AY110998.1| Zea mays CL371_1 mRNA sequence 502 e-139
3ref|XM_473945.1| Oryza sativa (japonica cultivar-group), predic... 472 e-130
4dbj|AK099234.1| Oryza sativa (japonica cultivar-group) cDNA clon... 472 e-130
5dbj|AK059270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 464 e-127
6emb|AL606645.2|OSJN00079 Oryza sativa genomic DNA, chromosome 4,... 226 6e-56
7dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 226 6e-56
8gb|CP000032.1| Silicibacter pomeroyi DSS-3 plasmid megaplasmid, ... 60 9e-06
9gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 60 9e-06
10emb|CR385258.1| Gallus gallus finished cDNA, clone ChEST548a3 58 3e-05
11ref|NM_204788.1| Gallus gallus T-protein (LOC395566), mRNA 58 3e-05
12dbj|D11162.1|CHKTP Gallus gallus mRNA for T-protein, complete cds 58 3e-05
13emb|BX572101.1| Prochlorococcus marinus MIT9313 complete genome;... 56 1e-04
14emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 52 0.002
15gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 52 0.002
16gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 48 0.033
17dbj|AB220490.1| Macaca fascicularis mRNA, clone QmoA-14709: simi... 48 0.033
18gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 46 0.13
19gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 46 0.13
20emb|CR859402.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1227 (from cl... 46 0.13
21gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 44 0.51
22gb|AC147370.4| Mus musculus BAC clone RP24-243N3 from chromosome... 44 0.51
23gb|AC124365.5| Mus musculus BAC clone RP24-539F12 from chromosom... 44 0.51
24gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete se... 44 0.51
25gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete se... 44 0.51
26gb|CP000133.1| Rhizobium etli CFN 42, complete genome 44 0.51
27gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 44 0.51
28emb|AL079341.19|HSDJ319M7 Human DNA sequence from clone RP1-319M... 42 2.0
29emb|Z25862.1|STTSGDC S.tuberosum mRNA for T subunit of glycine d... 42 2.0
30gb|AE005997.1| Caulobacter crescentus CB15 section 323 of 359 of... 42 2.0
31dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 42 2.0
32gb|AC140360.4| Mus musculus BAC clone RP24-241G4 from chromosome... 42 2.0
33ref|NM_101057.3| Arabidopsis thaliana aminomethyltransferase AT1... 40 8.0
34ref|NM_179315.1| Arabidopsis thaliana aminomethyltransferase AT1... 40 8.0
35gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 40 8.0
36gb|AC149575.1| Populus trichocarpa clone Pop1-41G18, complete se... 40 8.0
37gb|BT012751.1| Lycopersicon esculentum clone 113690F, mRNA sequence 40 8.0
38gb|AY582166.1| Viola cornuta internal transcribed spacer 1, comp... 40 8.0
39ref|XM_545762.2| PREDICTED: Canis familiaris similar to KAT prot... 40 8.0
40gb|AF097243.1| Viola calcarata internal transcribed spacer 1, co... 40 8.0
41gb|AF097242.1| Viola arvensis internal transcribed spacer 1, com... 40 8.0
42ref|XM_751484.1| Ustilago maydis 521 hypothetical protein (UM004... 40 8.0
43emb|CR733183.1| Gallus gallus finished cDNA, clone ChEST652d9 40 8.0
44gb|AC087289.9| Homo sapiens chromosome 17, clone RP11-552F3, com... 40 8.0
45gb|AF239168.2| Sus scrofa similar to glycine cleavage system T-p... 40 8.0
46gb|AF239167.2| Sus scrofa glycine cleavage system T-protein mRNA... 40 8.0
47gb|AF036701.1| Caenorhabditis elegans cosmid ZC416, complete seq... 40 8.0
48emb|AJ717740.1| Hordeum vulgare betaGAL1 gene, tRNA-Pro pseudoge... 40 8.0
49gb|AY928276.1| Viola sacchalinensis voucher Kim040507 internal t... 40 8.0
50gb|AY125509.1| Arabidopsis thaliana At1g11860/F12F1_30 mRNA, com... 40 8.0
51dbj|AK128407.1| Homo sapiens cDNA FLJ46550 fis, clone THYMU30386... 40 8.0
52dbj|AK094458.1| Homo sapiens cDNA FLJ37139 fis, clone BRACE20237... 40 8.0
53dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 40 8.0
54gb|AC021180.6| Homo sapiens BAC clone RP11-727M10 from 4, comple... 40 8.0
55gb|AY148244.1| Viola valderia internal transcribed spacer 1, par... 40 8.0
56gb|AY148243.1| Viola tricolor internal transcribed spacer 1, par... 40 8.0
57gb|AY148241.1| Viola perinensis internal transcribed spacer 1, p... 40 8.0
58gb|AY148239.1| Viola palmensis internal transcribed spacer 1, pa... 40 8.0
59gb|AY148237.1| Viola magellensis internal transcribed spacer 1, ... 40 8.0
60gb|AY148236.1| Viola lutea internal transcribed spacer 1, partia... 40 8.0
61gb|AY148235.1| Viola kitaibeliana internal transcribed spacer 1,... 40 8.0
62gb|AY148234.1| Viola gracilis internal transcribed spacer 1, par... 40 8.0
63gb|AY148233.1| Viola eugeniae internal transcribed spacer 1, par... 40 8.0
64gb|AY148231.1| Viola cheiranthifolia internal transcribed spacer... 40 8.0
65gb|AY148229.1| Viola calcarata internal transcribed spacer 1, pa... 40 8.0
66gb|AY148227.1| Viola bertolonii internal transcribed spacer 1, p... 40 8.0
67gb|AY148226.1| Viola arvensis internal transcribed spacer 1, par... 40 8.0
68gb|AY148225.1| Viola aetolica internal transcribed spacer 1, par... 40 8.0
69gb|BT006361.1| Arabidopsis thaliana At1g11860/F12F1_30 gene, com... 40 8.0
70gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 8.0
71dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.0
72gb|AC135782.4| Homo sapiens chromosome 16 clone CTD-2555A7, comp... 40 8.0
73emb|BX815798.1|CNS0ABJN Arabidopsis thaliana Full-length cDNA Co... 40 8.0
74emb|BX815440.1|CNS0ABEC Arabidopsis thaliana Full-length cDNA Co... 40 8.0
75emb|BX815010.1|CNS0ABD4 Arabidopsis thaliana Full-length cDNA Co... 40 8.0
76emb|BX815758.1|CNS0AAGH Arabidopsis thaliana Full-length cDNA Co... 40 8.0
77gb|DQ055414.1| Viola tricolor subsp. tricolor clone c8 from Pola... 40 8.0
78gb|DQ055413.1| Viola tricolor subsp. tricolor clone c5 from Pola... 40 8.0
79gb|DQ055411.1| Viola tricolor subsp. tricolor clone b6 from Pola... 40 8.0
80gb|DQ055410.1| Viola tricolor subsp. tricolor clone b5 from Pola... 40 8.0
81gb|DQ055409.1| Viola tricolor subsp. tricolor clone b4 from Pola... 40 8.0
82gb|DQ055408.1| Viola tricolor subsp. tricolor clone a4 from Pola... 40 8.0
83gb|DQ055407.1| Viola tricolor subsp. tricolor clone a3 from Pola... 40 8.0
84gb|DQ055406.1| Viola tricolor subsp. tricolor clone a2 from Pola... 40 8.0
85gb|DQ055405.1| Viola tricolor subsp. curtisii clone d5 from Neth... 40 8.0
86gb|DQ055404.1| Viola tricolor subsp. curtisii clone d3 from Neth... 40 8.0
87gb|DQ055403.1| Viola tricolor subsp. curtisii clone c3 from Neth... 40 8.0
88gb|DQ055402.1| Viola tricolor subsp. curtisii clone c2 from Neth... 40 8.0
89gb|DQ055401.1| Viola tricolor subsp. curtisii clone b4 from Neth... 40 8.0
90gb|DQ055400.1| Viola tricolor subsp. curtisii clone b3 from Neth... 40 8.0
91gb|DQ055399.1| Viola tricolor subsp. curtisii clone a1 from Neth... 40 8.0
92gb|DQ055398.1| Viola tricolor subsp. tricolor clone c6 from Germ... 40 8.0
93gb|DQ055397.1| Viola tricolor subsp. tricolor clone c3 from Germ... 40 8.0
94gb|DQ055396.1| Viola tricolor subsp. tricolor clone c2 from Germ... 40 8.0
95gb|DQ055395.1| Viola tricolor subsp. tricolor clone b4 from Germ... 40 8.0
96gb|DQ055394.1| Viola tricolor subsp. tricolor clone b3 from Germ... 40 8.0
97gb|DQ055393.1| Viola tricolor subsp. tricolor clone b1 from Germ... 40 8.0
98gb|DQ055392.1| Viola tricolor subsp. tricolor clone a4 from Germ... 40 8.0
99gb|DQ055391.1| Viola tricolor subsp. tricolor clone a3 from Germ... 40 8.0
100gb|DQ055390.1| Viola tricolor subsp. tricolor clone a1 from Germ... 40 8.0
101gb|DQ055381.1| Viola guestphalica clone a2 from Germany 18S ribo... 40 8.0
102gb|DQ055380.1| Viola guestphalica clone a1 from Germany 18S ribo... 40 8.0
103gb|DQ055378.1| Viola guestphalica clone b2 from Germany 18S ribo... 40 8.0
104gb|DQ055377.1| Viola lutea clone g16 from France 18S ribosomal R... 40 8.0
105gb|DQ055376.1| Viola lutea clone g14 from France 18S ribosomal R... 40 8.0
106gb|DQ055375.1| Viola lutea clone g13 from France 18S ribosomal R... 40 8.0
107gb|DQ055374.1| Viola lutea clone f15 from France 18S ribosomal R... 40 8.0
108gb|DQ055373.1| Viola lutea clone f13 from France 18S ribosomal R... 40 8.0
109gb|DQ055372.1| Viola lutea clone c13 from France 18S ribosomal R... 40 8.0
110gb|DQ055371.1| Viola lutea clone c11 from France 18S ribosomal R... 40 8.0
111gb|DQ055370.1| Viola lutea clone c10 18S ribosomal RNA gene, par... 40 8.0
112gb|DQ055369.1| Viola lutea clone a15 from France 18S ribosomal R... 40 8.0
113gb|DQ055368.1| Viola lutea clone a14 from France 18S ribosomal R... 40 8.0
114gb|DQ055367.1| Viola lutea clone a13 from France 18S ribosomal R... 40 8.0
115gb|DQ055365.1| Viola lutea clone d5 from France 18S ribosomal RN... 40 8.0
116gb|DQ055364.1| Viola lutea clone d4 from France 18S ribosomal RN... 40 8.0
117gb|DQ055363.1| Viola lutea clone d3 from France 18S ribosomal RN... 40 8.0
118gb|DQ055362.1| Viola lutea subsp. calaminaria clone c2 from Germ... 40 8.0
119gb|DQ055361.1| Viola lutea subsp. calaminaria clone c1 from Germ... 40 8.0
120gb|DQ055360.1| Viola lutea subsp. calaminaria clone e4 from Germ... 40 8.0
121gb|DQ055359.1| Viola lutea subsp. calaminaria clone d3 from Germ... 40 8.0
122gb|DQ055358.1| Viola lutea subsp. calaminaria clone d2 from Germ... 40 8.0
123gb|DQ055357.1| Viola lutea subsp. calaminaria clone b2 from Germ... 40 8.0
124gb|DQ055356.1| Viola lutea subsp. calaminaria clone b1 from Germ... 40 8.0
125gb|DQ055355.1| Viola lutea subsp. calaminaria clone y4 from Germ... 40 8.0
126gb|DQ055347.1| Viola arvensis clone d4 from Germany 18S ribosoma... 40 8.0
127gb|DQ055346.1| Viola arvensis clone d1 from Germany 18S ribosoma... 40 8.0
128gb|DQ055345.1| Viola arvensis clone c5 from Germany 18S ribosoma... 40 8.0
129gb|DQ055344.1| Viola arvensis clone c4 from Germany 18S ribosoma... 40 8.0
130gb|DQ055343.1| Viola arvensis clone b6 from Germany 18S ribosoma... 40 8.0
131gb|DQ055342.1| Viola arvensis clone a3 from Germany 18S ribosoma... 40 8.0
132gb|DQ055341.1| Viola arvensis clone b1 from Germany 18S ribosoma... 40 8.0
133gb|DQ055340.1| Viola arvensis clone a1 from Germany 18S ribosoma... 40 8.0
134dbj|AP005251.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.0
135dbj|AP004044.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.0
136emb|CR812466.18| Zebrafish DNA sequence from clone CH211-269M1 i... 40 8.0
137dbj|AB084920.2| Halocynthia roretzi mRNA for HrTRPV, complete cds 40 8.0
138gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 8.0
139gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 ... 40 8.0
140dbj|AP005672.1| Physcomitrella patens subsp. patens chloroplast ... 40 8.0
141emb|AL845172.3| Mouse DNA sequence from clone RP23-285J17 on chr... 40 8.0 
>gb|BT009171.1| Triticum aestivum clone wl1n.pk0105.h9:fis, full insert mRNA sequence
          Length = 1468

