ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags39h13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U26545.1|HVU26545 Hordeum vulgare Mg-chelatase subunit (Xanth... 1140 0.0
2gb|DQ084026.1| Zea mays magnesium chelatase subunit I precursor ... 654 0.0
3gb|DQ084025.1| Zea mays magnesium chelatase subunit I precursor ... 654 0.0
4gb|AY109514.1| Zea mays CL865_1 mRNA sequence 549 e-153
5ref|XM_462936.1| Oryza sativa (japonica cultivar-group), mRNA 470 e-129
6gb|AC084767.11| Oryza sativa (japonica cultivar-group) chromosom... 470 e-129
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 470 e-129
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 470 e-129
9dbj|AK104435.1| Oryza sativa (japonica cultivar-group) cDNA clon... 470 e-129
10dbj|AK070720.1| Oryza sativa (japonica cultivar-group) cDNA clon... 470 e-129
11dbj|AK060389.1| Oryza sativa (japonica cultivar-group) cDNA clon... 470 e-129
12dbj|AK071134.1| Oryza sativa (japonica cultivar-group) cDNA clon... 462 e-127
13dbj|AK066270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 339 6e-90
14gb|AF343974.1|AF343974 Chlamydomonas reinhardtii magnesium-chela... 299 5e-78
15dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 157 5e-35
16emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segmen... 141 3e-30
17gb|CP000110.1| Synechococcus sp. CC9605, complete genome 115 2e-22
18dbj|D45857.1|SOYCHLI Soybean mRNA for Mg chelatase subunit (46 k... 115 2e-22
19gb|AY616113.1| Prototheca wickerhamii plastid Mg chelatase subun... 107 4e-20
20emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome;... 98 4e-17
21gb|BT012789.1| Lycopersicon esculentum clone 113783F, mRNA sequence 92 3e-15
22gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 82 2e-12
23gb|CP000097.1| Synechococcus sp. CC9902, complete genome 76 1e-10
24gb|AF014053.1|AF014053 Nicotiana tabacum Mg protoporphyrin chela... 76 1e-10
25gb|AE006470.1| Chlorobium tepidum TLS, complete genome 72 2e-09
26gb|AY005135.1| Chlorobium tepidum Ybc5 (ybc5) gene, partial cds;... 72 2e-09
27gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 70 9e-09
28gb|U67064.1|NTU67064 Nicotiana tabacum sulfur gene (Su-s) mRNA, ... 70 9e-09
29gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 66 1e-07
30gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 64 6e-07
31emb|BX927153.1| Corynebacterium glutamicum ATCC 13032, IS finger... 64 6e-07
32emb|AJ010302.1|RSP010302 Rhodobacter sphaeroides photosynthetic ... 64 6e-07
33gb|AF195122.1| Rhodobacter sphaeroides photosynthetic gene clust... 64 6e-07
34gb|CP000249.1| Frankia sp. CcI3, complete genome 64 6e-07
35dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, compl... 64 6e-07
36gb|AF017642.1|AF017642 Rhodobacter sphaeroides magnesium chelata... 64 6e-07
37dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 62 2e-06
38dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 62 2e-06
39gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 62 2e-06
40gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 60 9e-06
41gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 58 3e-05
42emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 58 3e-05
43emb|BX842581.1| Mycobacterium tuberculosis H37Rv complete genome... 58 3e-05
44dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 58 3e-05
45gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 56 1e-04
46gb|CP000088.1| Thermobifida fusca YX, complete genome 56 1e-04
47dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 56 1e-04
48gb|U35144.1|SSU35144 Synechocystis sp. Mg-protoporhyrin IX (chlI... 56 1e-04
49emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... 54 5e-04
50emb|Z83933.1|CVZ83933 Chlorobium vibrioforme 15 kb genomic DNA f... 52 0.002
51dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 52 0.002
52gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 52 0.002
53gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 50 0.009
54emb|Z11165.1|RCPHSYNG R.capsulatus complete photosynthesis gene ... 48 0.034
55gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 48 0.034
56gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 48 0.034
57gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 48 0.034
58emb|X52291.1|RCCRTAK Rhodobacter capsulatus clustered genes crtA... 48 0.034
59gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 48 0.034
60ref|NM_123961.2| Arabidopsis thaliana CHLI2; magnesium chelatase... 46 0.13
61ref|NM_123962.2| Arabidopsis thaliana hydrolase AT5G45940 mRNA, ... 46 0.13
62gb|BT015783.1| Arabidopsis thaliana At5g45930 mRNA, complete cds 46 0.13
63gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete... 46 0.13
64gb|AY140022.1| Arabidopsis thaliana magnesium chelatase subunit ... 46 0.13
65gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, R... 46 0.13
66emb|BX831184.1|CNS09ZFF Arabidopsis thaliana Full-length cDNA Co... 46 0.13
67dbj|AB016870.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.13
68dbj|AB017350.1| Acidiphilium rubrum bchP, bchI, bchD, crtI genes... 46 0.13
69gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, compl... 44 0.53
70gb|AC007269.3| Homo sapiens PAC clone RP5-1058P19 from 7, comple... 44 0.53
71gb|AF080002.1|AF080002 Heliobacillus mobilis exopolyphosphatase ... 44 0.53
72emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 44 0.53
73gb|AF027390.1|AF027390 Homo sapiens 7q telomere, complete sequence 44 0.53
74gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 42 2.1
75gb|DQ468113.1| Arthrospira platensis magnesium chelatas ChlI sub... 42 2.1
76emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 42 2.1
77gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 42 2.1
78gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 42 2.1
79dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 42 2.1
80gb|AE011805.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 2.1
81gb|AE012526.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.1
82gb|AE012272.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.1
83gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 2.1
84gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 2.1
85ref|NM_209271.1| Eremothecium gossypii ADL178Wp (ADL178W), mRNA 42 2.1
86gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 42 2.1
87ref|NM_201215.1| Danio rerio zgc:56248 (zgc:56248), mRNA 40 8.2
88ref|NM_025807.1| Mus musculus solute carrier family 16 (monocarb... 40 8.2
89gb|BC034205.1| Mus musculus solute carrier family 16 (monocarbox... 40 8.2
90gb|AC164303.2| Mus musculus BAC clone RP24-530J21 from chromosom... 40 8.2
91gb|BC055839.1| Mus musculus solute carrier family 16 (monocarbox... 40 8.2
92gb|BC046023.1| Danio rerio zgc:56248, mRNA (cDNA clone MGC:56248... 40 8.2
93gb|AC121858.3| Mus musculus BAC clone RP24-104B23 from chromosom... 40 8.2
94gb|AC122923.4| Mus musculus BAC clone RP23-36G5 from 10, complet... 40 8.2
95emb|CR391986.5| Zebrafish DNA sequence from clone CH211-195O20 i... 40 8.2
96emb|AL121772.19|HSJ965G21 Human DNA sequence from clone RP5-965G... 40 8.2
97emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ... 40 8.2
98emb|AL939123.1|SCO939123 Streptomyces coelicolor A3(2) complete ... 40 8.2
99ref|NM_078673.2| Drosophila melanogaster TBP-associated factor 8... 40 8.2
100gb|AY071604.1| Drosophila melanogaster RE65343 full length cDNA 40 8.2
101gb|AC011614.8| Drosophila melanogaster, chromosome X, region 16F... 40 8.2
102gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome 40 8.2
103dbj|AK004684.2| Mus musculus adult male lung cDNA, RIKEN full-le... 40 8.2
104dbj|AK004599.1| Mus musculus adult male lung cDNA, RIKEN full-le... 40 8.2
105dbj|AK004556.1| Mus musculus adult male lung cDNA, RIKEN full-le... 40 8.2
106gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplas... 40 8.2
107gb|AF288461.1|AF288461 Chloroflexus aurantiacus BchI (bchI) and ... 40 8.2
108gb|AE005068.1| Halobacterium sp. NRC-1 section 99 of 170 of the ... 40 8.2
109gb|AE003507.3| Drosophila melanogaster chromosome X, section 59 ... 40 8.2
110emb|AL590988.11| Mouse DNA sequence from clone RP23-46C18 on chr... 40 8.2
111dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 8.2
112emb|AL671893.7| Mouse DNA sequence from clone RP23-170G19 on chr... 40 8.2
113emb|Y15513.1|DMPRODOS Drosophila melanogaster prodos gene 40 8.2

>gb|U26545.1|HVU26545 Hordeum vulgare Mg-chelatase subunit (Xantha-h) mRNA, partial cds
          Length = 1141

 Score = 1140 bits (575), Expect = 0.0
 Identities = 592/597 (99%), Gaps = 3/597 (0%)
 Strand = Plus / Plus

                                                                       
Query: 10  accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 253 accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 312

                                                                       
Query: 70  gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 313 gataaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 372

                                                                       
Query: 130 aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 373 aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 432

                                                                       
Query: 190 ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 433 ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 492

                                                                       
Query: 250 cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 493 cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 552

                                                                       
Query: 310 ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 553 ctcctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 612

                                                                       
Query: 370 gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 613 gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 672

                                                                       
Query: 430 tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 732

                                                                       
Query: 490 tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 733 tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 792

                                                                    
Query: 550 gtggatggactcagaggagacattgtcactaacagggc---tgccaaggcgttggct 603
           ||||||||||||||||||||||||||||||||||||||   ||||||||||||||||
Sbjct: 793 gtggatggactcagaggagacattgtcactaacagggcctatgccaaggcgttggct 849



to top

>gb|DQ084026.1| Zea mays magnesium chelatase subunit I precursor (ChlI) gene,
            ChlI-W22 allele, partial cds
          Length = 1455

 Score =  654 bits (330), Expect = 0.0
 Identities = 528/594 (88%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||
Sbjct: 715  accatggtcgacctgcccctcggcgccaccgaggaccgcgtctgcggcaccattgacatc 774

