>ref|NM_188414.1| Oryza sativa (japonica cultivar-group), Ozsa8140 predicted mRNA
          Length = 2007

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 122/145 (84%), Gaps = 1/145 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    catgcgcttattattgggatcaacttcgaggagattgactttgacaagaatgatgctgtc 61
            ||||| ||||| ||||| |||||||| |||||| ||||||||||||||||||| ||||| 
Sbjct: 1243 catgcacttatcattggtatcaactttgaggaggttgactttgacaagaatgacgctgtt 1302

                                                                        
Query: 62   gacaagatcatggtacgacttcgatacttcaggcaatgacacagtggaggaagatgagtt 121
            ||||||||||||| | ||||| || || ||||||||||| |  || ||||| |  |||||
Sbjct: 1303 gacaagatcatgg-atgactttgacacgtcaggcaatgatatcgtcgaggaggcagagtt 1361

                                     
Query: 122  tgtcgcgggaatgaaaatatggctt 146
            |||| |||| ||||| | |||||||
Sbjct: 1362 tgtctcggggatgaagagatggctt 1386

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 122/145 (84%), Gaps = 1/145 (0%)
 Strand = Plus / Plus

                                                                           
Query: 2       catgcgcttattattgggatcaacttcgaggagattgactttgacaagaatgatgctgtc 61
               ||||| ||||| ||||| |||||||| |||||| ||||||||||||||||||| ||||| 
Sbjct: 6136891 catgcacttatcattggtatcaactttgaggaggttgactttgacaagaatgacgctgtt 6136950

                                                                           
Query: 62      gacaagatcatggtacgacttcgatacttcaggcaatgacacagtggaggaagatgagtt 121
               ||||||||||||| | ||||| || || ||||||||||| |  || ||||| |  |||||
Sbjct: 6136951 gacaagatcatgg-atgactttgacacgtcaggcaatgatatcgtcgaggaggcagagtt 6137009

                                        
Query: 122     tgtcgcgggaatgaaaatatggctt 146
               |||| |||| ||||| | |||||||
Sbjct: 6137010 tgtctcggggatgaagagatggctt 6137034

>dbj|AP002092.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031E09
          Length = 176349

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 122/145 (84%), Gaps = 1/145 (0%)
 Strand = Plus / Plus

                                                                          
Query: 2      catgcgcttattattgggatcaacttcgaggagattgactttgacaagaatgatgctgtc 61
              ||||| ||||| ||||| |||||||| |||||| ||||||||||||||||||| ||||| 
Sbjct: 161248 catgcacttatcattggtatcaactttgaggaggttgactttgacaagaatgacgctgtt 161307

                                                                          
Query: 62     gacaagatcatggtacgacttcgatacttcaggcaatgacacagtggaggaagatgagtt 121
              ||||||||||||| | ||||| || || ||||||||||| |  || ||||| |  |||||
Sbjct: 161308 gacaagatcatgg-atgactttgacacgtcaggcaatgatatcgtcgaggaggcagagtt 161366

                                       
Query: 122    tgtcgcgggaatgaaaatatggctt 146
              |||| |||| ||||| | |||||||
Sbjct: 161367 tgtctcggggatgaagagatggctt 161391

>dbj|AK066468.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013066B01, full
            insert sequence
          Length = 2023

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 122/145 (84%), Gaps = 1/145 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2    catgcgcttattattgggatcaacttcgaggagattgactttgacaagaatgatgctgtc 61
            ||||| ||||| ||||| |||||||| |||||| ||||||||||||||||||| ||||| 
Sbjct: 1028 catgcacttatcattggtatcaactttgaggaggttgactttgacaagaatgacgctgtt 1087

                                                                        
Query: 62   gacaagatcatggtacgacttcgatacttcaggcaatgacacagtggaggaagatgagtt 121
            ||||||||||||| | ||||| || || ||||||||||| |  || ||||| |  |||||
Sbjct: 1088 gacaagatcatgg-atgactttgacacgtcaggcaatgatatcgtcgaggaggcagagtt 1146

                                     
Query: 122  tgtcgcgggaatgaaaatatggctt 146
            |||| |||| ||||| | |||||||
Sbjct: 1147 tgtctcggggatgaagagatggctt 1171

>gb|AY676122.1| Pyrgula annulata 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 472

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 41  tttgacaagaatgatgctgtc 61
           |||||||||||||||||||||
Sbjct: 107 tttgacaagaatgatgctgtc 127

>gb|AY676121.1| Dianella thiesseana 16S large subunit ribosomal RNA gene, partial
           sequence; mitochondrial
          Length = 472