 Score =  593 bits (299), Expect = e-166
 Identities = 505/571 (88%), Gaps = 2/571 (0%)
 Strand = Plus / Plus

                                                                        
Query: 19   acctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaag 78
            |||||||||||||||  || ||||||| |||| ||| | |||||||| || |||||||||
Sbjct: 502  acctcgcccacatcgaggcgcacatgg-aggccttcaacaagaagggcggggacgtcaag 560

                                                                        
Query: 79   tggcacgtccacgacgagcgctccctcctcgccctgcagggtcctcttgctgcaccaact 138
            |||||| |||||||||| || || || |||||  |||||||||||||||||||||| |||
Sbjct: 561  tggcacatccacgacgaccgatcgctgctcgcattgcagggtcctcttgctgcacctact 620

                                                                        
Query: 139  ctccagttgctgacaaaggaagatttgagcaaaatgtacttcagtgacttcaagatgatt 198
            || ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621  ctgcagttgctgacgaaagaagatttgagcaaaatgtacttcagtgacttcaagatgatt 680

                                                                        
Query: 199  gacatcaatggatctgcttgcttcctcaccagaactggctacaccggcgaagatggattt 258
            ||||||||||||| ||| ||||| || || |||||||||||||||||||||||||| |||
Sbjct: 681  gacatcaatggatatgcatgctttctgacgagaactggctacaccggcgaagatggtttt 740

                                                                        
Query: 259  gaaatctccgtgccgtcagagaacgcggtcgatctcgcaaaggccctcctggagaagtcc 318
            || ||||| || ||||||||||| || || ||||| ||| ||||| |||| ||||  || 
Sbjct: 741  gagatctctgttccgtcagagaatgcagtggatcttgcagaggccatcctagagagatcg 800

                                                                        
Query: 319  gagggcaaggtgaggctgaccggcctgggcgcccgtgacagtctccggctggaggcgggc 378
            || ||||||||| ||||||||||| |||||||||||||||||||||| |||||||| |||
Sbjct: 801  gaaggcaaggtgcggctgaccggcttgggcgcccgtgacagtctccgactggaggcaggc 860