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            |||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 775  gagaaggcgctcaccgagggcgtcaaggcgttcgagcccggcctgctcgccaaggccaac 834

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            |||||||||||||| || |||||||| |||||||| |||||||| || || || || |||
Sbjct: 835  aggggcatactgtacgtcgacgaggtcaacctgctggacgaccacctcgtcgacgtgctg 894

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            |||||||| || ||||| |||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 895  ctggattccgctgcgtcggggtggaacacggtggagagggagggtatctccatatcccac 954

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| |||||||||||||| ||||| ||||||||||||||||| |||||| |||| |||
Sbjct: 955  cctgctcgcttcatcctcatcggctctggtaacccggaggaaggggagctcaggccccag 1014

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||
Sbjct: 1015 ctgctggaccggttcgggatgcacgcgcaggttggtaccgtcagggacgccgagctcagg 1074

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            |||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||  |||| 
Sbjct: 1075 gtgaagatcgtggaggagagggctcgtttcgacagggatccgaagacgttccgtgagtcg 1134

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            |||   || ||||| || ||||||||| |||||||  |||| || ||||| ||||| || 
Sbjct: 1135 taccatgacgagcaggagaagctccagcagcagatatcatctgcacggagtaaccttggc 1194

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             |||||||| | |||||||| ||||| || ||||||||| ||||||| || ||| |||| 
Sbjct: 1195 gctgtgcagattgaccatgacctccgtgtcaagatatccaaggtgtgctctgagttgaac 1254

                                                                  
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggct 603
            || |||||||||||||| |||||||| ||||||||||||||||||||| |||||
Sbjct: 1255 gttgatggactcagaggtgacattgtgactaacagggctgccaaggcgctggct 1308



to top

>gb|DQ084025.1| Zea mays magnesium chelatase subunit I precursor (ChlI) mRNA,
            ChlI-W22 allele, complete cds
          Length = 1248

 Score =  654 bits (330), Expect = 0.0
 Identities = 528/594 (88%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||
Sbjct: 508  accatggtcgacctgcccctcggcgccaccgaggaccgcgtctgcggcaccattgacatc 567

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            |||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 568  gagaaggcgctcaccgagggcgtcaaggcgttcgagcccggcctgctcgccaaggccaac 627

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            |||||||||||||| || |||||||| |||||||| |||||||| || || || || |||
Sbjct: 628  aggggcatactgtacgtcgacgaggtcaacctgctggacgaccacctcgtcgacgtgctg 687

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            |||||||| || ||||| |||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 688  ctggattccgctgcgtcggggtggaacacggtggagagggagggtatctccatatcccac 747

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| |||||||||||||| ||||| ||||||||||||||||| |||||| |||| |||
Sbjct: 748  cctgctcgcttcatcctcatcggctctggtaacccggaggaaggggagctcaggccccag 807

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||
Sbjct: 808  ctgctggaccggttcgggatgcacgcgcaggttggtaccgtcagggacgccgagctcagg 867

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            |||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||  |||| 
Sbjct: 868  gtgaagatcgtggaggagagggctcgtttcgacagggatccgaagacgttccgtgagtcg 927

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            |||   || ||||| || ||||||||| |||||||  |||| || ||||| ||||| || 
Sbjct: 928  taccatgacgagcaggagaagctccagcagcagatatcatctgcacggagtaaccttggc 987

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             |||||||| | |||||||| ||||| || ||||||||| ||||||| || ||| |||| 
Sbjct: 988  gctgtgcagattgaccatgacctccgtgtcaagatatccaaggtgtgctctgagttgaac 1047

                                                                  
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggct 603
            || |||||||||||||| |||||||| ||||||||||||||||||||| |||||
Sbjct: 1048 gttgatggactcagaggtgacattgtgactaacagggctgccaaggcgctggct 1101



to top

>gb|AY109514.1| Zea mays CL865_1 mRNA sequence
          Length = 1376

 Score =  549 bits (277), Expect = e-153
 Identities = 379/413 (91%)
 Strand = Plus / Plus

                                                                       
Query: 10  accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
           |||||||||||||||||||||||||||||||||||| | || ||||||||||| ||||||
Sbjct: 525 accatggtcgacctgcccctcggcgccaccgaggaccgcgtctgcggcaccattgacatc 584

                                                                       
Query: 70  gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
           |||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 585 gagaaggcgctcaccgagggcgtcaaggcgttcgagcccggcctgctcgccaaggccaac 644

                                                                       
Query: 130 aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
           |||||||||||||| || |||||||| |||||||| |||||||| || || || || |||
Sbjct: 645 aggggcatactgtacgtcgacgaggtcaacctgctggacgaccacctcgtcgacgtgctg 704

                                                                       
Query: 190 ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
           |||||||| || ||||| |||||||||||||||||||||||||| |||||||| ||||||
Sbjct: 705 ctggattccgctgcgtcggggtggaacacggtggagagggagggtatctccatatcccac 764

                                                                       
Query: 250 cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
           ||||| |||||||||||||| ||||| ||||||||||||||||| |||||| |||| |||
Sbjct: 765 cctgctcgcttcatcctcatcggctctggtaacccggaggaaggggagctcaggccccag 824

                                                                       
Query: 310 ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||
Sbjct: 825 ctgctggaccggttcgggatgcacgcgcaggttggtaccgtcagggacgccgagctcagg 884

                                                                
Query: 370 gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccg 422
           |||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 885 gtgaagatcgtggaggagagggctcgtttcgacagggatccgaagacgttccg 937



 Score =  113 bits (57), Expect = 7e-22
 Identities = 99/113 (87%)
 Strand = Plus / Plus

                                                                        
Query: 491  ctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaatg 550
            |||||||| | |||||||| ||||| || ||||||||| ||||||| || ||| |||| |
Sbjct: 1006 ctgtgcagattgaccatgacctccgtgtcaagatatccaaggtgtgctctgagttgaacg 1065

                                                                 
Query: 551  tggatggactcagaggagacattgtcactaacagggctgccaaggcgttggct 603
            | |||||||||||||| |||||||| ||||||||||||||||||||| |||||
Sbjct: 1066 ttgatggactcagaggtgacattgtgactaacagggctgccaaggcgctggct 1118



to top

>ref|XM_462936.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1286

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 508  accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 567

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 568  gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 627

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 628  agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 687

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 688  ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 747

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 748  cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 807

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 808  ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 867

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 868  gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 927

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 928  tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 987

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 988  gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 1047

                                                                 
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
            || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 1048 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 1100



to top

>gb|AC084767.11| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0057P11
             map R606A, complete sequence
          Length = 163580

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Plus

                                                                         
Query: 10    accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
             |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 75307 accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 75366

                                                                         
Query: 70    gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
             ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 75367 gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 75426

                                                                         
Query: 130   aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
             ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 75427 agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 75486

                                                                         
Query: 190   ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
             ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 75487 ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 75546

                                                                         
Query: 250   cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
             ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 75547 cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 75606

                                                                         
Query: 310   ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
             ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 75607 ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 75666

                                                                         
Query: 370   gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
             ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 75667 gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 75726

                                                                         
Query: 430   tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
             ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 75727 tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 75786

                                                                         
Query: 490   tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
              |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 75787 gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 75846

                                                                  
Query: 550   gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
             || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 75847 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 75899



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Minus

                                                                            
Query: 10       accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
                |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 20056706 accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 20056647

                                                                            
Query: 70       gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
                ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 20056646 gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 20056587

                                                                            
Query: 130      aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
                ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 20056586 agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 20056527

                                                                            
Query: 190      ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
                ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 20056526 ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 20056467

                                                                            
Query: 250      cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
                ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 20056466 cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 20056407

                                                                            
Query: 310      ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
                ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 20056406 ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 20056347

                                                                            
Query: 370      gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
                ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 20056346 gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 20056287

                                                                            
Query: 430      tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
                ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 20056286 tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 20056227

                                                                            
Query: 490      tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
                 |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 20056226 gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 20056167

                                                                     
Query: 550      gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
                || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 20056166 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 20056114



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Minus

                                                                            
Query: 10       accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
                |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 20049734 accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 20049675

                                                                            
Query: 70       gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
                ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 20049674 gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 20049615

                                                                            
Query: 130      aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
                ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 20049614 agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 20049555

                                                                            
Query: 190      ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
                ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 20049554 ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 20049495

                                                                            
Query: 250      cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
                ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 20049494 cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 20049435

                                                                            
Query: 310      ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
                ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 20049434 ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 20049375

                                                                            
Query: 370      gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
                ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 20049374 gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 20049315

                                                                            
Query: 430      tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
                ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 20049314 tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 20049255

                                                                            
Query: 490      tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
                 |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 20049254 gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 20049195

                                                                     
Query: 550      gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
                || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 20049194 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 20049142



to top

>dbj|AK104435.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-D12, full
            insert sequence
          Length = 1504

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 528  accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 587

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 588  gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 647

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 648  agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 707

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 708  ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 767

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 768  cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 827

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 828  ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 887

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 888  gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 947

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 948  tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 1007

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 1008 gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 1067

                                                                 
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
            || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 1068 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 1120



to top

>dbj|AK070720.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023056M13, full
            insert sequence
          Length = 2111

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 545  accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 604

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 605  gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 664

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 665  agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 724

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 725  ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 784

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 785  cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 844

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 845  ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 904

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 905  gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 964

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 965  tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 1024

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 1025 gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 1084

                                                                 
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
            || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 1085 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 1137



to top

>dbj|AK060389.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-H01, full
            insert sequence
          Length = 1481

 Score =  470 bits (237), Expect = e-129
 Identities = 504/593 (84%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 567  accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 626

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 627  gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 686

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 687  agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 746

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 747  ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 806

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 807  cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 866

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 867  ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 926

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 927  gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 986

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 987  tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 1046

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             |||||||| | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 1047 gctgtgcagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 1106

                                                                 
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
            || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 1107 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 1159



to top

>dbj|AK071134.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078K03, full
            insert sequence
          Length = 1576

