ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags37c23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_506994.1| PREDICTED Oryza sativa (japonica cultivar-group... 593 e-166
2ref|XM_467983.2| Oryza sativa (japonica cultivar-group), mRNA 593 e-166
3ref|XM_467984.1| Oryza sativa (japonica cultivar-group), mRNA 593 e-166
4ref|XM_507534.1| PREDICTED Oryza sativa (japonica cultivar-group... 593 e-166
5ref|XM_506993.2| PREDICTED Oryza sativa (japonica cultivar-group... 593 e-166
6dbj|AK104659.1| Oryza sativa (japonica cultivar-group) cDNA clon... 593 e-166
7dbj|AK098996.1| Oryza sativa (japonica cultivar-group) cDNA clon... 593 e-166
8dbj|AK060304.1| Oryza sativa (japonica cultivar-group) cDNA clon... 593 e-166
9dbj|AK059725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 593 e-166
10dbj|AK099120.1| Oryza sativa (japonica cultivar-group) cDNA clon... 563 e-157
11gb|BT017874.1| Zea mays clone EL01N0513B08.c mRNA sequence 511 e-142
12dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 230 5e-57
13dbj|AP004125.3| Oryza sativa (japonica cultivar-group) genomic D... 230 5e-57
14gb|AY705803.1| Pinus halepensis clone 25r mRNA sequence 165 2e-37
15ref|NM_121002.2| Arabidopsis thaliana inorganic diphosphatase/ m... 129 1e-26
16gb|AY551439.1| Arabidopsis thaliana chloroplast inorganic pyroph... 129 1e-26
17gb|AY079355.1| Arabidopsis thaliana putative inorganic pyrophosp... 129 1e-26
18gb|AY045945.1| Arabidopsis thaliana putative inorganic pyrophosp... 129 1e-26
19gb|AY087275.1| Arabidopsis thaliana clone 33506 mRNA, complete s... 129 1e-26
20emb|AJ252210.1|ATH252210 Arabidopsis thaliana mRNA for inorganic... 129 1e-26
21gb|BT014393.1| Lycopersicon esculentum clone 133698R, mRNA sequence 115 2e-22
22gb|DQ122898.1| Chlamydomonas incerta chloroplast inorganic pyrop... 115 2e-22
23emb|AJ298231.1|CRE298231 Chlamydomonas reinhardtii partial mRNA ... 107 5e-20
24emb|BX830340.1|CNS0A1HN Arabidopsis thaliana Full-length cDNA Co... 105 2e-19
25gb|AY109365.1| Zea mays CL4861_1 mRNA sequence 96 2e-16
26dbj|AB020752.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 86 2e-13
27emb|AL353994.1|ATF17I14 Arabidopsis thaliana DNA chromosome 5, B... 86 2e-13
28ref|XM_960051.1| Neurospora crassa OR74A hypothetical protein (N... 62 2e-06
29ref|XM_325130.1| Neurospora crassa OR74A hypothetical protein (N... 62 2e-06
30emb|BX842629.1| Neurospora crassa DNA linkage group I BAC contig... 62 2e-06
31ref|XM_655480.1| Aspergillus nidulans FGSC A4 hypothetical prote... 58 4e-05
32ref|XM_363672.1| Magnaporthe grisea 70-15 hypothetical protein (... 54 6e-04
33dbj|AB010076.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
34ref|XM_757124.1| Ustilago maydis 521 hypothetical protein (UM060... 50 0.009
35ref|XM_380672.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 50 0.009
36dbj|AK110681.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.009
37gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.14
38ref|XM_571083.1| Cryptococcus neoformans var. neoformans JEC21 i... 46 0.14
39ref|XM_505378.1| Yarrowia lipolytica CLIB122, YALI0F13541g predi... 46 0.14
40gb|DQ437939.1| Cryptococcus neoformans var. neoformans strain 92... 46 0.14
41gb|DQ437938.1| Cryptococcus neoformans var. neoformans strain 92... 46 0.14
42gb|DQ437937.1| Cryptococcus neoformans var. neoformans strain MM... 46 0.14
43gb|DQ437936.1| Cryptococcus neoformans var. neoformans strain Y ... 46 0.14
44gb|DQ437935.1| Cryptococcus neoformans var. neoformans strain Y ... 46 0.14
45gb|DQ437934.1| Cryptococcus neoformans var. neoformans strain Y ... 46 0.14
46gb|DQ437933.1| Cryptococcus neoformans var. neoformans strain CA... 46 0.14
47gb|DQ437932.1| Cryptococcus neoformans var. neoformans strain B3... 46 0.14
48gb|DQ437931.1| Cryptococcus neoformans var. neoformans strain 11... 46 0.14
49gb|DQ437929.1| Cryptococcus neoformans var. neoformans strain J9... 46 0.14
50gb|DQ437928.1| Cryptococcus neoformans var. neoformans strain B3... 46 0.14
51dbj|AB226094.1| Aspergillus oryzae cDNA, contig sequence: AoEST2951 46 0.14
52dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 46 0.14
53ref|NM_079125.2| Drosophila melanogaster Nucleosome remodeling f... 46 0.14
54gb|AY075479.1| Drosophila melanogaster RE37074 full length cDNA 46 0.14
55gb|AC007574.6|AC007574 Drosophila melanogaster, chromosome 2R, r... 46 0.14
56emb|AL391749.4|CNS06C8I Human chromosome 14 DNA sequence BAC R-2... 46 0.14
57gb|AE003464.2| Drosophila melanogaster chromosome 2R, section 71... 46 0.14
58gb|AF085601.1|AF085601 Drosophila melanogaster inorganic pyropho... 46 0.14
59gb|AF085600.1|AF085600 Drosophila melanogaster inorganic pyropho... 46 0.14
60emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 46 0.14
61ref|XM_414212.1| PREDICTED: Gallus gallus similar to Sulfotransf... 44 0.57
62ref|NM_123986.3| Arabidopsis thaliana unknown protein AT5G46170 ... 42 2.2
63gb|AY431337.1| Aedes aegypti ASAP ID: 35937 inorganic pyrophosph... 42 2.2
64gb|DQ440278.1| Aedes aegypti clone AET-3565 inorganic pyrophosph... 42 2.2
65gb|AY142657.1| Arabidopsis thaliana unknown protein (At5g46170) ... 42 2.2
66gb|AY070105.1| Arabidopsis thaliana unknown protein (At5g46170) ... 42 2.2
67emb|CR938565.1| Single read from an extremity of a full-length c... 42 2.2
68gb|U55373.2| Caenorhabditis elegans cosmid F26F12, complete sequ... 42 2.2
69gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 2.2
70ref|NM_072122.3| Caenorhabditis elegans LEThal family member (le... 42 2.2
71gb|AF308445.1|AF308445 Caenorhabditis elegans LET-418 (let-418) ... 42 2.2
72dbj|AB006698.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 2.2
73ref|NM_210229.1| Eremothecium gossypii AER015Cp (AER015C), mRNA 42 2.2
74gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, com... 40 8.8
75gb|BT017827.1| Zea mays clone EL01N0508E10.c mRNA sequence 40 8.8
76gb|AC119670.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.8
77ref|XM_421589.1| PREDICTED: Gallus gallus similar to SAR1a prote... 40 8.8
78gb|AY568281.1| Halanaerobium congolense rhodanese (rdlA) gene, c... 40 8.8
79emb|Z68882.1|CEC47E12 Caenorhabditis elegans Cosmid C47E12, comp... 40 8.8
80gb|DQ437947.1| Cryptococcus neoformans var. grubii strain KNA-14... 40 8.8
81gb|DQ437946.1| Cryptococcus neoformans var. grubii strain DUMC 1... 40 8.8
82gb|DQ437945.1| Cryptococcus neoformans var. grubii strain 125.91... 40 8.8
83gb|DQ437944.1| Cryptococcus neoformans var. grubii strain H99 in... 40 8.8
84gb|DQ437943.1| Cryptococcus neoformans var. grubii strain 78.5.9... 40 8.8
85gb|DQ437942.1| Cryptococcus neoformans var. grubii strain 46F.5.... 40 8.8
86gb|DQ437941.1| Cryptococcus neoformans var. grubii strain 98 ino... 40 8.8
87gb|DQ437940.1| Cryptococcus neoformans var. grubii strain 55 ino... 40 8.8
88gb|DQ437930.1| Cryptococcus neoformans var. grubii strain 20021.... 40 8.8
89emb|AL662802.14| Mouse DNA sequence from clone RP23-34N10 on chr... 40 8.8
90emb|BX901978.14| Zebrafish DNA sequence from clone DKEY-155M6 in... 40 8.8
91emb|CR407274.1| Gallus gallus finished cDNA, clone ChEST356i23 40 8.8
92ref|NM_061649.2| Caenorhabditis elegans F45C12.10 (F45C12.10) mR... 40 8.8
93ref|NM_001027905.2| Caenorhabditis elegans inorganic PYroPhospha... 40 8.8
94ref|NM_001027903.2| Caenorhabditis elegans inorganic PYroPhospha... 40 8.8
95ref|NM_001027904.1| Caenorhabditis elegans inorganic PYroPhospha... 40 8.8
96ref|NM_001027902.1| Caenorhabditis elegans inorganic PYroPhospha... 40 8.8
97emb|BX933929.2| Gallus gallus finished cDNA, clone ChEST130l7 40 8.8
98emb|CR352483.1| Gallus gallus finished cDNA, clone ChEST179i7 40 8.8
99dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
100emb|BX930000.1| Gallus gallus finished cDNA, clone ChEST766c12 40 8.8
101gb|AF016684.1| Caenorhabditis elegans cosmid F45C12, complete se... 40 8.8
102emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 8.8
103gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.8
104emb|AL590969.12| Mouse DNA sequence from clone RP23-281C18 on ch... 40 8.8
105gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, comp... 40 8.8