                                                                        
Query: 379  ctctgcctgtacggcaacgacatggagcagcacatcacgccagtggaggcggggcctgtc 438
            || |||||||||||||||||||||||||||||||||||||| ||||| ||  ||||| ||
Sbjct: 861  ctgtgcctgtacggcaacgacatggagcagcacatcacgccggtggaagc-cggcctctc 919

                                                                        
Query: 439  gtgggcgatcggcaagcggaggagggcggagggcgggttcctgggcgcggaggtgatcct 498
             ||||||||||||||| |||||||||| |||||||| ||||||||||| || ||||||||
Sbjct: 920  atgggcgatcggcaagaggaggagggcagagggcggtttcctgggcgcagacgtgatcct 979

                                                                        
Query: 499  gaagcagctcaaggaaggccccaagatccggcgcgtgggcatcttctcgcaggggccgcc 558
            |||||||||| ||||||| || |||||| |||||||||||||  || |||||||||||||
Sbjct: 980  gaagcagctccaggaagggccaaagatcaggcgcgtgggcatggtcacgcaggggccgcc 1039

                                           
Query: 559  cccgcggagccacagcgagatcgtgagcggc 589
            | ||||||||||||||||| | |||||||||
Sbjct: 1040 cgcgcggagccacagcgagctggtgagcggc 1070
to top
>gb|AY110998.1| Zea mays CL371_1 mRNA sequence
          Length = 1475

 Score =  502 bits (253), Expect = e-139
 Identities = 455/522 (87%), Gaps = 2/522 (0%)
 Strand = Plus / Plus

                                                                        
Query: 19   acctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaag 78
            |||||||||||||||  || ||||||| |||| ||| | |||||||| || |||||||||
Sbjct: 532  acctcgcccacatcgaggcgcacatgg-aggccttcaacaagaagggcggggacgtcaag 590

                                                                        
Query: 79   tggcacgtccacgacgagcgctccctcctcgccctgcagggtcctcttgctgcaccaact 138
            |||||| |||||||||| || || || |||||  |||||||||||||||||||||| |||
Sbjct: 591  tggcacatccacgacgaccgatcgctgctcgcattgcagggtcctcttgctgcacctact 650

                                                                        
Query: 139  ctccagttgctgacaaaggaagatttgagcaaaatgtacttcagtgacttcaagatgatt 198
            || ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651  ctgcagttgctgacgaaagaagatttgagcaaaatgtacttcagtgacttcaagatgatt 710

                                                                        
Query: 199  gacatcaatggatctgcttgcttcctcaccagaactggctacaccggcgaagatggattt 258
            ||||||||||||| ||| ||||| || || |||||||||||||||||||||||||| |||
Sbjct: 711  gacatcaatggatatgcatgctttctgacgagaactggctacaccggcgaagatggtttt 770

                                                                        
Query: 259  gaaatctccgtgccgtcagagaacgcggtcgatctcgcaaaggccctcctggagaagtcc 318
            || ||||| || ||||||||||| || || ||||| ||| ||||| |||| ||||  || 
Sbjct: 771  gagatctctgttccgtcagagaatgcagtggatcttgcagaggccatcctagagagatcg 830

                                                                        
Query: 319  gagggcaaggtgaggctgaccggcctgggcgcccgtgacagtctccggctggaggcgggc 378
            || ||||||||| ||||||||||| |||||||||||||||||||||| |||||||| |||
Sbjct: 831  gaaggcaaggtgcggctgaccggcttgggcgcccgtgacagtctccgactggaggcaggc 890

                                                                        
Query: 379  ctctgcctgtacggcaacgacatggagcagcacatcacgccagtggaggcggggcctgtc 438
            || |||||||||||||||||||||||||||||||||||||| ||||| ||  ||||| ||
Sbjct: 891  ctgtgcctgtacggcaacgacatggagcagcacatcacgccggtggaagc-cggcctctc 949

                                                                        
Query: 439  gtgggcgatcggcaagcggaggagggcggagggcgggttcctgggcgcggaggtgatcct 498
             ||||||||        |||||||||| |||||||| ||||||||||| || ||||||||
Sbjct: 950  atgggcgatnnnnnnnaggaggagggcagagggcggtttcctgggcgcagacgtgatcct 1009

                                                      
Query: 499  gaagcagctcaaggaaggccccaagatccggcgcgtgggcat 540
            |||||||||| ||||||| || |||||| |||||||||||||
Sbjct: 1010 gaagcagctccaggaagggccaaagatcaggcgcgtgggcat 1051
to top
>ref|XM_473945.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1227

 Score =  472 bits (238), Expect = e-130
 Identities = 486/566 (85%), Gaps = 2/566 (0%)
 Strand = Plus / Plus

                                                                        
Query: 21   ctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaagtg 80
            ||||||||||| || |  ||||||| |||| ||| | |||||||| ||||||||||||||
Sbjct: 466  ctcgcccacattggggagcacatgg-aggccttcaacaagaagggcggcgacgtcaagtg 524

                                                                        
Query: 81   gcacgtccacgacgagcgctccctcctcgccctgcagggtcctcttgctgcaccaactct 140
            |||||||||||| |||||||| || || ||  ||||||| ||||||||||||||||||||
Sbjct: 525  gcacgtccacgatgagcgctcgcttcttgcattgcagggacctcttgctgcaccaactct 584

                                                                        
Query: 141  ccagttgctgacaaaggaagatttgagcaaaatgtacttcagtgacttcaagatgattga 200
            ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 585  ccagttgctgacaaaagaagatttaagcaaaatgtatttcagtgacttcaagatgattga 644

                                                                        
Query: 201  catcaatggatctgcttgcttcctcaccagaactggctacaccggcgaagatggatttga 260
            ||||||||||| ||||||||| |||||||||||||| || ||||| |||||||| |||||
Sbjct: 645  catcaatggatatgcttgctttctcaccagaactggttataccggtgaagatgggtttga 704

                                                                        
Query: 261  aatctccgtgccgtcagagaacgcggtcgatctcgcaaaggccctcctggagaagtccga 320
            |||||| || || |||||||| || || ||||| |||||||||||||||||||| || ||
Sbjct: 705  aatctctgttccatcagagaatgcagttgatcttgcaaaggccctcctggagaaatctga 764

                                                                        
Query: 321  gggcaaggtgaggctgaccggcctgggcgcccgtgacagtctccggctggaggcgggcct 380
             ||||||||||| ||||| ||  | || |||||||||||||||||  ||||||| |||||
Sbjct: 765  aggcaaggtgagactgactggtttaggtgcccgtgacagtctccgcttggaggctggcct 824

                                                                        
Query: 381  ctgcctgtacggcaacgacatggagcagcacatcacgccagtggaggcggggcctgtcgt 440
            ||||||||||||||||||||||||||| |||||||| ||||| |||||  || || || |
Sbjct: 825  ctgcctgtacggcaacgacatggagcaacacatcacaccagttgaggc-tggtctctcat 883

                                                                        
Query: 441  gggcgatcggcaagcggaggagggcggagggcgggttcctgggcgcggaggtgatcctga 500
            |||| || |||||| ||||||  || || ||||| |||||||| || || |||||||| |
Sbjct: 884  gggcaattggcaagaggaggaaagcagaaggcggcttcctgggagcagatgtgatcctca 943

                                                                        
Query: 501  agcagctcaaggaaggccccaagatccggcgcgtgggcatcttctcgcaggggccgcccc 560
            |||||||| |||||||||| |||||| |||| || ||  || ||||||| || ||||| |
Sbjct: 944  agcagctccaggaaggcccaaagatcaggcgtgtcggtctcctctcgcaaggaccgcctc 1003