 Score =  462 bits (233), Expect = e-127
 Identities = 503/593 (84%)
 Strand = Plus / Plus

                                                                        
Query: 10   accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
            |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 550  accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 609

                                                                        
Query: 70   gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
            ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 610  gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 669

                                                                        
Query: 130  aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
            ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 670  agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 729

                                                                        
Query: 190  ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
            ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 730  ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 789

                                                                        
Query: 250  cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
            ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 790  cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 849

                                                                        
Query: 310  ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
            ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 850  ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 909

                                                                        
Query: 370  gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
            ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 910  gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 969

                                                                        
Query: 430  tacttggaggagcaagataagctccaggagcagatcacatccgctcggagcaacctcggt 489
            ||||||||||| ||||| ||||||||| |||||||  |||| |||||||| ||||| |||
Sbjct: 970  tacttggaggaacaagacaagctccagcagcagatttcatctgctcggagtaaccttggt 1029

                                                                        
Query: 490  tctgtgcagctcgaccatgatctccgggttaagatatcccaggtgtgttccgagctgaat 549
             ||||| || | ||||||||||| || |||||||| ||  | |||||| | ||| |||||
Sbjct: 1030 gctgtgaagattgaccatgatcttcgtgttaagatttctaaagtgtgtgcagagttgaat 1089

                                                                 
Query: 550  gtggatggactcagaggagacattgtcactaacagggctgccaaggcgttggc 602
            || |||||| | ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 1090 gttgatggattaagaggggacattgtgactaacagggctgccaaggcgttggc 1142



to top

>dbj|AK066270.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013062C16, full
           insert sequence
          Length = 2780

 Score =  339 bits (171), Expect = 6e-90
 Identities = 363/427 (85%)
 Strand = Plus / Plus

                                                                       
Query: 10  accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
           |||||||| || || ||||| || ||||| ||||| || || || |||||||| || || 
Sbjct: 544 accatggtagatcttccccttggtgccactgaggatagagtctgtggcaccattgatatt 603

                                                                       
Query: 70  gagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaac 129
           ||||||||||||||||| |||||||||||||| ||||| ||  |||||||||||||||||
Sbjct: 604 gagaaggcgctcaccgatggtgtcaaggcgttcgagcctggtttgcttgccaaggccaac 663

                                                                       
Query: 130 aggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctg 189
           ||||| || || |||||||| ||||| ||  || | || |||||||| || ||||| || 
Sbjct: 664 agggggattctttatgtggatgaggtcaatttgttggatgaccatctagtagatgtgctt 723

                                                                       
Query: 190 ctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccac 249
           ||||||||||| ||||| || |||||||| |||||||| ||||| |||||||||||||||
Sbjct: 724 ctggattctgctgcgtcaggatggaacaccgtggagagagagggtatctccatctcccac 783

                                                                       
Query: 250 cctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcag 309
           ||||| || |||||||||||||| || |||||||| |||||||| ||||||||||| |||
Sbjct: 784 cctgctcggttcatcctcattgggtctggtaaccccgaggaaggggagctccggccacag 843

                                                                       
Query: 310 ctgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagg 369
           ||||| |||||||| || ||||||||||||||||| || |||||||| || || || |||
Sbjct: 844 ctgcttgaccggtttggcatgcacgcgcaggttggtactgtcagggatgctgaactcagg 903

                                                                       
Query: 370 gtgaagattgtggaggagagggctcggttcgacagggacccgaaaacgttccggcagtcc 429
           ||||| ||||| || ||||| ||||||||||||||||| || ||  |||||||  |||||
Sbjct: 904 gtgaaaattgttgaagagagagctcggttcgacagggatccaaaggcgttccgtgagtcc 963

                  
Query: 430 tacttgg 436
           |||||||
Sbjct: 964 tacttgg 970



to top

>gb|AF343974.1|AF343974 Chlamydomonas reinhardtii magnesium-chelatase subunit I (chlI)
           mRNA, complete cds
          Length = 2139

 Score =  299 bits (151), Expect = 5e-78
 Identities = 298/347 (85%)
 Strand = Plus / Plus

                                                                       
Query: 11  ccatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcg 70
           ||||||| ||||||||||| |||||||| |||||| | ||||||||||||||||||||||
Sbjct: 530 ccatggtggacctgcccctgggcgccactgaggaccgcgtgtgcggcaccatcgacatcg 589

                                                                       
Query: 71  agaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaaca 130
           |||||||||| |||||||||||||||||||| ||||| |||||||| |||||||||||| 
Sbjct: 590 agaaggcgctgaccgagggtgtcaaggcgttcgagcccggcctgctggccaaggccaacc 649

                                                                       
Query: 131 ggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctgc 190
           | ||||| ||||| ||||| ||||| |||||||| |||||||| ||||| ||||| ||||
Sbjct: 650 gcggcatcctgtacgtggatgaggtcaacctgctggacgaccacctggtcgatgtgctgc 709

                                                                       
Query: 191 tggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccacc 250
           |||| || ||||| ||||| |||||||| |||||| | ||||| |||||||||  |||||
Sbjct: 710 tggactcggccgcctccggctggaacaccgtggagcgcgagggtatctccatcagccacc 769

                                                                       
Query: 251 ctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcagc 310
           | || |||||||||||  | ||||| || ||||| ||||| || ||||| || || ||||
Sbjct: 770 ccgcccgcttcatcctggtcggctcgggcaaccccgaggagggtgagctgcgcccccagc 829

                                                          
Query: 311 tgctggaccggttcgggatgcacgcgcaggttggcaccgtcagggac 357
           ||||||| || ||||| |||||||| ||| | |||||||||| ||||
Sbjct: 830 tgctggatcgcttcggcatgcacgcccagatcggcaccgtcaaggac 876



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score =  157 bits (79), Expect = 5e-35
 Identities = 190/227 (83%)
 Strand = Plus / Plus

                                                                           
Query: 13      atggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcgag 72
               ||||| || ||||||||||| |||||||| ||| | || |||||||| ||||||||||| 
Sbjct: 1824102 atggtggatctgcccctcggggccaccgaagaccgcgtctgcggcacgatcgacatcgaa 1824161

                                                                           
Query: 73      aaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaacagg 132
               || || ||| ||||||| ||||| || || ||||| || ||||| |||   |||||| ||
Sbjct: 1824162 aaagccctctccgagggcgtcaaagccttcgagccggggctgctcgcccgtgccaaccgg 1824221

                                                                           
Query: 133     ggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctgctg 192
               ||||| || || || |||||||| ||||||||||||||||| ||||||||||| ||||| 
Sbjct: 1824222 ggcattctctacgtcgacgaggtcaacctgctcgacgaccacctggtggatgtactgctc 1824281

                                                              
Query: 193     gattctgccgcgtccgggtggaacacggtggagagggagggcatctc 239
               ||||| ||||| ||||| ||||||||||| ||| | |||||||||||
Sbjct: 1824282 gattcggccgcttccggctggaacacggtcgagcgcgagggcatctc 1824328



to top

>emb|BX569691.1| Synechococcus sp. WH8102 complete genome; segment 3/7
          Length = 347365

 Score =  141 bits (71), Expect = 3e-30
 Identities = 206/251 (82%)
 Strand = Plus / Minus

                                                                        
Query: 64   gacatcgagaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaag 123
            |||||||||||||| |||| |||||| ||    || |||||||| |||||||| ||||||
Sbjct: 2689 gacatcgagaaggccctcagcgagggcgtgcgtgcctttgagcccggcctgctggccaag 2630

                                                                        
Query: 124  gccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggat 183
            |||||| | ||| | || |||||||| |||||||||||||| || |||||||||||||||
Sbjct: 2629 gccaaccgcggcctgctttatgtggatgaggtgaacctgctggatgaccatctggtggat 2570

                                                                        
Query: 184  gttctgctggattctgccgcgtccgggtggaacacggtggagagggagggcatctccatc 243
            |||||||| ||||| || || || || ||||||||||||||  | |||||| | ||| | 
Sbjct: 2569 gttctgctcgattccgctgcttcgggttggaacacggtggaacgtgagggcgtgtccgtg 2510

                                                                        
Query: 244  tcccaccctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccgg 303
              ||| || || |||||| | || || |||||||| ||||| ||||| ||||| || |||
Sbjct: 2509 cgccatccagcccgcttcgtgctgatcggctccggcaaccctgaggagggcgaactgcgg 2450

                       
Query: 304  ccgcagctgct 314
            |||||||||||
Sbjct: 2449 ccgcagctgct 2439



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score =  115 bits (58), Expect = 2e-22
 Identities = 250/314 (79%)
 Strand = Plus / Plus

                                                                           
Query: 13      atggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcgag 72
               ||||| |||||||||||||| || || || ||| |  | |||||||||||||||||||||
Sbjct: 1771803 atggtggacctgcccctcggtgcaacggaagaccgcctctgcggcaccatcgacatcgag 1771862

                                                                           
Query: 73      aaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaacagg 132
               || || || | ||| || ||    || |||||||| || ||||| |||||||||||| | 
Sbjct: 1771863 aaagccctgagcgaaggcgtgcgcgcctttgagcccggtctgctggccaaggccaaccgc 1771922

                                                                           
Query: 133     ggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctgctg 192
               ||| | || || ||||| ||||||||||||||||||||||| || || || || || || 
Sbjct: 1771923 ggcctgctctacgtggatgaggtgaacctgctcgacgaccacctcgtcgacgtgcttctt 1771982

                                                                           
Query: 193     gattctgccgcgtccgggtggaacacggtggagagggagggcatctccatctcccaccct 252
               ||||| || || ||||| |||||||| |||||  |||| ||| ||||| |   |||||| 
Sbjct: 1771983 gattcagcagcctccggttggaacaccgtggaacgggaaggcgtctccgtgcgccacccc 1772042