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 41  tttgacaagaatgatgctgtc 61
           |||||||||||||||||||||
Sbjct: 107 tttgacaagaatgatgctgtc 127

>gb|AC018554.7| Homo sapiens chromosome 16 clone RP11-457D20, complete sequence
          Length = 216977

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   cagtggaggaagatgagtttg 123
             |||||||||||||||||||||
Sbjct: 81319 cagtggaggaagatgagtttg 81339

>gb|AF445340.1| Pyrgula annulata 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 501

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 41  tttgacaagaatgatgctgtc 61
           |||||||||||||||||||||
Sbjct: 126 tttgacaagaatgatgctgtc 146

>ref|XM_754856.1| Ustilago maydis 521 hypothetical protein (UM03802.1) partial mRNA
          Length = 2106

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 29  gaggagattgactttgacaa 48
           ||||||||||||||||||||
Sbjct: 490 gaggagattgactttgacaa 509

>emb|AL670009.1|NC123A4 Neurospora crassa DNA linkage group V cosmid contig 123A4
          Length = 153794

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 51    atgatgctgtcgacaagatc 70
             ||||||||||||||||||||
Sbjct: 96688 atgatgctgtcgacaagatc 96669

>gb|AC130289.11| Homo sapiens chromosome 17, clone RP1-66C13, complete sequence
          Length = 136599

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ttgactttgacaagaatgat 55
             ||||||||||||||||||||
Sbjct: 15445 ttgactttgacaagaatgat 15464

>ref|XM_220008.3| PREDICTED: Rattus norvegicus phosphoinositide-3-kinase adaptor
            protein 1 (predicted) (Pik3ap1_predicted), mRNA
          Length = 5208

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 100  acacagtggaggaagatgag 119
            ||||||||||||||||||||
Sbjct: 2072 acacagtggaggaagatgag 2091

>emb|AL354047.6|HS66C13 Homo sapiens chromosome 17 from PAC RPCI-1 66C13 map 17p11.2 region
             D17S842-D17S953, complete sequence
          Length = 156907

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ttgactttgacaagaatgat 55
             ||||||||||||||||||||
Sbjct: 15446 ttgactttgacaagaatgat 15465

>ref|NM_213707.1| Xenopus tropicalis hypothetical protein MGC69339 (MGC69339), mRNA
          Length = 1931

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 87   acttcaggcaatgacacagtgga 109
            ||||||||||||| |||||||||
Sbjct: 1055 acttcaggcaatgccacagtgga 1077

>gb|BC077382.1| Xenopus laevis cDNA clone IMAGE:6864060, partial cds
          Length = 3495

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 95   caatgacacagtggaggaagatg 117
            |||| ||||||||||||||||||
Sbjct: 2552 caatcacacagtggaggaagatg 2530

>gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome 6, complete sequence
          Length = 192869

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 131   aatgaaaatatggcttcac 149
             |||||||||||||||||||
Sbjct: 81057 aatgaaaatatggcttcac 81039

>gb|AC132411.3| Mus musculus BAC clone RP23-352O24 from chromosome 1, complete sequence
          Length = 181902

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 36     ttgactttgacaagaatga 54
              |||||||||||||||||||
Sbjct: 125706 ttgactttgacaagaatga 125688

>emb|Z83745.1|HS453A3 Human DNA sequence from clone RP3-453A3 on chromosome Xp11 Contains a
            protein phosphatase 1, regulatory (inhibitor) subunit 11
            (PPP1R11) pseudogene and the 5' end of the gene for a
            novel protein (FLJ31204), complete sequence
          Length = 130926

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 31   ggagattgactttgacaag 49
            |||||||||||||||||||
Sbjct: 1243 ggagattgactttgacaag 1225

>emb|BX538353.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 4/4
          Length = 277703

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 29    gaggagattgactttgaca 47
             |||||||||||||||||||
Sbjct: 78944 gaggagattgactttgaca 78926

>gb|AC090579.6| Homo sapiens chromosome 8, clone RP11-649G15, complete sequence
          Length = 186066

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 108    gaggaagatgagtttgtcg 126
              |||||||||||||||||||
Sbjct: 144287 gaggaagatgagtttgtcg 144269

>gb|BC098978.1| Xenopus laevis cDNA clone IMAGE:4970613, partial cds
          Length = 3717

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 95   caatgacacagtggaggaagatg 117
            |||| ||||||||||||||||||
Sbjct: 2726 caatcacacagtggaggaagatg 2704

>ref|XM_938797.1| PREDICTED: Homo sapiens similar to Transgelin-2 (LOC648155), mRNA
          Length = 1379