                                      
Query: 561  cgcggagccacagcgagatcgtgagc 586
            | ||||| || || ||||| ||||||
Sbjct: 1004 ctcggagtcatagtgagattgtgagc 1029
to top
>dbj|AK099234.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106I02, full
            insert sequence
          Length = 1430

 Score =  472 bits (238), Expect = e-130
 Identities = 486/566 (85%), Gaps = 2/566 (0%)
 Strand = Plus / Plus

                                                                        
Query: 21   ctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaagtg 80
            ||||||||||| || |  ||||||| |||| ||| | |||||||| ||||||||||||||
Sbjct: 511  ctcgcccacattggggagcacatgg-aggccttcaacaagaagggcggcgacgtcaagtg 569

                                                                        
Query: 81   gcacgtccacgacgagcgctccctcctcgccctgcagggtcctcttgctgcaccaactct 140
            |||||||||||| |||||||| || || ||  ||||||| ||||||||||||||||||||
Sbjct: 570  gcacgtccacgatgagcgctcgcttcttgcattgcagggacctcttgctgcaccaactct 629

                                                                        
Query: 141  ccagttgctgacaaaggaagatttgagcaaaatgtacttcagtgacttcaagatgattga 200
            ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 630  ccagttgctgacaaaagaagatttaagcaaaatgtatttcagtgacttcaagatgattga 689

                                                                        
Query: 201  catcaatggatctgcttgcttcctcaccagaactggctacaccggcgaagatggatttga 260
            ||||||||||| ||||||||| |||||||||||||| || ||||| |||||||| |||||
Sbjct: 690  catcaatggatatgcttgctttctcaccagaactggttataccggtgaagatgggtttga 749

                                                                        
Query: 261  aatctccgtgccgtcagagaacgcggtcgatctcgcaaaggccctcctggagaagtccga 320
            |||||| || || |||||||| || || ||||| |||||||||||||||||||| || ||
Sbjct: 750  aatctctgttccatcagagaatgcagttgatcttgcaaaggccctcctggagaaatctga 809

                                                                        
Query: 321  gggcaaggtgaggctgaccggcctgggcgcccgtgacagtctccggctggaggcgggcct 380
             ||||||||||| ||||| ||  | || |||||||||||||||||  ||||||| |||||
Sbjct: 810  aggcaaggtgagactgactggtttaggtgcccgtgacagtctccgcttggaggctggcct 869

                                                                        
Query: 381  ctgcctgtacggcaacgacatggagcagcacatcacgccagtggaggcggggcctgtcgt 440
            ||||||||||||||||||||||||||| |||||||| ||||| |||||  || || || |
Sbjct: 870  ctgcctgtacggcaacgacatggagcaacacatcacaccagttgaggc-tggtctctcat 928

                                                                        
Query: 441  gggcgatcggcaagcggaggagggcggagggcgggttcctgggcgcggaggtgatcctga 500
            |||| || |||||| ||||||  || || ||||| |||||||| || || |||||||| |
Sbjct: 929  gggcaattggcaagaggaggaaagcagaaggcggcttcctgggagcagatgtgatcctca 988

                                                                        
Query: 501  agcagctcaaggaaggccccaagatccggcgcgtgggcatcttctcgcaggggccgcccc 560
            |||||||| |||||||||| |||||| |||| || ||  || ||||||| || ||||| |
Sbjct: 989  agcagctccaggaaggcccaaagatcaggcgtgtcggtctcctctcgcaaggaccgcctc 1048

                                      
Query: 561  cgcggagccacagcgagatcgtgagc 586
            | ||||| || || ||||| ||||||
Sbjct: 1049 ctcggagtcatagtgagattgtgagc 1074
to top
>dbj|AK059270.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-B08, full
           insert sequence
          Length = 994

 Score =  464 bits (234), Expect = e-127
 Identities = 485/566 (85%), Gaps = 2/566 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  ctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaagtg 80
           ||||||||||| || |  ||||||| |||| ||| | |||||||| ||||||||||||||
Sbjct: 61  ctcgcccacattggggagcacatgg-aggccttcaacaagaagggcggcgacgtcaagtg 119

                                                                       
Query: 81  gcacgtccacgacgagcgctccctcctcgccctgcagggtcctcttgctgcaccaactct 140
           |||||||||||| |||||||| || || ||  ||||||| ||||||||||||||||||||
Sbjct: 120 gcacgtccacgatgagcgctcgcttcttgcattgcagggacctcttgctgcaccaactct 179

                                                                       
Query: 141 ccagttgctgacaaaggaagatttgagcaaaatgtacttcagtgacttcaagatgattga 200
           ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 180 ccagttgctgacaaaagaagatttaagcaaaatgtatttcagtgacttcaagatgattga 239

                                                                       
Query: 201 catcaatggatctgcttgcttcctcaccagaactggctacaccggcgaagatggatttga 260
           ||||||||||| ||||||||| |||||||||||||| || ||||| |||||||| |||||
Sbjct: 240 catcaatggatatgcttgctttctcaccagaactggttataccggtgaagatgggtttga 299

                                                                       
Query: 261 aatctccgtgccgtcagagaacgcggtcgatctcgcaaaggccctcctggagaagtccga 320
           |||||| || || |||||||| || || ||||| |||||||||||||||||||| || ||
Sbjct: 300 aatctctgttccatcagagaatgcagttgatcttgcaaaggccctcctggagaaatctga 359

                                                                       
Query: 321 gggcaaggtgaggctgaccggcctgggcgcccgtgacagtctccggctggaggcgggcct 380
            ||||||||||| ||||| ||  | || |||||||||||||||||  ||||||| |||||
Sbjct: 360 aggcaaggtgagactgactggtttaggtgcccgtgacagtctccgcttggaggctggcct 419

                                                                       
Query: 381 ctgcctgtacggcaacgacatggagcagcacatcacgccagtggaggcggggcctgtcgt 440
           ||||||||||||||||||||||| ||| |||||||| ||||| |||||  || || || |
Sbjct: 420 ctgcctgtacggcaacgacatggggcaacacatcacaccagttgaggc-tggtctctcat 478

                                                                       
Query: 441 gggcgatcggcaagcggaggagggcggagggcgggttcctgggcgcggaggtgatcctga 500
           |||| || |||||| ||||||  || || ||||| |||||||| || || |||||||| |
Sbjct: 479 gggcaattggcaagaggaggaaagcagaaggcggcttcctgggagcagatgtgatcctca 538

                                                                       
Query: 501 agcagctcaaggaaggccccaagatccggcgcgtgggcatcttctcgcaggggccgcccc 560
           |||||||| |||||||||| |||||| |||| || ||  || ||||||| || ||||| |
Sbjct: 539 agcagctccaggaaggcccaaagatcaggcgtgtcggtctcctctcgcaaggaccgcctc 598

                                     
Query: 561 cgcggagccacagcgagatcgtgagc 586
           | ||||| || || ||||| ||||||
Sbjct: 599 ctcggagtcatagtgagattgtgagc 624
to top
>emb|AL606645.2|OSJN00079 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053K19,
             complete sequence
          Length = 187601

 Score =  226 bits (114), Expect = 6e-56
 Identities = 289/346 (83%), Gaps = 1/346 (0%)
 Strand = Plus / Plus

                                                                         
Query: 241   accggcgaagatggatttgaaatctccgtgccgtcagagaacgcggtcgatctcgcaaag 300
             ||||| |||||||| ||||||||||| || || |||||||| || || ||||| ||||||
Sbjct: 70065 accggtgaagatgggtttgaaatctctgttccatcagagaatgcagttgatcttgcaaag 70124