                                                                           
Query: 253     gcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggccgcagctg 312
               || || ||| |  | ||||||||||| ||||| ||||||||||| ||||| || ||||||
Sbjct: 1772043 gcccgtttcgtgttgattggctccggcaaccccgaggaaggcgaactccgcccccagctg 1772102

                             
Query: 313     ctggaccggttcgg 326
               || ||||| |||||
Sbjct: 1772103 ctcgaccgtttcgg 1772116



to top

>dbj|D45857.1|SOYCHLI Soybean mRNA for Mg chelatase subunit (46 kD), complete cds
          Length = 1953

 Score =  115 bits (58), Expect = 2e-22
 Identities = 175/214 (81%)
 Strand = Plus / Plus

                                                                        
Query: 176  tggtggatgttctgctggattctgccgcgtccgggtggaacacggtggagagggagggca 235
            ||||||||||  || |||||||||| || || || |||||||| || ||||| ||||| |
Sbjct: 1261 tggtggatgtgttgttggattctgctgcatcaggatggaacacagtagagagagagggaa 1320

                                                                        
Query: 236  tctccatctcccaccctgcgcgcttcatcctcattggctccggtaacccggaggaaggcg 295
            | || ||||| || ||||| || || ||||| |||||||| || ||||| || ||||| |
Sbjct: 1321 tttctatctcgcatcctgcacggtttatcctaattggctcaggcaaccccgaagaagggg 1380

                                                                        
Query: 296  agctccggccgcagctgctggaccggttcgggatgcacgcgcaggttggcaccgtcaggg 355
            ||||||||||||||||||| ||  |||| || ||||| || || ||||| || || ||||
Sbjct: 1381 agctccggccgcagctgctagataggtttggaatgcatgctcaagttggaactgttaggg 1440

                                              
Query: 356  acgccgagctgagggtgaagattgtggaggagag 389
            | || ||||| || ||||||||||||||||||||
Sbjct: 1441 atgctgagctcagagtgaagattgtggaggagag 1474



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 530  aggtgtgttccgagctgaatgtggatggactcagaggagacat 572
            |||||||| | ||| |||||||||||||| | |||||||||||
Sbjct: 1615 aggtgtgtgctgagttgaatgtggatggattaagaggagacat 1657



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 64   gacatcgagaaggcgctcaccgagggtgtcaaggcgtttgagcc 107
            ||||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 1149 gacattgagaaagccctgactgagggtgtcaaggcatttgagcc 1192



to top

>gb|AY616113.1| Prototheca wickerhamii plastid Mg chelatase subunit I mRNA, partial
           cds; nuclear gene for plastid product
          Length = 600

 Score =  107 bits (54), Expect = 4e-20
 Identities = 93/106 (87%)
 Strand = Plus / Plus

                                                                       
Query: 11  ccatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcg 70
           ||||||| ||||||||||| || ||||| |||||| | |||||||||||||| |||||||
Sbjct: 491 ccatggtggacctgcccctgggagccacagaggaccgtgtgtgcggcaccattgacatcg 550

                                                         
Query: 71  agaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgct 116
           |||||||||| || ||||| || |||||||||||||| || |||||
Sbjct: 551 agaaggcgctgactgagggcgtgaaggcgtttgagcctgggctgct 596



to top

>emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome; segment 4/7
          Length = 346683

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                          
Query: 52     tgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcgtttgagccaggc 111
              |||||||||||||||||||||||||| |||| ||| || ||    || || |||||||||
Sbjct: 178620 tgcggcaccatcgacatcgagaaggccctcagcgaaggagttcgtgcattcgagccaggc 178679

                                                                          
Query: 112    ctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgac 171
              ||||| |||||||||||| | ||| | || || || || || || || ||||| ||||||
Sbjct: 178680 ctgctggccaaggccaaccgcggcttgctctacgtcgatgaagtcaatctgcttgacgac 178739

                                                                   
Query: 172    catctggtggatgttctgctggattctgccgcgtccgggtggaacacggtgga 224
              ||||| || ||||| ||||||||||| || || || || ||||||||||||||
Sbjct: 178740 catcttgtcgatgtgctgctggattcagcggcatcaggatggaacacggtgga 178792



to top

>gb|BT012789.1| Lycopersicon esculentum clone 113783F, mRNA sequence
          Length = 1564

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 193/242 (79%)
 Strand = Plus / Plus

                                                                       
Query: 40  gaggacagggtgtgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcg 99
           |||||||||||||| || || |||||||| ||||| || || ||||||||||| ||||| 
Sbjct: 616 gaggacagggtgtgtgggacaatcgacattgagaaagctcttaccgagggtgtgaaggca 675

                                                                       
Query: 100 tttgagccaggcctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaac 159
           || ||||| || || ||||| || || ||||| || ||||| ||||| |||||||| || 
Sbjct: 676 ttcgagcctggtcttcttgctaaagctaacagaggaatactttatgtcgacgaggttaat 735

                                                                       
Query: 160 ctgctcgacgaccatctggtggatgttctgctggattctgccgcgtccgggtggaacacg 219
           ||  | ||||||||| | || ||||||||  |||||||||| || || || |||||||| 
Sbjct: 736 cttttggacgaccatttagtagatgttcttttggattctgcagcatcaggatggaacact 795

                                                                       
Query: 220 gtggagagggagggcatctccatctcccaccctgcgcgcttcatcctcattggctccggt 279
           || || || ||||| || || || || |||||||| || || ||||| ||||| || |||
Sbjct: 796 gttgaaagagagggaatatcaatttcacaccctgctcgatttatccttattggttcaggt 855

             
Query: 280 aa 281
           ||
Sbjct: 856 aa 857



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                        
Query: 505  catgatctccgggttaagatatcccaggtgtgttccgagctgaatgtggatggactcaga 564
            ||||||||||| ||||| || ||  |||| ||| | || |||||||| |||||| | |||
Sbjct: 1081 catgatctccgcgttaaaatctctaaggtctgtgcagaactgaatgtcgatggattgaga 1140

                                
Query: 565  ggagacattgtcactaacag 584
            || || || |||||||||||
Sbjct: 1141 ggtgatatagtcactaacag 1160



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                           
Query: 118     gccaaggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctg 177
               |||||||||||| | ||||| || || ||||||||||| ||||| || |||||||| |||
Sbjct: 1947863 gccaaggccaaccgcggcatcctctacgtggacgaggtcaacctcctggacgaccacctg 1947922

                                                                    
Query: 178     gtggatgttctgctggattctgccgcgtccgggtggaacacggtggagaggga 230
               ||||||||  |||||||| | || || || || ||||||||||||||| ||||
Sbjct: 1947923 gtggatgtcttgctggatgcggcggcctctggctggaacacggtggagcggga 1947975



to top

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                          
Query: 100    tttgagccaggcctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaac 159
              ||||| ||||||||  | |||||||||||| | ||| | || || ||||| |||||||||
Sbjct: 722238 tttgaaccaggcctcttggccaaggccaaccgcggcttgctctacgtggatgaggtgaac 722179

                                                                          
Query: 160    ctgctcgacgaccatctggtggatgttctgctggattctgccgcgtccgggtggaacacg 219
              || |||||||| || || ||||||||  |||||||||| ||||| || || |||||||| 
Sbjct: 722178 ctcctcgacgatcaccttgtggatgtgttgctggattccgccgcatcgggctggaacacc 722119

                    
Query: 220    gtggag 225
              ||||||
Sbjct: 722118 gtggag 722113



to top

>gb|AF014053.1|AF014053 Nicotiana tabacum Mg protoporphyrin chelatase subunit (Chl I) mRNA,
           complete cds
          Length = 1572

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 40  gaggacagggtgtgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcg 99
           |||||||||||||| ||||| |||||||| ||||| || || || |||||||| ||||| 
Sbjct: 616 gaggacagggtgtgtggcacaatcgacattgagaaagctcttactgagggtgtgaaggct 675

                                                                       
Query: 100 tttgagccaggcctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaac 159
           || ||||| || || ||||| || || ||||| || ||||| || || || ||||| || 
Sbjct: 676 ttcgagcctggtcttcttgctaaagctaacagaggaatactttacgtcgatgaggttaat 735

                                                                       
Query: 160 ctgctcgacgaccatctggtggatgttctgctggattctgccgcgtccgggtggaacacg 219
           ||  | ||||||||| | || ||||||||  |||||||||| || || || |||||||| 
Sbjct: 736 cttttggacgaccatttagtagatgttcttttggattctgcagcatcgggatggaacact 795

                                                                       
Query: 220 gtggagagggagggcatctccatctcccaccctgcgcgcttcatcctcattggctccggt 279
           || || || ||||| || || || || |||||||| || || ||||| ||||| || |||
Sbjct: 796 gttgaaagagaggggatatcaatatcacaccctgcccggtttatccttattggttcgggt 855

             
Query: 280 aa 281
           ||
Sbjct: 856 aa 857



to top

>gb|AE006470.1| Chlorobium tepidum TLS, complete genome
          Length = 2154946

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                           
Query: 52      tgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcgtttgagccaggc 111
               |||||||||||||||||||| |||||||| |||   || |||||||| |||||||| || 
Sbjct: 1218629 tgcggcaccatcgacatcgaaaaggcgcttaccagcggcgtcaaggcttttgagcctggt 1218570

                                                                           
Query: 112     ctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgac 171
               ||||||||| || ||||| | ||  | || ||| | |||||||| ||||| ||||| |||
Sbjct: 1218569 ctgcttgcccagtccaaccgcggtttcctctatatcgacgaggtcaaccttctcgatgac 1218510

                       
Query: 172     catctggt 179
               || |||||
Sbjct: 1218509 cacctggt 1218502



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                          
Query: 104    agccaggcctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaacctgc 163
              |||| |||||||| ||||| ||| ||| ||| || |||||||| || || ||||||||||
Sbjct: 437261 agccgggcctgctcgccaaagcccacaaggggattctgtatgtcgatgaagtgaacctgc 437320