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 108  gaggaagatgagtttgtcg 126
            |||||||||||||||||||
Sbjct: 1324 gaggaagatgagtttgtcg 1342

>ref|XM_927980.1| PREDICTED: Homo sapiens similar to Transgelin-2 (LOC643319), mRNA
          Length = 1379

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 108  gaggaagatgagtttgtcg 126
            |||||||||||||||||||
Sbjct: 1324 gaggaagatgagtttgtcg 1342

>gb|AC022428.7| Homo sapiens chromosome 5 clone CTD-2372H16, complete sequence
          Length = 94891

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 31  ggagattgactttgacaag 49
           |||||||||||||||||||
Sbjct: 216 ggagattgactttgacaag 198

>ref|XM_627796.1| Cryptosporidium parvum Iowa II Prp9p-like splicing factor 3a
           subunit 3 snRNP. C-terminal C2H2 (cgd6_4670), partial
           mRNA
          Length = 1482

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 29  gaggagattgactttgaca 47
           |||||||||||||||||||
Sbjct: 421 gaggagattgactttgaca 439

>emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chromosome 4, complete
              sequence
          Length = 186208

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 130    gaatgaaaatatggcttca 148
              |||||||||||||||||||
Sbjct: 124257 gaatgaaaatatggcttca 124275

>gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222826

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 33    agattgactttgacaagaatgat 55
             ||||||||||||| |||||||||
Sbjct: 78607 agattgactttgataagaatgat 78629

>gb|AC016591.6|AC016591 Homo sapiens chromosome 5 clone CTD-2003D5, complete sequence
          Length = 137366

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 31    ggagattgactttgacaag 49
             |||||||||||||||||||
Sbjct: 51973 ggagattgactttgacaag 51991

>gb|AC023344.4|AC023344 Homo sapiens BAC clone RP11-395G23 from 8, complete sequence
          Length = 186751

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 108   gaggaagatgagtttgtcg 126
             |||||||||||||||||||
Sbjct: 37151 gaggaagatgagtttgtcg 37133

>gb|DQ020202.1| Homo sapiens oxidation resistance 1 (OXR1) gene, complete cds
          Length = 96584

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 108   gaggaagatgagtttgtcg 126
             |||||||||||||||||||
Sbjct: 39933 gaggaagatgagtttgtcg 39915

>gb|AC099344.4| Homo sapiens BAC clone RP11-427E2 from 2, complete sequence
          Length = 135598

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 131   aatgaaaatatggcttcac 149
             |||||||||||||||||||
Sbjct: 47082 aatgaaaatatggcttcac 47100

>gb|AC153890.8| Mus musculus  BAC RP23-403C13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 202932

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     caacttcgaggagattgac 40
              |||||||||||||||||||
Sbjct: 126160 caacttcgaggagattgac 126178

>gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 198060

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 33   agattgactttgacaagaatgat 55
            ||||||||||||| |||||||||
Sbjct: 2256 agattgactttgataagaatgat 2234

>gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome 14, complete sequence
          Length = 246800

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 101    cacagtggaggaagatgag 119
              |||||||||||||||||||
Sbjct: 210755 cacagtggaggaagatgag 210773

>emb|CT030647.17| Mouse DNA sequence from clone RP23-379I9 on chromosome 14, complete
             sequence
          Length = 205598

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 101   cacagtggaggaagatgag 119
             |||||||||||||||||||
Sbjct: 76265 cacagtggaggaagatgag 76283

>dbj|AP000856.3| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1539E1
          Length = 152130

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 108   gaggaagatgagtttgtcg 126
             |||||||||||||||||||
Sbjct: 65644 gaggaagatgagtttgtcg 65626

>gb|BC067955.1| Xenopus tropicalis hypothetical protein MGC69339, mRNA (cDNA clone
            IMAGE:5309042)
          Length = 1931

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 87   acttcaggcaatgacacagtgga 109
            ||||||||||||| |||||||||
Sbjct: 1055 acttcaggcaatgccacagtgga 1077

>dbj|AP004285.2| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1356H11
          Length = 145327

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 108    gaggaagatgagtttgtcg 126
              |||||||||||||||||||
Sbjct: 124447 gaggaagatgagtttgtcg 124429


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,476,998
Number of Sequences: 3902068
Number of extensions: 1476998
Number of successful extensions: 103641
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 103541
Number of HSP's gapped (non-prelim): 100
length of query: 191
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 169
effective length of database: 17,147,199,772
effective search space: 2897876761468
effective search space used: 2897876761468
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)