                                                                         
Query: 301   gccctcctggagaagtccgagggcaaggtgaggctgaccggcctgggcgcccgtgacagt 360
             |||||||||||||| || || ||||||||||| ||||| ||  | || ||||||||||||
Sbjct: 70125 gccctcctggagaaatctgaaggcaaggtgagactgactggtttaggtgcccgtgacagt 70184

                                                                         
Query: 361   ctccggctggaggcgggcctctgcctgtacggcaacgacatggagcagcacatcacgcca 420
             |||||  ||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 70185 ctccgcttggaggctggcctctgcctgtacggcaacgacatggagcaacacatcacacca 70244

                                                                         
Query: 421   gtggaggcggggcctgtcgtgggcgatcggcaagcggaggagggcggagggcgggttcct 480
             || |||||  || || || ||||| || |||||| ||||||  || || ||||| |||||
Sbjct: 70245 gttgaggc-tggtctctcatgggcaattggcaagaggaggaaagcagaaggcggcttcct 70303

                                                                         
Query: 481   gggcgcggaggtgatcctgaagcagctcaaggaaggccccaagatccggcgcgtgggcat 540
             ||| || || |||||||| ||||||||| |||||||||| |||||| |||| || ||  |
Sbjct: 70304 gggagcagatgtgatcctcaagcagctccaggaaggcccaaagatcaggcgtgtcggtct 70363

                                                           
Query: 541   cttctcgcaggggccgcccccgcggagccacagcgagatcgtgagc 586
             | ||||||| || ||||| || ||||| || || ||||| ||||||
Sbjct: 70364 cctctcgcaaggaccgcctcctcggagtcatagtgagattgtgagc 70409



 Score =  194 bits (98), Expect = 2e-46
 Identities = 116/122 (95%)
 Strand = Plus / Plus

                                                                         
Query: 115   cagggtcctcttgctgcaccaactctccagttgctgacaaaggaagatttgagcaaaatg 174
             ||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 69832 cagggacctcttgctgcaccaactctccagttgctgacaaaagaagatttaagcaaaatg 69891

                                                                         
Query: 175   tacttcagtgacttcaagatgattgacatcaatggatctgcttgcttcctcaccagaact 234
             || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 69892 tatttcagtgacttcaagatgattgacatcaatggatatgcttgctttctcaccagaact 69951

               
Query: 235   gg 236
             ||
Sbjct: 69952 gg 69953



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 71/81 (87%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                         
Query: 21    ctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaagtg 80
             ||||||||||| || |  ||||||| |||| ||| | |||||||| ||||||||||||||
Sbjct: 68675 ctcgcccacattggggagcacatgg-aggccttcaacaagaagggcggcgacgtcaagtg 68733

                                  
Query: 81    gcacgtccacgacgagcgctc 101
             |||||||||||| ||||||||
Sbjct: 68734 gcacgtccacgatgagcgctc 68754
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  226 bits (114), Expect = 6e-56
 Identities = 289/346 (83%), Gaps = 1/346 (0%)
 Strand = Plus / Plus

                                                                            
Query: 241      accggcgaagatggatttgaaatctccgtgccgtcagagaacgcggtcgatctcgcaaag 300
                ||||| |||||||| ||||||||||| || || |||||||| || || ||||| ||||||
Sbjct: 31736795 accggtgaagatgggtttgaaatctctgttccatcagagaatgcagttgatcttgcaaag 31736854

                                                                            
Query: 301      gccctcctggagaagtccgagggcaaggtgaggctgaccggcctgggcgcccgtgacagt 360
                |||||||||||||| || || ||||||||||| ||||| ||  | || ||||||||||||
Sbjct: 31736855 gccctcctggagaaatctgaaggcaaggtgagactgactggtttaggtgcccgtgacagt 31736914

                                                                            
Query: 361      ctccggctggaggcgggcctctgcctgtacggcaacgacatggagcagcacatcacgcca 420
                |||||  ||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 31736915 ctccgcttggaggctggcctctgcctgtacggcaacgacatggagcaacacatcacacca 31736974

                                                                            
Query: 421      gtggaggcggggcctgtcgtgggcgatcggcaagcggaggagggcggagggcgggttcct 480
                || |||||  || || || ||||| || |||||| ||||||  || || ||||| |||||
Sbjct: 31736975 gttgaggc-tggtctctcatgggcaattggcaagaggaggaaagcagaaggcggcttcct 31737033

                                                                            
Query: 481      gggcgcggaggtgatcctgaagcagctcaaggaaggccccaagatccggcgcgtgggcat 540
                ||| || || |||||||| ||||||||| |||||||||| |||||| |||| || ||  |
Sbjct: 31737034 gggagcagatgtgatcctcaagcagctccaggaaggcccaaagatcaggcgtgtcggtct 31737093

                                                              
Query: 541      cttctcgcaggggccgcccccgcggagccacagcgagatcgtgagc 586
                | ||||||| || ||||| || ||||| || || ||||| ||||||
Sbjct: 31737094 cctctcgcaaggaccgcctcctcggagtcatagtgagattgtgagc 31737139



 Score =  194 bits (98), Expect = 2e-46
 Identities = 116/122 (95%)
 Strand = Plus / Plus

                                                                            
Query: 115      cagggtcctcttgctgcaccaactctccagttgctgacaaaggaagatttgagcaaaatg 174
                ||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 31736562 cagggacctcttgctgcaccaactctccagttgctgacaaaagaagatttaagcaaaatg 31736621

                                                                            
Query: 175      tacttcagtgacttcaagatgattgacatcaatggatctgcttgcttcctcaccagaact 234
                || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 31736622 tatttcagtgacttcaagatgattgacatcaatggatatgcttgctttctcaccagaact 31736681

                  
Query: 235      gg 236
                ||
Sbjct: 31736682 gg 31736683



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 71/81 (87%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                            
Query: 21       ctcgcccacatcggcgcccacatggnaggcgttccagaagaagggtggcgacgtcaagtg 80
                ||||||||||| || |  ||||||| |||| ||| | |||||||| ||||||||||||||
Sbjct: 31735405 ctcgcccacattggggagcacatgg-aggccttcaacaagaagggcggcgacgtcaagtg 31735463

                                     
Query: 81       gcacgtccacgacgagcgctc 101
                |||||||||||| ||||||||
Sbjct: 31735464 gcacgtccacgatgagcgctc 31735484
to top
>gb|CP000032.1| Silicibacter pomeroyi DSS-3 plasmid megaplasmid, complete sequence
          Length = 491611

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 340   ggcctgggcgcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgac 399
             |||||||||||||| ||||| || |||||||||||||| || ||||| || ||||| |||
Sbjct: 52573 ggcctgggcgcccgcgacagcctgcggctggaggcggggctgtgcctctatggcaatgac 52632

               
Query: 400   at 401
             ||
Sbjct: 52633 at 52634
to top
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                     
Query: 339     cggcctgggcgcccgtgacagtctccggctggaggcgggcctctgcctgtacgg 392
               |||||| |||||||| ||||| || ||||| ||||||||||||||||| |||||
Sbjct: 1819998 cggcctcggcgcccgcgacagcctgcggctcgaggcgggcctctgcctttacgg 1819945
to top
>emb|CR385258.1| Gallus gallus finished cDNA, clone ChEST548a3
          Length = 971

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 349 gcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgacatggagcag 408
           ||||| ||||| || || |||||||| || |||||||| |||||||||||||| ||  ||
Sbjct: 506 gcccgggacagcctgcgcctggaggccgggctctgcctctacggcaacgacatcgatgag 565

                                    
Query: 409 cacatcacgccagtggaggcggggc 433
             || ||||||||||||||| ||||
Sbjct: 566 agcaccacgccagtggaggctgggc 590
to top
>ref|NM_204788.1| Gallus gallus T-protein (LOC395566), mRNA
          Length = 1228