>ref|XM_506994.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1767_D02.15-2
           mRNA
          Length = 1130

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 329 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 387

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 388 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 447

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 448 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 507

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 508 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 567

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 568 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 627

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 628 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 687

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 688 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 747

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 748 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 807

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 808 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 867

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 868 gagagctctcactagccta 886



to top

>ref|XM_467983.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1187

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 386 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 444

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 445 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 504

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 505 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 564

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 565 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 624

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 625 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 684

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 685 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 744

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 745 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 804

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 805 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 864

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 865 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 924

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 925 gagagctctcactagccta 943



to top

>ref|XM_467984.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1125

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 387 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 445

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 446 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 505

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 506 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 565

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 566 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 625

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 626 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 685

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 686 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 745

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 746 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 805

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 806 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 865

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 866 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 925

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 926 gagagctctcactagccta 944



to top

>ref|XM_507534.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1767_D02.15-2
           mRNA
          Length = 1198

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 387 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 445

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 446 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 505

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 506 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 565

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 566 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 625

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 626 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 685

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 686 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 745

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 746 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 805

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 806 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 865

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 866 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 925

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 926 gagagctctcactagccta 944



to top

>ref|XM_506993.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1767_D02.15-2
           mRNA
          Length = 1204

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 391 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 449

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 450 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 509

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 510 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 569

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 570 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 629

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 630 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 689

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 690 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 749

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 750 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 809

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 810 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 869

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 870 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 929

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 930 gagagctctcactagccta 948



to top

>dbj|AK104659.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D07, full
           insert sequence
          Length = 1187

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 386 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 444

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 445 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 504

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 505 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 564

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 565 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 624

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 625 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 684

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 685 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 744

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 745 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 804

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 805 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 864

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 865 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 924

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 925 gagagctctcactagccta 943



to top

>dbj|AK098996.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013102B11, full
           insert sequence
          Length = 1199

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 388 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 446

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 447 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 506

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 507 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 566

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 567 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 626

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 627 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 686

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 687 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 746

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 747 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 806

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 807 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 866

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 867 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 926

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 927 gagagctctcactagccta 945



to top

>dbj|AK060304.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-A07, full
           insert sequence
          Length = 1130

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 329 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 387

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 388 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 447

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 448 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 507

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 508 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 567

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 568 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 627

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 628 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 687

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 688 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 747