                              
Query: 164    tcgacgaccatctggt 179
              | || |||||||||||
Sbjct: 437321 ttgatgaccatctggt 437336



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                          
Query: 131    ggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctgc 190
              ||||||| |||||||| || |||||||||||||| || |||||  |||| ||||| ||||
Sbjct: 439339 ggggcattctgtatgtcgatgaggtgaacctgcttgatgaccacgtggttgatgtgctgc 439398

               
Query: 191    t 191
              |
Sbjct: 439399 t 439399



to top

>gb|AY005135.1| Chlorobium tepidum Ybc5 (ybc5) gene, partial cds; Dld2 (dld2), BchI
            (chlI), BchD (bchD), and BchH3 (bchH3) genes, complete
            cds; and unknown gene
          Length = 10543

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                        
Query: 52   tgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcgtttgagccaggc 111
            |||||||||||||||||||| |||||||| |||   || |||||||| |||||||| || 
Sbjct: 2454 tgcggcaccatcgacatcgaaaaggcgcttaccagcggcgtcaaggcttttgagcctggt 2513

                                                                        
Query: 112  ctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgac 171
            ||||||||| || ||||| | ||  | || ||| | |||||||| ||||| ||||| |||
Sbjct: 2514 ctgcttgcccagtccaaccgcggtttcctctatatcgacgaggtcaaccttctcgatgac 2573

                    
Query: 172  catctggt 179
            || |||||
Sbjct: 2574 cacctggt 2581



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 215/275 (78%)
 Strand = Plus / Plus

                                                                          
Query: 52     tgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcgtttgagccaggc 111
              ||||| ||||||||||||||  |||||||||||   || |||||||| || ||||| || 
Sbjct: 900617 tgcggtaccatcgacatcgaacaggcgctcaccagcggcgtcaaggccttcgagccgggt 900676

                                                                          
Query: 112    ctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgac 171
              ||||| ||| |||||||| | ||| | || ||  | |||||||| ||||| |||||||||
Sbjct: 900677 ctgctcgcccaggccaaccgcggcttcctttacatcgacgaggtcaacctcctcgacgac 900736

                                                                          
Query: 172    catctggtggatgttctgctggattctgccgcgtccgggtggaacacggtggagagggag 231
              || || || || || ||||| |||   |||||   |||   ||||  ||| ||| | |||
Sbjct: 900737 caccttgtcgacgtgctgcttgatgtggccgccagcggcaagaacgtggtcgagcgcgag 900796

                                                                          
Query: 232    ggcatctccatctcccaccctgcgcgcttcatcctcattggctccggtaacccggaggaa 291
              ||||||  ||||  |||||| || |||||| | ||| | || ||||| ||||| ||||||
Sbjct: 900797 ggcatcagcatccgccacccggcccgcttcgtgctcgtcggttccggcaaccccgaggaa 900856

                                                 
Query: 292    ggcgagctccggccgcagctgctggaccggttcgg 326
              ||||||||||| |||||||| || ||||| |||||
Sbjct: 900857 ggcgagctccgcccgcagctcctcgaccgtttcgg 900891



to top

>gb|U67064.1|NTU67064 Nicotiana tabacum sulfur gene (Su-s) mRNA, complete cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 40  gaggacagggtgtgcggcaccatcgacatcgagaaggcgctcaccgagggtgtcaaggcg 99
           |||||||||||||| ||||| |||||||| ||||| || || || |||||||| ||||| 
Sbjct: 582 gaggacagggtgtgtggcacaatcgacattgagaaagctcttactgagggtgtgaaggct 641

                                                                       
Query: 100 tttgagccaggcctgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaac 159
           || ||||| || || ||||| || || ||||| || ||||| ||||| || ||||| || 
Sbjct: 642 ttcgagcctggtcttcttgctaaagctaacagaggaatactttatgtcgatgaggttaat 701

                                                                      
Query: 160 ctgctcgacgaccatctggtggatgttctgctggattctgccgcgtccgggtggaacac 218
           ||  | || |||||| | || ||||||||  |||||||||| || || || ||||||||
Sbjct: 702 cttttggatgaccatttagtagatgttcttttggattctgcagcatcgggatggaacac 760



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                           
Query: 128     acaggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttc 187
               |||||||||| ||||||||||||||| | ||||| ||||||||||| || || ||||| |
Sbjct: 1046095 acaggggcatcctgtatgtggacgagattaaccttctcgacgaccaccttgtagatgtac 1046154

                            
Query: 188     tgctggattctgc 200
               | ||||| |||||
Sbjct: 1046155 tcctggactctgc 1046167



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271     ggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
               ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 1998024 ggctcgggcaaccccgaggaaggcgagctgcgcccgcagcttctggaccggttcgg 1998079



to top

>emb|BX927153.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete
              genome; segment 6/10
          Length = 349584

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                          
Query: 283    ccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
              ||||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 334414 ccggaggaaggcgagctgcgcccgcagctgctggaccgtttcgg 334371



to top

>emb|AJ010302.1|RSP010302 Rhodobacter sphaeroides photosynthetic gene cluster
          Length = 40707

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 271   ggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
             ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 23125 ggctcgggcaaccccgaggaaggcgagctgcgcccgcagcttctggaccggttcgg 23070



to top

>gb|AF195122.1| Rhodobacter sphaeroides photosynthetic gene cluster, partial sequence
          Length = 66280

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 271   ggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
             ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 48231 ggctcgggcaaccccgaggaaggcgagctgcgcccgcagcttctggaccggttcgg 48176



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                               
Query: 280     aacccggaggaaggcgagctccggccgcagctgctggaccggttcggg 327
               ||||||||||| |||||||| || ||||||||||| ||||||||||||
Sbjct: 2681139 aacccggaggagggcgagctgcgtccgcagctgctcgaccggttcggg 2681092



to top

>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome
          Length = 3309401

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                           
Query: 283     ccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
               ||||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 2109805 ccggaggaaggcgagctgcgcccgcagctgctggaccgtttcgg 2109762



to top

>gb|AF017642.1|AF017642 Rhodobacter sphaeroides magnesium chelatase subunits BchI (bchI)
           and BchD (bchD) genes, complete cds; and BchO (bchO)
           gene, partial cds
          Length = 3154

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 271 ggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
           ||||| || ||||| |||||||||||||| || |||||||| ||||||||||||||
Sbjct: 526 ggctcgggcaaccccgaggaaggcgagctgcgcccgcagcttctggaccggttcgg 581



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Minus

                                                                           
Query: 148     gacgaggtgaacctgctcgacgaccatctggtggatgttctgctggattctgccgcgtcc 207
               ||||| || |||||||||||||| ||| |||| ||||| |||||||| || || || || 
Sbjct: 1056306 gacgaagtcaacctgctcgacgatcatttggtagatgtgctgctggactcggcggcttct 1056247

                                                                           
Query: 208     gggtggaacacggtggagagggagggcatctccatctcccaccctgcgcgcttcatcctc 267
               || ||||| ||||||||  |||| ||| | || ||   ||||||||| |||||| || | 
Sbjct: 1056246 ggttggaatacggtggaacgggaaggcgtatcgattcgccaccctgctcgcttcgtcttg 1056187

                                                              
Query: 268     attggctccggtaacccggaggaaggcgagctccggccgcagctgct 314
                |||| ||||||||||| |||||||| || || ||||| ||| ||||
Sbjct: 1056186 gttggttccggtaaccccgaggaaggtgaactgcggcctcagttgct 1056140



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 280     aacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
               ||||||||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 4235316 aacccggaggagggcgagctgcgtccgcagctgctggaccgtttcgg 4235270



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                          
Query: 148    gacgaggtgaacctgctcgacgaccatctggtggatgttctgctggattctgccgcgtcc 207
              ||||| || |||||||||||||| ||| |||| ||||| |||||||| || || || || 
Sbjct: 564573 gacgaagtcaacctgctcgacgatcatttggtagatgtgctgctggactcggcggcttct 564632

                                                                          
Query: 208    gggtggaacacggtggagagggagggcatctccatctcccaccctgcgcgcttcatcctc 267
              || ||||| ||||||||  |||| ||| | || ||   ||||||||| |||||| || | 
Sbjct: 564633 ggttggaatacggtggaacgggaaggcgtatcgattcgccaccctgctcgcttcgtcttg 564692

                                                             
Query: 268    attggctccggtaacccggaggaaggcgagctccggccgcagctgct 314
               |||| ||||||||||| |||||||| || || ||||| ||| ||||
Sbjct: 564693 gttggttccggtaaccccgaggaaggtgaactgcggcctcagttgct 564739



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                     
Query: 145     gtggacgaggtgaacctgctcgacgaccatctggtgga 182
               |||||||||||||| ||||||||||||||||| |||||
Sbjct: 2674329 gtggacgaggtgaatctgctcgacgaccatctcgtgga 2674292



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                            
Query: 283     ccggaggaaggcgagctccggccgcagctgctggaccggttcggg 327
               |||||||| ||||| || || ||||||||||||||||||||||||
Sbjct: 3153810 ccggaggagggcgaactgcgtccgcagctgctggaccggttcggg 3153766



to top

>emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 10/14
          Length = 307550

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                           
Query: 283    ccggaggaaggcgagctccggccgcagctgctggaccggttcggg 327
              |||||||| ||||| || || ||||||||||||||||||||||||
Sbjct: 298614 ccggaggagggcgaactgcgtccgcagctgctggaccggttcggg 298570



to top

>emb|BX842581.1| Mycobacterium tuberculosis H37Rv complete genome; segment 10/13
          Length = 348676

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 283   ccggaggaaggcgagctccggccgcagctgctggaccggttcggg 327
             |||||||| ||||| || || ||||||||||||||||||||||||
Sbjct: 40561 ccggaggagggcgaactgcgtccgcagctgctggaccggttcggg 40517