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 349 gcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgacatggagcag 408
           ||||| ||||| || || |||||||| || |||||||| |||||||||||||| ||  ||
Sbjct: 764 gcccgggacagcctgcgcctggaggccgggctctgcctctacggcaacgacatcgatgag 823

                                    
Query: 409 cacatcacgccagtggaggcggggc 433
             || ||||||||||||||| ||||
Sbjct: 824 agcaccacgccagtggaggctgggc 848
to top
>dbj|D11162.1|CHKTP Gallus gallus mRNA for T-protein, complete cds
          Length = 1228

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 349 gcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgacatggagcag 408
           ||||| ||||| || || |||||||| || |||||||| |||||||||||||| ||  ||
Sbjct: 764 gcccgggacagcctgcgcctggaggccgggctctgcctctacggcaacgacatcgatgag 823

                                    
Query: 409 cacatcacgccagtggaggcggggc 433
             || ||||||||||||||| ||||
Sbjct: 824 agcaccacgccagtggaggctgggc 848
to top
>emb|BX572101.1| Prochlorococcus marinus MIT9313 complete genome; segment 7/7
          Length = 318136

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                              
Query: 230    gaactggctacaccggcgaagatggatttgaa 261
              |||||||||||||||||||||| |||||||||
Sbjct: 249529 gaactggctacaccggcgaagacggatttgaa 249560
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                           
Query: 339     cggcctgggcgcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacga 398
               ||||||||||||||| |||   || || |||||||| ||| | |||||||||||| ||||
Sbjct: 4751360 cggcctgggcgcccgcgactcgctgcgcctggaggccggcttgtgcctgtacggccacga 4751419

                     
Query: 399     catgga 404
               ||||||
Sbjct: 4751420 catgga 4751425
to top
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                           
Query: 340     ggcctgggcgcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgac 399
               ||||| |||||||| ||||  ||||| || || ||||| ||||||||| |||||||||||
Sbjct: 2012026 ggcctcggcgcccgcgacacgctccgcctcgaagcggggctctgcctgcacggcaacgac 2012085

                 
Query: 400     at 401
               ||
Sbjct: 2012086 at 2012087
to top
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                           
Query: 339     cggcctgggcgcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacga 398
               |||||| ||||||||||||   || || ||||| || ||||| |||||||||||| ||||
Sbjct: 4956491 cggcctcggcgcccgtgactcgctgcgcctggaagccggcctgtgcctgtacggccacga 4956550

                   
Query: 399     catg 402
               ||||
Sbjct: 4956551 catg 4956554
to top
>dbj|AB220490.1| Macaca fascicularis mRNA, clone QmoA-14709: similar to Homo sapiens
           aminomethyltransferase(AMT),mRNA, NM_000481.2
          Length = 2054

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 358 agtctccggctggaggcgggcctctgcctgtacggcaacgacat 401
           ||||| || |||||||| ||||||||||||||||| || |||||
Sbjct: 808 agtctgcgcctggaggcaggcctctgcctgtacgggaatgacat 851
to top
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 340     ggcctgggcgcccgtgacagtctccggctggaggcgggc 378
               |||||||||||||| ||||  || |||||||||||||||
Sbjct: 2002632 ggcctgggcgcccgcgacacgctgcggctggaggcgggc 2002670
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 235     ggctacaccggcgaagatggatttgaaatctccgtgccg 273
               ||||||||||||||||| || || |||||||| ||||||
Sbjct: 5360702 ggctacaccggcgaagacggtttcgaaatctcggtgccg 5360740
to top
>emb|CR859402.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1227 (from clone DKFZp459J1227)
          Length = 4462

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 367  ctggaggcgggcctctgcctgtacggcaacgacat 401
            |||||||| ||||||||||||||||| || |||||
Sbjct: 3268 ctggaggcaggcctctgcctgtacgggaatgacat 3302
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 334    ctgaccggcctgggcgcccgtg 355
              ||||||||||||||||||||||
Sbjct: 827439 ctgaccggcctgggcgcccgtg 827418
to top
>gb|AC147370.4| Mus musculus BAC clone RP24-243N3 from chromosome 12, complete sequence
          Length = 162528

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 503   cagctcaaggaaggccccaaga 524
             ||||||||||||||||||||||
Sbjct: 79753 cagctcaaggaaggccccaaga 79774
to top
>gb|AC124365.5| Mus musculus BAC clone RP24-539F12 from chromosome 12, complete sequence
          Length = 148952

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 503    cagctcaaggaaggccccaaga 524
              ||||||||||||||||||||||
Sbjct: 146869 cagctcaaggaaggccccaaga 146848
to top
>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence
          Length = 122876

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 238   tacaccggcgaagatggatttgaaatctccgtgccgtcagag 279
             |||||||| |||||||||||||| ||||| || || ||||||
Sbjct: 81675 tacaccggagaagatggatttgagatctcagttccttcagag 81716
to top
>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence
          Length = 133030

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 238   tacaccggcgaagatggatttgaaatctccgtgccgtcagag 279
             |||||||| |||||||||||||| ||||| || || ||||||
Sbjct: 40029 tacaccggagaagatggatttgagatctcagttccttcagag 39988
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 368     tggaggcgggcctctgcctgtacggcaacgacat 401
               |||| |||||||||||||| || |||||||||||
Sbjct: 2341765 tggaagcgggcctctgcctttatggcaacgacat 2341798
to top
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 235     ggctacaccggcgaagatggatttga 260
               |||||||||||||||||||| |||||
Sbjct: 3330543 ggctacaccggcgaagatggttttga 3330568
to top
>emb|AL079341.19|HSDJ319M7 Human DNA sequence from clone RP1-319M7 on chromosome 6p21.1-21.3
             Contains the 5' end of the gene for a novel protein
             (contains KIAA1880 and FLJ32945), a TRK-fused gene (TFG)
             pseudogene and a CpG island, complete sequence
          Length = 128216

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 152   caaaggaagatttgagcaaaa 172
             |||||||||||||||||||||
Sbjct: 65121 caaaggaagatttgagcaaaa 65101
to top
>emb|Z25862.1|STTSGDC S.tuberosum mRNA for T subunit of glycine decarboxylase
           multi-enzyme complex
          Length = 1418

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 352 cgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgacatggagcagcac 411
           ||||||||||| || || ||||| ||  | ||| | |||||||| |||||||||||||||
Sbjct: 855 cgtgacagtcttcgtcttgaggctggattgtgcttatacggcaatgacatggagcagcac 914

            
Query: 412 a 412
           |
Sbjct: 915 a 915



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 148 ctgacaaaggaagatttgagcaaaatgtactt 179
           |||||||| || ||||||||||| ||||||||
Sbjct: 651 ctgacaaaagatgatttgagcaagatgtactt 682
to top
>gb|AE005997.1| Caulobacter crescentus CB15 section 323 of 359 of the complete
           genome
          Length = 11386

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 340 ggcctgggcgcccgtgacagtctccggctggaggcgggcct 380
           |||||||||||||| ||||| || || ||||| ||||||||
Sbjct: 921 ggcctgggcgcccgcgacagcctgcgcctggaagcgggcct 881
to top
>dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012
          Length = 2668010

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 109     gccctgcagggtcctcttgct 129
               |||||||||||||||||||||
Sbjct: 1613848 gccctgcagggtcctcttgct 1613828
to top
>gb|AC140360.4| Mus musculus BAC clone RP24-241G4 from chromosome 12, complete sequence
          Length = 181901