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 748 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 807

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 808 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 867

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 868 gagagctctcactagccta 886



to top

>dbj|AK059725.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-B08, full
           insert sequence
          Length = 1204

 Score =  593 bits (299), Expect = e-166
 Identities = 495/559 (88%), Gaps = 1/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 391 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 449

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 450 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 509

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 510 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 569

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 570 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 629

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 630 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 689

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 690 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 749

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||
Sbjct: 750 attttccgggaacattgactgccatcagagactggttcagggactacaagataccagacg 809

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| |||||||||||||||||||| ||||
Sbjct: 810 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaaggaatatgctctga 869

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 870 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 929

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 930 gagagctctcactagccta 948



to top

>dbj|AK099120.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036A18, full
           insert sequence
          Length = 1123

 Score =  563 bits (284), Expect = e-157
 Identities = 492/559 (88%), Gaps = 3/559 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 387 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 445

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           |||||||||||||||| ||||||||||||||||| || ||||| ||||| ||| ||||||
Sbjct: 446 agaagggcaacctccgatactacccgtacaacattaattggaattatggattatttcccc 505

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||   ||||||  | ||||| ||||||||| |||| || ||||
Sbjct: 506 aaacatgggaggacccaactcttgcaaacaccgatgtcgaaggagcatttggggataatg 565

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||||||||||||||| || || ||||| |||||||||| ||
Sbjct: 566 atcctgttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaagg 625

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | ||||| |||||||||||||| |||||||| || || ||||||||||||||||||||||
Sbjct: 626 taaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtgg 685

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           | ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| |||
Sbjct: 686 ctatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagc 745

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           ||||||||||||| |||||||| |||  |||||||||||| ||||||||||| |||||||
Sbjct: 746 attttccgggaacattgactgccatc--agactggttcagggactacaagataccagacg 803

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| || |||||||| ||  ||||| |||| ||||||||||||| |||||| ||||
Sbjct: 804 gtaagcctgcaaacagatttggtctgggcaacaaacccacaagcaagggatatgctctga 863

                                                                       
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagaggaaaatcccggcgg 540
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 864 aggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaaggaatatccctgctg 923

                              
Query: 541 gagagctctcgctagccta 559
           |||||||||| ||||||||
Sbjct: 924 gagagctctcactagccta 942



to top

>gb|BT017874.1| Zea mays clone EL01N0513B08.c mRNA sequence
          Length = 961

 Score =  511 bits (258), Expect = e-142
 Identities = 460/526 (87%), Gaps = 1/526 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
           |||||||||| |||||||||||||||||| | |  | ||| |||||||||||||||||||
Sbjct: 179 cagcgccaag-atggaggtcgccaccgactatgttttcacgcccatcaagcaggacacca 237

                                                                       
Query: 61  agaagggcaacctccgttactacccgtacaacatcaactggaactatgggttacttcccc 120
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 238 agaagggcaaccttcgatactacccgtacaacattaactggaactatgggttacttcctc 297

                                                                       
Query: 121 agacatgggaggatccgacagctgcaaatgctgatgttgaaggagcacttggagacaatg 180
           | ||||||||||| || ||  |||||||| |||| |||||||||||| |||| || ||||
Sbjct: 298 aaacatgggaggacccaacttctgcaaattctgaggttgaaggagcatttggggataatg 357

                                                                       
Query: 181 atccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttaggg 240
           |||| ||||||||||| ||||| ||||||||||| |||||| | ||||| ||||||| ||
Sbjct: 358 atcctgttgatgttgttgagataggtgaaagacgtgccaatgtcggggacgttcttaagg 417

                                                                       
Query: 241 tgaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtgg 300
           | || ||||||||||||||||| |||||||| || |||||||||||||||||||||||||
Sbjct: 418 ttaagccattggcagctttagcaatgattgatgagggagagcttgactggaaaattgtgg 477

                                                                       
Query: 301 ccatttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagc 360
           ||||||||||||| || || ||||||||||||||||| || || |||||||| ||| |||
Sbjct: 478 ccatttctttggatgacccgaaagcatctcttgtgaacgacgtggatgatgttgagaagc 537