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 136/169 (80%), Gaps = 2/169 (1%)
 Strand = Plus / Minus

                                                                           
Query: 12      catggtcgacctgcccctcggcgccaccgaggacagggt-gtgcggcaccatcgacatcg 70
               ||||||||| |||||| |||||||| |||||||| || | ||| ||| |  |||||||||
Sbjct: 7690507 catggtcgaactgcccgtcggcgcctccgaggaccggctcgtg-ggcgcgctcgacatcg 7690449

                                                                           
Query: 71      agaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaaca 130
               ||  ||||||| | |||||||| ||||| || ||||| |||||||| ||| | ||  || 
Sbjct: 7690448 agcgggcgctcgcggagggtgtgaaggccttcgagcccggcctgctggccgacgcgcacc 7690389

                                                                
Query: 131     ggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggt 179
               | || || ||||| || |||||||| ||||| ||| ||||||| |||||
Sbjct: 7690388 gcgggatcctgtacgtcgacgaggtcaacctcctccacgaccacctggt 7690340



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 292     ggcgagctccggccgcagctgctggaccggttcggg 327
               |||||||| ||||||||| |||| ||||||||||||
Sbjct: 7690227 ggcgagctgcggccgcagttgctcgaccggttcggg 7690192



to top

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 148  gacgaggtgaacctgctcgacgaccatctggtggatgttctgct 191
            ||||||||||||||||| | ||||||||||||||| || |||||
Sbjct: 3762 gacgaggtgaacctgctggccgaccatctggtggacgtgctgct 3719



to top

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                          
Query: 280    aacccggaggaaggcgagctccggccgcagctgctggaccggtt 323
              |||||||||||||| ||||| ||||| |||||| ||||||||||
Sbjct: 351478 aacccggaggaaggggagctacggccccagctgttggaccggtt 351435



to top

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                          
Query: 10     accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
              |||||||| ||  ||||||| || || || || ||| |||||||||||||||||||||||
Sbjct: 658580 accatggtggatttgcccctgggggcaacggaagaccgggtgtgcggcaccatcgacatc 658639

                      
Query: 70     gagaaggc 77
              || |||||
Sbjct: 658640 gaaaaggc 658647



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                           
Query: 118    gccaaggccaacaggggcatactgtatgtggacgaggtgaacctg 162
              ||||| |||||| ||||||| || ||||||||||| || ||||||
Sbjct: 658688 gccaaagccaaccggggcattctctatgtggacgaagttaacctg 658732



to top

>gb|U35144.1|SSU35144 Synechocystis sp. Mg-protoporhyrin IX (chlI) gene, complete cds
          Length = 2304

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 10  accatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatc 69
           |||||||| ||  ||||||| || || || || ||| |||||||||||||||||||||||
Sbjct: 680 accatggtggatttgcccctgggggcaacggaagaccgggtgtgcggcaccatcgacatc 739

                   
Query: 70  gagaaggc 77
           || |||||
Sbjct: 740 gaaaaggc 747



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 118 gccaaggccaacaggggcatactgtatgtggacgaggtgaacctg 162
           ||||| |||||| ||||||| || ||||||||||| || ||||||
Sbjct: 788 gccaaagccaaccggggcattctctatgtggacgaagttaacctg 832



to top

>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29
          Length = 283100

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                          
Query: 13     atggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcgag 72
              |||||||| |||||| |||| ||| |||||||| || ||   ||| || |||||||||||
Sbjct: 163327 atggtcgagctgcccgtcggggcctccgaggaccggctggtgggcgccctcgacatcgag 163386

                                                                          
Query: 73     aaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaacagg 132
                ||||||  | ||||| || ||||| || ||||| |||||||| ||| | ||  || | 
Sbjct: 163387 cgggcgctggcggagggcgtgaaggccttcgagcccggcctgctggccgacgcgcaccgc 163446

                                                             
Query: 133    ggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggt 179
              || || ||||| || |||||||| ||||||||| ||||||| |||||
Sbjct: 163447 ggaatcctgtacgtcgacgaggtcaacctgctccacgaccacctggt 163493



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 292    ggcgagctccggccgcagctgctggaccggttcgg 326
              |||||||| ||||||||| |||| |||||||||||
Sbjct: 163606 ggcgagctgcggccgcagttgctcgaccggttcgg 163640



to top

>emb|Z83933.1|CVZ83933 Chlorobium vibrioforme 15 kb genomic DNA fragment
          Length = 14648

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 246  ccaccctgcgcgcttcatcctcattggctccggtaacccggaggaaggcgagctccggcc 305
            ||||||||| |||||| | ||  |||| || ||||||||||| || || ||||| || ||
Sbjct: 4658 ccaccctgcccgcttcgtgctggttggttcaggtaacccggaagagggtgagcttcgtcc 4717

                                          
Query: 306  gcagctgctggaccggttcgggatgcacgc 335
            ||||||||| ||||| |||||  |||||||
Sbjct: 4718 gcagctgctcgaccgtttcggtctgcacgc 4747



to top

>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 122/154 (79%)
 Strand = Plus / Minus

                                                                           
Query: 11      ccatggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcg 70
               ||||||| || |||||||| || ||||| || ||  ||||||||||||| || ||||| |
Sbjct: 1580765 ccatggtggatctgcccctgggagccacagaagatcgggtgtgcggcacgattgacattg 1580706

                                                                           
Query: 71      agaaggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaaca 130
               | || || ||  | ||||| || || || |||||||| || ||| | |||||||| ||  
Sbjct: 1580705 aaaaagcccttgctgagggggtgaaagcctttgagccgggactgttggccaaggcaaatc 1580646

                                                 
Query: 131     ggggcatactgtatgtggacgaggtgaacctgct 164
               | ||||| || |||||||| ||||||||||||||
Sbjct: 1580645 gcggcattctctatgtggatgaggtgaacctgct 1580612



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                           
Query: 526     tcccaggtgtgttccgagctgaatgtggatggactcagaggagacattgtcactaacagg 585
               ||||| |||||| | |||||| ||||||| || ||  | |||||||||||||||||| | 
Sbjct: 1580250 tcccaagtgtgtgctgagctggatgtggacggcctgcggggagacattgtcactaaccgc 1580191

                                
Query: 586     gctgccaaggcgttggc 602
               || |||||||| |||||
Sbjct: 1580190 gcggccaaggccttggc 1580174



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 133     ggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctgctg 192
               ||||| |||||| | ||||| ||||||||||| | |||||| |||||||| || ||||||
Sbjct: 1684550 ggcatgctgtatatcgacgaagtgaacctgctggccgaccacctggtggacgtgctgctg 1684491

                 
Query: 193     ga 194
               ||
Sbjct: 1684490 ga 1684489



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 139    ctgtatgtggacgaggtgaacctgctcgacgaccatctggt 179
              |||||| | ||||| |||||||||||||| |||||||||||
Sbjct: 569473 ctgtatatcgacgaagtgaacctgctcgaagaccatctggt 569513



to top

>emb|Z11165.1|RCPHSYNG R.capsulatus complete photosynthesis gene cluster
          Length = 45959

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 271   ggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
             ||||| || |||||||| || ||||| || ||||||||||| |||||||| |||||
Sbjct: 26340 ggctcgggcaacccggaagagggcgacctgcggccgcagcttctggaccgtttcgg 26285



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                               
Query: 14      tggtcgacctgcccctcggcgccaccgaggac 45
               ||||||| ||||| ||||||||||||||||||
Sbjct: 1365952 tggtcgatctgccgctcggcgccaccgaggac 1365983



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 565    ggagacattgtcactaacagggctgccaaggc 596
              |||||||||||||| ||| |||||||||||||
Sbjct: 122707 ggagacattgtcaccaaccgggctgccaaggc 122738



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 14      tggtcgacctgcccctcggcgccaccgaggac 45
               ||||||| ||||| ||||||||||||||||||
Sbjct: 4585388 tggtcgatctgccgctcggcgccaccgaggac 4585357



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                   
Query: 275     ccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
               |||| |||||||| || |||||||| || |||||  |||| |||||||||||
Sbjct: 4585127 ccggcaacccggaagagggcgagctgcgtccgcaattgctcgaccggttcgg 4585076



to top

>emb|X52291.1|RCCRTAK Rhodobacter capsulatus clustered genes crtA-F, I and K involved in
           carotenoid biosynthesis
          Length = 10068

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 271 ggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
           ||||| || |||||||| || ||||| || ||||||||||| |||||||| |||||
Sbjct: 481 ggctcgggcaacccggaagagggcgacctgcggccgcagcttctggaccgtttcgg 426



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 304     ccgcagctgctggaccggttcggg 327
               ||||||||||||||||||||||||
Sbjct: 3252717 ccgcagctgctggaccggttcggg 3252694



to top

>ref|NM_123961.2| Arabidopsis thaliana CHLI2; magnesium chelatase AT5G45930 (CHLI2)
           mRNA, complete cds
          Length = 1460

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                       
Query: 262 atcctcattggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccgg 321
           ||||||||||| || || || || || ||||| |||||  | || ||||| || ||| ||
Sbjct: 857 atcctcattggttcaggaaatcctgaagaaggagagcttagaccacagcttcttgacagg 916

                                                                      
Query: 322 ttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagggtgaagattgt 380
           || || ||||||||||| || || || || || |||||||||||||| || ||||||||
Sbjct: 917 tttggtatgcacgcgcaagtagggacggttagagacgccgagctgagagttaagattgt 975



to top

>ref|NM_123962.2| Arabidopsis thaliana hydrolase AT5G45940 mRNA, complete cds
          Length = 1342

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                        
Query: 262  atcctcattggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccgg 321
            ||||||||||| || || || || || ||||| |||||  | || ||||| || ||| ||
Sbjct: 1317 atcctcattggttcaggaaatcctgaagaaggagagcttagaccacagcttcttgacagg 1258