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 540   tcttctcgcaggggccgcccc 560
             |||||||||||||||||||||
Sbjct: 69527 tcttctcgcaggggccgcccc 69507
to top
>ref|NM_101057.3| Arabidopsis thaliana aminomethyltransferase AT1G11860 transcript
           variant AT1G11860.1 mRNA, complete cds
          Length = 1581

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 909 tggagaagtccgagggtaaggtaaggct 936
to top
>ref|NM_179315.1| Arabidopsis thaliana aminomethyltransferase AT1G11860 transcript
           variant AT1G11860.2 mRNA, complete cds
          Length = 1582

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 910 tggagaagtccgagggtaaggtaaggct 937
to top
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 450    gcaagcggaggagggcggag 469
              ||||||||||||||||||||
Sbjct: 794979 gcaagcggaggagggcggag 794998
to top
>gb|AC149575.1| Populus trichocarpa clone Pop1-41G18, complete sequence
          Length = 111678

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 238   tacaccggcgaagatggatttgaaatctccgtgccgtcagagaa 281
             ||||| || ||||||||||||||||| || || || ||||||||
Sbjct: 21682 tacactggagaagatggatttgaaatatcagttccttcagagaa 21639
to top
>gb|BT012751.1| Lycopersicon esculentum clone 113690F, mRNA sequence
          Length = 2576

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 148  ctgacaaaggaagatttgagcaaaatgtactt 179
            |||||||| || ||||||||||| ||||||||
Sbjct: 1420 ctgacaaaagatgatttgagcaagatgtactt 1451
to top
>gb|AY582166.1| Viola cornuta internal transcribed spacer 1, complete sequence
          Length = 239

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>ref|XM_545762.2| PREDICTED: Canis familiaris similar to KAT protein (LOC488645),
           mRNA
          Length = 542

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 550 ggggccgcccccgcggagcc 569
           ||||||||||||||||||||
Sbjct: 33  ggggccgcccccgcggagcc 14
to top
>gb|AF097243.1| Viola calcarata internal transcribed spacer 1, complete sequence
          Length = 240

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AF097242.1| Viola arvensis internal transcribed spacer 1, complete sequence
          Length = 240

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 174 cgagcgctccctcctcgccc 193
to top
>ref|XM_751484.1| Ustilago maydis 521 hypothetical protein (UM00430.1) partial mRNA
          Length = 1365

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 235 ggctacaccggcgaagatggatttgaaatctc 266
           ||||||||||||||||| ||||| || |||||
Sbjct: 826 ggctacaccggcgaagacggattcgagatctc 857
to top
>emb|CR733183.1| Gallus gallus finished cDNA, clone ChEST652d9
          Length = 2335

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 216  ttgcttcctcaccagaactg 235
            ||||||||||||||||||||
Sbjct: 2174 ttgcttcctcaccagaactg 2193
to top
>gb|AC087289.9| Homo sapiens chromosome 17, clone RP11-552F3, complete sequence
          Length = 203765

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 495    tcctgaagcagctcaaggaa 514
              ||||||||||||||||||||
Sbjct: 105688 tcctgaagcagctcaaggaa 105669
to top
>gb|AF239168.2| Sus scrofa similar to glycine cleavage system T-protein mRNA sequence
          Length = 1005

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 370  gaggcgggcctctgcctgtacggcaacgacat 401
            ||||| |||||||||||||| || ||||||||
Sbjct: 970  gaggcaggcctctgcctgtatgggaacgacat 1001
to top
>gb|AF239167.2| Sus scrofa glycine cleavage system T-protein mRNA, partial cds
          Length = 717

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 370 gaggcgggcctctgcctgtacggcaacgacat 401
           ||||| |||||||||||||| || ||||||||
Sbjct: 682 gaggcaggcctctgcctgtatgggaacgacat 713
to top
>gb|AF036701.1| Caenorhabditis elegans cosmid ZC416, complete sequence
          Length = 35586

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 454   gcggaggagggcggagggcg 473
             ||||||||||||||||||||
Sbjct: 34365 gcggaggagggcggagggcg 34346
to top
>emb|AJ717740.1| Hordeum vulgare betaGAL1 gene, tRNA-Pro pseudogene, ORF_1 pseudogene
            and tnp2-like1 gene (partial)
          Length = 10640

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   acgacgagcgctccctcctc 108
            ||||||||||||||||||||
Sbjct: 2114 acgacgagcgctccctcctc 2133
to top
>gb|AY928276.1| Viola sacchalinensis voucher Kim040507 internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence
          Length = 685

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 213 cgagcgctccctcctcgccc 232
to top
>gb|AY125509.1| Arabidopsis thaliana At1g11860/F12F1_30 mRNA, complete cds
          Length = 1478

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 855 tggagaagtccgagggtaaggtaaggct 882
to top
>dbj|AK128407.1| Homo sapiens cDNA FLJ46550 fis, clone THYMU3038603, moderately
            similar to Mus musculus WW domain binding protein 2
            (Wbp2)
          Length = 3717

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 495  tcctgaagcagctcaaggaa 514
            ||||||||||||||||||||
Sbjct: 1882 tcctgaagcagctcaaggaa 1863
to top
>dbj|AK094458.1| Homo sapiens cDNA FLJ37139 fis, clone BRACE2023727, weakly similar
           to Human WW domain binding protein-2 mRNA
          Length = 2069

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 495 tcctgaagcagctcaaggaa 514
           ||||||||||||||||||||
Sbjct: 190 tcctgaagcagctcaaggaa 171
to top
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 232     actggctacaccggcgaaga 251
               ||||||||||||||||||||
Sbjct: 1771642 actggctacaccggcgaaga 1771661
to top
>gb|AC021180.6| Homo sapiens BAC clone RP11-727M10 from 4, complete sequence
          Length = 173940

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cagttgctgacaaaggaaga 161
             ||||||||||||||||||||
Sbjct: 63089 cagttgctgacaaaggaaga 63108
to top
>gb|AY148244.1| Viola valderia internal transcribed spacer 1, partial sequence
          Length = 200

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 131 cgagcgctccctcctcgccc 150
to top
>gb|AY148243.1| Viola tricolor internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148241.1| Viola perinensis internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148239.1| Viola palmensis internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148237.1| Viola magellensis internal transcribed spacer 1, partial sequence
          Length = 240

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 171 cgagcgctccctcctcgccc 190
to top
>gb|AY148236.1| Viola lutea internal transcribed spacer 1, partial sequence
          Length = 243

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148235.1| Viola kitaibeliana internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148234.1| Viola gracilis internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148233.1| Viola eugeniae internal transcribed spacer 1, partial sequence
          Length = 243

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148231.1| Viola cheiranthifolia internal transcribed spacer 1, partial
           sequence
          Length = 241

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 172 cgagcgctccctcctcgccc 191
to top
>gb|AY148229.1| Viola calcarata internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 172 cgagcgctccctcctcgccc 191
to top
>gb|AY148227.1| Viola bertolonii internal transcribed spacer 1, partial sequence
          Length = 198

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 130 cgagcgctccctcctcgccc 149
to top
>gb|AY148226.1| Viola arvensis internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 173 cgagcgctccctcctcgccc 192
to top
>gb|AY148225.1| Viola aetolica internal transcribed spacer 1, partial sequence
          Length = 242

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 172 cgagcgctccctcctcgccc 191
to top
>gb|BT006361.1| Arabidopsis thaliana At1g11860/F12F1_30 gene, complete cds
          Length = 1227

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 752 tggagaagtccgagggtaaggtaaggct 779
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                       
Query: 469     gggcgggttcctgggcgcggaggtgatcctgaagcagctc 508
               |||||||||||| |||||||| | |||||||  |||||||
Sbjct: 4277538 gggcgggttcctcggcgcggacgcgatcctggcgcagctc 4277577