                                                                       
Query: 361 attttccgggaacgttgactgcaatcagagactggttcagagactacaagatcccagacg 420
           |||||||||| ||  ||||||| ||||||||||||||||||||||||||||| || || |
Sbjct: 538 attttccggggacactgactgccatcagagactggttcagagactacaagatacctgatg 597

                                                                       
Query: 421 ggaagcccgccaacagattcggcttgggcgacaagcccacaagcaaggaatatgccctga 480
           | ||||| ||||||| ||| ||  | ||| |||||||| ||||||||||||| |||||||
Sbjct: 598 gaaagcctgccaacaaatttggtctcggcaacaagcccgcaagcaaggaatacgccctga 657

                                                         
Query: 481 aggtgatagaggaaaccaacgagtcatgggagaaattggtgaagag 526
           |||| ||  | || |||||||| ||||||||||||||||| |||||
Sbjct: 658 aggtcattcaagagaccaacgaatcatgggagaaattggtaaagag 703



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  230 bits (116), Expect = 5e-57
 Identities = 170/188 (90%)
 Strand = Plus / Plus

                                                                            
Query: 182      tccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttagggt 241
                ||||||||||||||| ||||||||||||||||| || || ||||| |||||||||| |||
Sbjct: 32395488 tccagttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaaggt 32395547

                                                                            
Query: 242      gaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtggc 301
                 ||||| |||||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 32395548 aaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtggc 32395607

                                                                            
Query: 302      catttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagca 361
                 ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| ||||
Sbjct: 32395608 tatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagca 32395667

                        
Query: 362      ttttccgg 369
                ||||||||
Sbjct: 32395668 ttttccgg 32395675



 Score =  119 bits (60), Expect = 1e-23
 Identities = 82/88 (93%), Gaps = 1/88 (1%)
 Strand = Plus / Plus

                                                                            
Query: 1        cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
                |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 32393798 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 32393856

                                            
Query: 61       agaagggcaacctccgttactacccgta 88
                |||||||||||||||| |||||||||||
Sbjct: 32393857 agaagggcaacctccgatactacccgta 32393884



 Score =  115 bits (58), Expect = 2e-22
 Identities = 85/94 (90%)
 Strand = Plus / Plus

                                                                            
Query: 466      aggaatatgccctgaaggtgatagaggaaaccaacgagtcatgggagaaattggtgaaga 525
                |||||||||| |||||||| ||||| ||||||||||| |||||||||||||||||||| |
Sbjct: 32396309 aggaatatgctctgaaggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaa 32396368

                                                  
Query: 526      ggaaaatcccggcgggagagctctcgctagccta 559
                |||| ||||| || ||||||||||| ||||||||
Sbjct: 32396369 ggaatatccctgctggagagctctcactagccta 32396402



 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                            
Query: 368      gggaacgttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcc 427
                |||||| |||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 32396134 gggaacattgactgccatcagagactggttcagggactacaagataccagacggtaagcc 32396193

                                                         
Query: 428      cgccaacagattcggcttgggcgacaagcccacaagcaagg 468
                 || |||||||| ||  ||||| |||| |||||||||||||
Sbjct: 32396194 tgcaaacagatttggtctgggcaacaaacccacaagcaagg 32396234



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                            
Query: 86       gtacaacatcaactggaactatgggttacttccccagacatgggaggatccgacagctgc 145
                ||||||||| || ||||| ||||| ||| ||||||| ||||||||||| || ||   |||
Sbjct: 32395297 gtacaacattaattggaattatggattatttccccaaacatgggaggacccaactcttgc 32395356

                                                       
Query: 146      aaatgctgatgttgaaggagcacttggagacaatgatcc 184
                |||  | ||||| ||||||||| |||| || ||||||||
Sbjct: 32395357 aaacaccgatgtcgaaggagcatttggggataatgatcc 32395395



to top

>dbj|AP004125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1767_D02
          Length = 139145

 Score =  230 bits (116), Expect = 5e-57
 Identities = 170/188 (90%)
 Strand = Plus / Plus