                                                                       
Query: 322  ttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagggtgaagattgt 380
            || || ||||||||||| || || || || || |||||||||||||| || ||||||||
Sbjct: 1257 tttggtatgcacgcgcaagtagggacggttagagacgccgagctgagagttaagattgt 1199



to top

>gb|BT015783.1| Arabidopsis thaliana At5g45930 mRNA, complete cds
          Length = 1257

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                       
Query: 262 atcctcattggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccgg 321
           ||||||||||| || || || || || ||||| |||||  | || ||||| || ||| ||
Sbjct: 769 atcctcattggttcaggaaatcctgaagaaggagagcttagaccacagcttcttgacagg 828

                                                                      
Query: 322 ttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagggtgaagattgt 380
           || || ||||||||||| || || || || || |||||||||||||| || ||||||||
Sbjct: 829 tttggtatgcacgcgcaagtagggacggttagagacgccgagctgagagttaagattgt 887



to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                           
Query: 113     tgcttgccaaggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgacc 172
               |||| ||||||||| || | ||| | |||||||| || ||||| |||||||| | |||||
Sbjct: 3608240 tgctggccaaggccgacggtggcgtgctgtatgtcgatgaggtcaacctgcttgccgacc 3608181

                      
Query: 173     atctggt 179
               |||||||
Sbjct: 3608180 atctggt 3608174



to top

>gb|AY140022.1| Arabidopsis thaliana magnesium chelatase subunit of
           protochlorophyllide reductase (At5g45930) mRNA, complete
           cds
          Length = 1424

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                       
Query: 262 atcctcattggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccgg 321
           ||||||||||| || || || || || ||||| |||||  | || ||||| || ||| ||
Sbjct: 857 atcctcattggttcaggaaatcctgaagaaggagagcttagaccacagcttcttgacagg 916

                                                                      
Query: 322 ttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagggtgaagattgt 380
           || || ||||||||||| || || || || || |||||||||||||| || ||||||||
Sbjct: 917 tttggtatgcacgcgcaagtagggacggttagagacgccgagctgagagttaagattgt 975



to top

>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete
             Sequence, complete sequence
          Length = 171061

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 365   tgagggtgaagattgtggaggagaggg 391
             |||||| ||||||||||||||||||||
Sbjct: 70576 tgagggggaagattgtggaggagaggg 70602



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 365   tgagggtgaagattgtggaggagag 389
             |||||| ||||||||||||||||||
Sbjct: 70702 tgagggggaagattgtggaggagag 70726



to top

>emb|BX831184.1|CNS09ZFF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS66ZF02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1367

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                       
Query: 262 atcctcattggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccgg 321
           ||||||||||| || || || || || ||||| |||||  | || ||||| || ||| ||
Sbjct: 842 atcctcattggttcaggaaatcctgaagaaggagagcttagaccacagcttcttgacagg 901

                                                                      
Query: 322 ttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagggtgaagattgt 380
           || || ||||||||||| || || || || || |||||||||||||| || ||||||||
Sbjct: 902 tttggtatgcacgcgcaagtagggacggttagagacgccgagctgagagttaagattgt 960



to top

>dbj|AB016870.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K15I22
          Length = 59648

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 95/119 (79%)
 Strand = Plus / Plus

                                                                         
Query: 262   atcctcattggctccggtaacccggaggaaggcgagctccggccgcagctgctggaccgg 321
             ||||||||||| || || || || || ||||| |||||  | || ||||| || ||| ||
Sbjct: 46401 atcctcattggttcaggaaatcctgaagaaggagagcttagaccacagcttcttgacagg 46460

                                                                        
Query: 322   ttcgggatgcacgcgcaggttggcaccgtcagggacgccgagctgagggtgaagattgt 380
             || || ||||||||||| || || || || || |||||||||||||| || ||||||||
Sbjct: 46461 tttggtatgcacgcgcaagtagggacggttagagacgccgagctgagagttaagattgt 46519



to top

>dbj|AB017350.1| Acidiphilium rubrum bchP, bchI, bchD, crtI genes and 2 ORFs, partial
            and complete cds
          Length = 4965

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 280  aacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
            ||||| ||||| |||||| | ||||||||| |||| |||||||||||
Sbjct: 1211 aaccccgaggagggcgagttgcggccgcagttgctcgaccggttcgg 1257



to top

>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence
          Length = 179251

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 229   gagggcatctccatctcccacc 250
             ||||||||||||||||||||||
Sbjct: 32541 gagggcatctccatctcccacc 32520



to top

>gb|AC007269.3| Homo sapiens PAC clone RP5-1058P19 from 7, complete sequence
          Length = 93011

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 229   gagggcatctccatctcccacc 250
             ||||||||||||||||||||||
Sbjct: 86045 gagggcatctccatctcccacc 86066



to top

>gb|AF080002.1|AF080002 Heliobacillus mobilis exopolyphosphatase Ppx (ppx) gene, partial cds;
             cobyric acid synthase CobQ (cobQ), UDP-N-acetylmuramyl
             tripeptide synthetase MurC (murC), glutamyl tRNA reductase
             HemA (hemA), photosynthesis gene cluster, complete
             sequence, stage II sporulation protein E Sp2E (sp2E), cell
             cycle protein MesJ (mesJ), and ATP-dependent zinc
             metallopeptidase FtsH (ftsH) genes, complete cds; and
             nucleoside diphosphate kinase B NdkB (ndkB) gene, partial
             cds
          Length = 35618

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 139/178 (78%)
 Strand = Plus / Plus

                                                                         
Query: 14    tggtcgacctgcccctcggcgccaccgaggacagggtgtgcggcaccatcgacatcgaga 73
             |||||||||| ||||| || || || || ||| |||| || || |||||||||||| | |
Sbjct: 20326 tggtcgaccttcccctaggggcgacggaagaccgggtttgtggtaccatcgacatccaaa 20385

                                                                         
Query: 74    aggcgctcaccgagggtgtcaaggcgtttgagccaggcctgcttgccaaggccaacaggg 133
             ||||  |  |||| || ||||| || |||||||||||| |||| ||| |||| ||| | |
Sbjct: 20386 aggccttggccgaaggggtcaaagcctttgagccaggcttgctagcccaggcaaaccgtg 20445

                                                                       
Query: 134   gcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggatgttctgct 191
             |  |  ||||||||||||| || ||| | ||||| ||||| || || ||||| |||||
Sbjct: 20446 ggtttttgtatgtggacgaagtcaacttactcgatgaccacctcgtcgatgtgctgct 20503



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 274   tccggtaacccggaggaaggcgagctccggccgcag 309
             |||||||||||||| |||||||| || || ||||||
Sbjct: 20586 tccggtaacccggaagaaggcgaactgcgtccgcag 20621



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                          
Query: 124    gccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtggat 183
              |||||| | ||||| || ||||| |||||||| ||||| ||||| ||||| || || || 
Sbjct: 537752 gccaaccgcggcatcctctatgtcgacgaggtcaaccttctcgatgaccacctcgtcgac 537811

                                        
Query: 184    gttctgctggattctgccgcgtccgg 209
              || ||||| ||| | |||||||||||
Sbjct: 537812 gtactgctcgatgcggccgcgtccgg 537837



to top

>gb|AF027390.1|AF027390 Homo sapiens 7q telomere, complete sequence
          Length = 225432

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 229   gagggcatctccatctcccacc 250
             ||||||||||||||||||||||
Sbjct: 18110 gagggcatctccatctcccacc 18131



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 61     atcgacatcgagaaggcgctcaccgaggg 89
              ||||||||||| ||||||||| |||||||
Sbjct: 368763 atcgacatcgacaaggcgctcgccgaggg 368735



to top

>gb|DQ468113.1| Arthrospira platensis magnesium chelatas ChlI subunit gene, partial
           cds
          Length = 1002

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 548 atgtggatggactcagaggagacattgtcactaacagggctgccaaggc 596
           |||| ||||||||  | ||||| ||||||||||||||||| || |||||
Sbjct: 779 atgtagatggactgcggggagatattgtcactaacagggcggcgaaggc 827



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 259     ttcatcctcattggctccggt 279
               |||||||||||||||||||||
Sbjct: 1984865 ttcatcctcattggctccggt 1984845



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 14      tggtcgacctgcccctcggcgccaccgaggacagggt 50
               ||||||| ||||| |||||||||||||| ||| ||||
Sbjct: 4209833 tggtcgatctgccgctcggcgccaccgaagaccgggt 4209797



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                   
Query: 275     ccggtaacccggaggaaggcgagctccggccgcagctgctggaccggttcgg 326
               |||| ||||| || ||||||||||| || |||||  |||| |||||||||||
Sbjct: 4209572 ccggcaaccccgaagaaggcgagctgcgtccgcaattgctcgaccggttcgg 4209521



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 280     aacccggaggaaggcgagctccggccgcagctgctggaccg 320
               ||||||||||| ||||| || || ||||| |||||||||||
Sbjct: 4221961 aacccggaggagggcgaactgcgtccgcaactgctggaccg 4221921



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 259     ttcatcctcattggctccggt 279
               |||||||||||||||||||||
Sbjct: 3153582 ttcatcctcattggctccggt 3153602



to top

>gb|AE011805.1| Xanthomonas axonopodis pv. citri str. 306,  section 183 of 469 of the
            complete genome
          Length = 10303

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 259  ttcatcctcattggctccggt 279
            |||||||||||||||||||||
Sbjct: 1562 ttcatcctcattggctccggt 1542



to top

>gb|AE012526.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 434
            of 460 of the complete genome
          Length = 10116

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 157  aacctgctcgacgaccatctg 177
            |||||||||||||||||||||
Sbjct: 1748 aacctgctcgacgaccatctg 1768



to top

>gb|AE012272.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 180
            of 460 of the complete genome
          Length = 10773