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                       
Query: 346     ggcgcccgtgacagtctccggctggaggcgggcctctgcctgtacggcaacgacat 401
               ||||| || ||||| || ||||||||||| || || ||||| |||||| |||||||
Sbjct: 4277404 ggcgctcgcgacagcctgcggctggaggccgggctttgcctctacggccacgacat 4277459
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 177      cttcagtgacttcaagatgattga 200
                |||||||||| |||||||||||||
Sbjct: 27672705 cttcagtgacctcaagatgattga 27672728
to top
>gb|AC135782.4| Homo sapiens chromosome 16 clone CTD-2555A7, complete sequence
          Length = 163550

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 456   ggaggagggcggagggcggg 475
             ||||||||||||||||||||
Sbjct: 33246 ggaggagggcggagggcggg 33265
to top
>emb|BX815798.1|CNS0ABJN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS9ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1374

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 755 tggagaagtccgagggtaaggtaaggct 782
to top
>emb|BX815440.1|CNS0ABEC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS60ZB04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1514

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 909 tggagaagtccgagggtaaggtaaggct 936
to top
>emb|BX815010.1|CNS0ABD4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZG07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1405

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 796 tggagaagtccgagggtaaggtaaggct 823
to top
>emb|BX815758.1|CNS0AAGH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS91ZA02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1460

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 308 tggagaagtccgagggcaaggtgaggct 335
           |||||||||||||||| ||||| |||||
Sbjct: 839 tggagaagtccgagggtaaggtaaggct 866
to top
>gb|DQ055414.1| Viola tricolor subsp. tricolor clone c8 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055413.1| Viola tricolor subsp. tricolor clone c5 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055411.1| Viola tricolor subsp. tricolor clone b6 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055410.1| Viola tricolor subsp. tricolor clone b5 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055409.1| Viola tricolor subsp. tricolor clone b4 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055408.1| Viola tricolor subsp. tricolor clone a4 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055407.1| Viola tricolor subsp. tricolor clone a3 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055406.1| Viola tricolor subsp. tricolor clone a2 from Poland 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055405.1| Viola tricolor subsp. curtisii clone d5 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 685

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055404.1| Viola tricolor subsp. curtisii clone d3 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055403.1| Viola tricolor subsp. curtisii clone c3 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055402.1| Viola tricolor subsp. curtisii clone c2 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055401.1| Viola tricolor subsp. curtisii clone b4 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055400.1| Viola tricolor subsp. curtisii clone b3 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055399.1| Viola tricolor subsp. curtisii clone a1 from Netherlands 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055398.1| Viola tricolor subsp. tricolor clone c6 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055397.1| Viola tricolor subsp. tricolor clone c3 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055396.1| Viola tricolor subsp. tricolor clone c2 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055395.1| Viola tricolor subsp. tricolor clone b4 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055394.1| Viola tricolor subsp. tricolor clone b3 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055393.1| Viola tricolor subsp. tricolor clone b1 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055392.1| Viola tricolor subsp. tricolor clone a4 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055391.1| Viola tricolor subsp. tricolor clone a3 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055390.1| Viola tricolor subsp. tricolor clone a1 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055381.1| Viola guestphalica clone a2 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055380.1| Viola guestphalica clone a1 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055378.1| Viola guestphalica clone b2 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 204 cgagcgctccctcctcgccc 223
to top
>gb|DQ055377.1| Viola lutea clone g16 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 681

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055376.1| Viola lutea clone g14 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055375.1| Viola lutea clone g13 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055374.1| Viola lutea clone f15 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055373.1| Viola lutea clone f13 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055372.1| Viola lutea clone c13 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055371.1| Viola lutea clone c11 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055370.1| Viola lutea clone c10 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055369.1| Viola lutea clone a15 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055368.1| Viola lutea clone a14 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055367.1| Viola lutea clone a13 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055365.1| Viola lutea clone d5 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055364.1| Viola lutea clone d4 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055363.1| Viola lutea clone d3 from France 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055362.1| Viola lutea subsp. calaminaria clone c2 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055361.1| Viola lutea subsp. calaminaria clone c1 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055360.1| Viola lutea subsp. calaminaria clone e4 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055359.1| Viola lutea subsp. calaminaria clone d3 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055358.1| Viola lutea subsp. calaminaria clone d2 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055357.1| Viola lutea subsp. calaminaria clone b2 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055356.1| Viola lutea subsp. calaminaria clone b1 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055355.1| Viola lutea subsp. calaminaria clone y4 from Germany 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055347.1| Viola arvensis clone d4 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055346.1| Viola arvensis clone d1 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055345.1| Viola arvensis clone c5 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055344.1| Viola arvensis clone c4 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055343.1| Viola arvensis clone b6 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055342.1| Viola arvensis clone a3 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055341.1| Viola arvensis clone b1 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>gb|DQ055340.1| Viola arvensis clone a1 from Germany 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 679

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  cgagcgctccctcctcgccc 112
           ||||||||||||||||||||
Sbjct: 205 cgagcgctccctcctcgccc 224
to top
>dbj|AP005251.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0011H15
          Length = 130146

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 177   cttcagtgacttcaagatgattga 200
             |||||||||| |||||||||||||
Sbjct: 70049 cttcagtgacctcaagatgattga 70072
to top
>dbj|AP004044.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
            clone:OJ1125_C01
          Length = 123849

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 177  cttcagtgacttcaagatgattga 200
            |||||||||| |||||||||||||
Sbjct: 5627 cttcagtgacctcaagatgattga 5650
to top
>emb|CR812466.18| Zebrafish DNA sequence from clone CH211-269M1 in linkage group 1,
              complete sequence
          Length = 138505

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 162    tttgagcaaaatgtacttca 181
              ||||||||||||||||||||
Sbjct: 137551 tttgagcaaaatgtacttca 137570
to top
>dbj|AB084920.2| Halocynthia roretzi mRNA for HrTRPV, complete cds
          Length = 3977

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 172 atgtacttcagtgacttcaa 191
           ||||||||||||||||||||
Sbjct: 861 atgtacttcagtgacttcaa 880
to top
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                       
Query: 338     ccggcctgggcgcccgtgacagtctccggctggaggcggg 377
               ||||||| |||||||| ||||  || ||||||||||||||
Sbjct: 1838648 ccggcctcggcgcccgcgacacgctgcggctggaggcggg 1838609
to top
>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete sequence
          Length = 123386

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 308    tggagaagtccgagggcaaggtgaggct 335
              |||||||||||||||| ||||| |||||
Sbjct: 111854 tggagaagtccgagggtaaggtaaggct 111827
to top
>dbj|AP005672.1| Physcomitrella patens subsp. patens chloroplast DNA, complete genome
          Length = 122890

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 418    ccagtggaggcggggcctgt 437
              ||||||||||||||||||||
Sbjct: 114640 ccagtggaggcggggcctgt 114621



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 418   ccagtggaggcggggcctgt 437
             ||||||||||||||||||||
Sbjct: 93462 ccagtggaggcggggcctgt 93481
to top
>emb|AL845172.3| Mouse DNA sequence from clone RP23-285J17 on chromosome 2, complete
             sequence
          Length = 185138

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 133   ccaactctccagttgctgacaaag 156
             |||||||| |||||||||||||||
Sbjct: 77024 ccaactctgcagttgctgacaaag 77001


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,099,568
Number of Sequences: 3902068
Number of extensions: 4099568
Number of successful extensions: 84219
Number of sequences better than 10.0: 141
Number of HSP's better than 10.0 without gapping: 141
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83274
Number of HSP's gapped (non-prelim): 939
length of query: 590
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 567
effective length of database: 17,143,297,704
effective search space: 9720249798168
effective search space used: 9720249798168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top