                                                                         
Query: 182   tccagttgatgttgtcgagattggtgaaagacgggccaatattggggatgttcttagggt 241
             ||||||||||||||| ||||||||||||||||| || || ||||| |||||||||| |||
Sbjct: 57001 tccagttgatgttgttgagattggtgaaagacgtgctaacattggagatgttcttaaggt 57060

                                                                         
Query: 242   gaaaccattggcagctttagcgatgattgacgaaggagagcttgactggaaaattgtggc 301
              ||||| |||||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 57061 aaaaccgttggcagctttagcaatgattgatgagggtgagcttgactggaaaattgtggc 57120

                                                                         
Query: 302   catttctttggacgatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagca 361
              ||||||||||| ||||| ||||||||||||||||||||||| |||||||| ||| ||||
Sbjct: 57121 tatttctttggatgatcctaaagcatctcttgtgaatgatgtggatgatgttgagaagca 57180

                     
Query: 362   ttttccgg 369
             ||||||||
Sbjct: 57181 ttttccgg 57188



 Score =  119 bits (60), Expect = 1e-23
 Identities = 82/88 (93%), Gaps = 1/88 (1%)
 Strand = Plus / Plus

                                                                         
Query: 1     cagcgccaagtatggaggtcgccaccgacgaggcctacactcccatcaagcaggacacca 60
             |||||||||| ||||||||||||||||||||| | | ||| |||||||||||||||||||
Sbjct: 55311 cagcgccaag-atggaggtcgccaccgacgagtcattcacccccatcaagcaggacacca 55369

                                         
Query: 61    agaagggcaacctccgttactacccgta 88
             |||||||||||||||| |||||||||||
Sbjct: 55370 agaagggcaacctccgatactacccgta 55397



 Score =  115 bits (58), Expect = 2e-22
 Identities = 85/94 (90%)
 Strand = Plus / Plus

                                                                         
Query: 466   aggaatatgccctgaaggtgatagaggaaaccaacgagtcatgggagaaattggtgaaga 525
             |||||||||| |||||||| ||||| ||||||||||| |||||||||||||||||||| |
Sbjct: 57822 aggaatatgctctgaaggtcatagaagaaaccaacgaatcatgggagaaattggtgaaaa 57881

                                               
Query: 526   ggaaaatcccggcgggagagctctcgctagccta 559
             |||| ||||| || ||||||||||| ||||||||
Sbjct: 57882 ggaatatccctgctggagagctctcactagccta 57915



 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                         
Query: 368   gggaacgttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcc 427
             |||||| |||||||| ||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 57647 gggaacattgactgccatcagagactggttcagggactacaagataccagacggtaagcc 57706

                                                      
Query: 428   cgccaacagattcggcttgggcgacaagcccacaagcaagg 468
              || |||||||| ||  ||||| |||| |||||||||||||
Sbjct: 57707 tgcaaacagatttggtctgggcaacaaacccacaagcaagg 57747



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                         
Query: 86    gtacaacatcaactggaactatgggttacttccccagacatgggaggatccgacagctgc 145
             ||||||||| || ||||| ||||| ||| ||||||| ||||||||||| || ||   |||
Sbjct: 56810 gtacaacattaattggaattatggattatttccccaaacatgggaggacccaactcttgc 56869

                                                    
Query: 146   aaatgctgatgttgaaggagcacttggagacaatgatcc 184
             |||  | ||||| ||||||||| |||| || ||||||||
Sbjct: 56870 aaacaccgatgtcgaaggagcatttggggataatgatcc 56908



to top

>gb|AY705803.1| Pinus halepensis clone 25r mRNA sequence
          Length = 1033

 Score =  165 bits (83), Expect = 2e-37
 Identities = 272/335 (81%)
 Strand = Plus / Plus

                                                                       
Query: 36  tacactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatc 95
           |||||||| |||||||||||||| ||||||||||| || || || ||||| || ||||| 
Sbjct: 410 tacactccaatcaagcaggacactaagaagggcaagcttcgatattacccatataacata 469

                                                                       
Query: 96  aactggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgat 155
           || ||||||||||| || ||||| || |||||||| || ||  |   ||||||||| || 
Sbjct: 470 aattggaactatggattgcttccacaaacatgggaagacccatctcttgcaaatgcagaa 529