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 259  ttcatcctcattggctccggt 279
            |||||||||||||||||||||
Sbjct: 6571 ttcatcctcattggctccggt 6551



to top

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 446    ataagctccaggagcagatca 466
              |||||||||||||||||||||
Sbjct: 382589 ataagctccaggagcagatca 382569



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 157     aacctgctcgacgaccatctg 177
               |||||||||||||||||||||
Sbjct: 4870108 aacctgctcgacgaccatctg 4870128



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 259     ttcatcctcattggctccggt 279
               |||||||||||||||||||||
Sbjct: 3052783 ttcatcctcattggctccggt 3052803



to top

>ref|NM_209271.1| Eremothecium gossypii ADL178Wp (ADL178W), mRNA
          Length = 789

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 446 ataagctccaggagcagatca 466
           |||||||||||||||||||||
Sbjct: 44  ataagctccaggagcagatca 24



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 259     ttcatcctcattggctccggt 279
               |||||||||||||||||||||
Sbjct: 3160889 ttcatcctcattggctccggt 3160909



to top

>ref|NM_201215.1| Danio rerio zgc:56248 (zgc:56248), mRNA
          Length = 2022

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 366 gagggtgaagattgtggagg 385
           ||||||||||||||||||||
Sbjct: 203 gagggtgaagattgtggagg 222



to top

>ref|NM_025807.1| Mus musculus solute carrier family 16 (monocarboxylic acid
           transporters), member 9 (Slc16a9), mRNA
          Length = 3565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 agctccggccgcagctgctg 315
           ||||||||||||||||||||
Sbjct: 71  agctccggccgcagctgctg 52



to top

>gb|BC034205.1| Mus musculus solute carrier family 16 (monocarboxylic acid
           transporters), member 9, mRNA (cDNA clone
           IMAGE:4987055), containing frame-shift errors
          Length = 2750

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 agctccggccgcagctgctg 315
           ||||||||||||||||||||
Sbjct: 25  agctccggccgcagctgctg 6



to top

>gb|AC164303.2| Mus musculus BAC clone RP24-530J21 from chromosome 14, complete
             sequence
          Length = 164905

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 368   gggtgaagattgtggaggag 387
             ||||||||||||||||||||
Sbjct: 96320 gggtgaagattgtggaggag 96301



to top

>gb|BC055839.1| Mus musculus solute carrier family 16 (monocarboxylic acid
           transporters), member 9, mRNA (cDNA clone MGC:67847
           IMAGE:4237811), complete cds
          Length = 2568

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 agctccggccgcagctgctg 315
           ||||||||||||||||||||
Sbjct: 28  agctccggccgcagctgctg 9



to top

>gb|BC046023.1| Danio rerio zgc:56248, mRNA (cDNA clone MGC:56248 IMAGE:5601671),
           complete cds
          Length = 2022

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 366 gagggtgaagattgtggagg 385
           ||||||||||||||||||||
Sbjct: 203 gagggtgaagattgtggagg 222



to top

>gb|AC121858.3| Mus musculus BAC clone RP24-104B23 from chromosome 8, complete sequence
          Length = 177226

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 533   tgtgttccgagctgaatgtg 552
             ||||||||||||||||||||
Sbjct: 62609 tgtgttccgagctgaatgtg 62590



to top

>gb|AC122923.4| Mus musculus BAC clone RP23-36G5 from 10, complete sequence
          Length = 242112

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 296    agctccggccgcagctgctg 315
              ||||||||||||||||||||
Sbjct: 139370 agctccggccgcagctgctg 139389



to top

>emb|CR391986.5| Zebrafish DNA sequence from clone CH211-195O20 in linkage group 17,
             complete sequence
          Length = 131805

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 366   gagggtgaagattgtggagg 385
             ||||||||||||||||||||
Sbjct: 78239 gagggtgaagattgtggagg 78258



to top

>emb|AL121772.19|HSJ965G21 Human DNA sequence from clone RP5-965G21 on chromosome 20 Contains the
             PYGB gene encoding the brain form of glycogen
             phosphorylase, the 3' end of the C20orf22 gene for
             chromosome 20 open reading frame 22 and a CpG island,
             complete sequence
          Length = 75499

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   ctgcttgccaaggccaacag 131
             ||||||||||||||||||||
Sbjct: 46816 ctgcttgccaaggccaacag 46797



to top

>emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete genome; segment 25/29
          Length = 296500

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 71     agaaggcgctcaccgagggtgtca 94
              |||||||||||||| |||||||||
Sbjct: 189343 agaaggcgctcaccaagggtgtca 189366



to top

>emb|AL939123.1|SCO939123 Streptomyces coelicolor A3(2) complete genome; segment 20/29
          Length = 300100

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 139   ctgtatgtggacgaggtgaacctgctcgacgaccatctggtgga 182
             ||||| || |||||||| ||||| ||||||||||| || |||||
Sbjct: 61440 ctgtacgtcgacgaggtcaacctcctcgacgaccacctcgtgga 61483



to top

>ref|NM_078673.2| Drosophila melanogaster TBP-associated factor 8 CG7128-RA (Taf8),
           mRNA
          Length = 1341

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 64  gacatcgagaaggcgctcac 83
           ||||||||||||||||||||
Sbjct: 587 gacatcgagaaggcgctcac 606



to top

>gb|AY071604.1| Drosophila melanogaster RE65343 full length cDNA
          Length = 1355

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 64  gacatcgagaaggcgctcac 83
           ||||||||||||||||||||
Sbjct: 587 gacatcgagaaggcgctcac 606



to top

>gb|AC011614.8| Drosophila melanogaster, chromosome X, region 16F-17A, BAC clone
              BACR48L05, complete sequence
          Length = 177138

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     gacatcgagaaggcgctcac 83
              ||||||||||||||||||||
Sbjct: 135864 gacatcgagaaggcgctcac 135845



to top

>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome
          Length = 3544738

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 160    ctgctcgacgaccatctggtggat 183
              |||||||| |||||||||||||||
Sbjct: 306624 ctgctcgaagaccatctggtggat 306647



to top

>dbj|AK004684.2| Mus musculus adult male lung cDNA, RIKEN full-length enriched
           library, clone:1200010B04 product:hypothetical protein,
           full insert sequence
          Length = 2653

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 agctccggccgcagctgctg 315
           ||||||||||||||||||||
Sbjct: 128 agctccggccgcagctgctg 109



to top

>dbj|AK004599.1| Mus musculus adult male lung cDNA, RIKEN full-length enriched
           library, clone:1200004H04 product:hypothetical protein,
           full insert sequence
          Length = 2927

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 agctccggccgcagctgctg 315
           ||||||||||||||||||||
Sbjct: 249 agctccggccgcagctgctg 230



to top

>dbj|AK004556.1| Mus musculus adult male lung cDNA, RIKEN full-length enriched
           library, clone:1200003C15 product:hypothetical protein,
           full insert sequence
          Length = 3565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 agctccggccgcagctgctg 315
           ||||||||||||||||||||
Sbjct: 71  agctccggccgcagctgctg 52



to top

>gb|AF022186.2|AF022186 Cyanidium caldarium strain RK1 chloroplast, complete genome
          Length = 164921

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 553    gatggactcagaggagacattgtcactaacagggct 588
              ||||| ||||||||||| || ||||| |||||||||
Sbjct: 109971 gatggtctcagaggagatatagtcaccaacagggct 109936



to top

>gb|AF288461.1|AF288461 Chloroflexus aurantiacus BchI (bchI) and BchD (bchD) genes, complete
            cds; and unknown genes
          Length = 6085

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 14   tggtcgacctgcccctcggcgccaccga 41
            |||| |||||||||||||| ||||||||
Sbjct: 1055 tggtagacctgcccctcggtgccaccga 1082



to top

>gb|AE005068.1| Halobacterium sp. NRC-1 section 99 of 170 of the complete genome
          Length = 13635

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                         
Query: 123   ggccaacaggggcatactgtatgtggacgaggtgaacctgctcgacgaccatctggtgga 182
             ||||||| |||| || || || || ||||| |||||||| ||||||||||| || |||||
Sbjct: 13069 ggccaaccgggggatcctctacgtcgacgaagtgaacctcctcgacgaccacctcgtgga 13010



to top

>gb|AE003507.3| Drosophila melanogaster chromosome X, section 59 of 74 of the complete
              sequence
          Length = 299804

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     gacatcgagaaggcgctcac 83
              ||||||||||||||||||||
Sbjct: 249971 gacatcgagaaggcgctcac 249990



to top

>emb|AL590988.11| Mouse DNA sequence from clone RP23-46C18 on chromosome 8, complete
              sequence
          Length = 183975

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 533    tgtgttccgagctgaatgtg 552
              ||||||||||||||||||||
Sbjct: 172025 tgtgttccgagctgaatgtg 172006



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 42      ggacagggtgtgcggcacca 61
               ||||||||||||||||||||
Sbjct: 1218054 ggacagggtgtgcggcacca 1218035



to top

>emb|AL671893.7| Mouse DNA sequence from clone RP23-170G19 on chromosome X, complete
             sequence
          Length = 175057

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 361   gagctgagggtgaagattgtggag 384
             |||||||||||||||| |||||||
Sbjct: 16655 gagctgagggtgaagagtgtggag 16678



to top

>emb|Y15513.1|DMPRODOS Drosophila melanogaster prodos gene
          Length = 1863

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 64  gacatcgagaaggcgctcac 83
           ||||||||||||||||||||
Sbjct: 938 gacatcgagaaggcgctcac 957


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,106,019
Number of Sequences: 3902068
Number of extensions: 4106019
Number of successful extensions: 82721
Number of sequences better than 10.0: 113
Number of HSP's better than 10.0 without gapping: 113
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80429
Number of HSP's gapped (non-prelim): 2281
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top