                                                                       
Query: 156 gttgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaagacgg 215
           |||||||||||| |||| |||||||||||||||||||| || |||||||| ||||| | |
Sbjct: 530 gttgaaggagcatttggtgacaatgatccagttgatgtggttgagattggggaaaggcag 589

                                                                       
Query: 216 gccaatattggggatgttcttagggtgaaaccattggcagctttagcgatgattgacgaa 275
           || || ||||| || || ||||  ||||| ||||| || |||||||| |||||||| |||
Sbjct: 590 gctaaaattggagaagtacttaaagtgaagccattagctgctttagcaatgattgatgaa 649

                                                                       
Query: 276 ggagagcttgactggaaaattgtggccatttctttggacgatcccaaagcatctcttgtg 335
           || ||  | || ||||||||||| || |||||| | || ||||| | |||| | ||||| 
Sbjct: 650 ggtgaattggattggaaaattgttgctatttctgttgatgatccaagagcaccacttgtc 709

                                              
Query: 336 aatgatgtagatgatgtcgaggagcattttccggg 370
           ||||||||  | ||||| ||| |||| ||||||||
Sbjct: 710 aatgatgtcaacgatgttgagaagcactttccggg 744



to top

>ref|NM_121002.2| Arabidopsis thaliana inorganic diphosphatase/ magnesium ion binding
           / pyrophosphatase AT5G09650 mRNA, complete cds
          Length = 1175

 Score =  129 bits (65), Expect = 1e-26
 Identities = 155/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 694 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 753

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||| || 
Sbjct: 754 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgggtaca 813

                                                                       
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcccgccaac 434
            | || || || ||||||||||| |||||||||||||||||||| || ||||| || |||
Sbjct: 814 ctaacagccattagagactggtttagagactacaagatcccagatggaaagcctgctaac 873

                
Query: 435 agatt 439
           |||||
Sbjct: 874 agatt 878



 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| ||||| ||
Sbjct: 477 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattaa 536

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 537 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 596

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 597 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 649



to top

>gb|AY551439.1| Arabidopsis thaliana chloroplast inorganic pyrophosphatase mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1077

 Score =  129 bits (65), Expect = 1e-26
 Identities = 155/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 598 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 657

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||| || 
Sbjct: 658 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgggtaca 717

                                                                       
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcccgccaac 434
            | || || || ||||||||||| |||||||||||||||||||| || ||||| || |||
Sbjct: 718 ctaacagccattagagactggtttagagactacaagatcccagatggaaagcctgctaac 777

                
Query: 435 agatt 439
           |||||
Sbjct: 778 agatt 782



 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| ||||| ||
Sbjct: 381 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattaa 440

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 441 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 500

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 501 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 553



to top

>gb|AY079355.1| Arabidopsis thaliana putative inorganic pyrophosphatase (At5g09650)
           mRNA, complete cds
          Length = 934

 Score =  129 bits (65), Expect = 1e-26
 Identities = 155/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 598 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 657

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||| || 
Sbjct: 658 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgggtaca 717

                                                                       
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcccgccaac 434
            | || || || ||||||||||| |||||||||||||||||||| || ||||| || |||
Sbjct: 718 ctaacagccattagagactggtttagagactacaagatcccagatggaaagcctgctaac 777

                
Query: 435 agatt 439
           |||||
Sbjct: 778 agatt 782



 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| ||||| ||
Sbjct: 381 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattaa 440

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 441 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 500

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 501 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 553



to top

>gb|AY045945.1| Arabidopsis thaliana putative inorganic pyrophosphatase (At5g09650)
           mRNA, complete cds
          Length = 1161

 Score =  129 bits (65), Expect = 1e-26
 Identities = 155/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 682 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 741

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||| || 
Sbjct: 742 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgggtaca 801

                                                                       
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcccgccaac 434
            | || || || ||||||||||| |||||||||||||||||||| || ||||| || |||
Sbjct: 802 ctaacagccattagagactggtttagagactacaagatcccagatggaaagcctgctaac 861

                
Query: 435 agatt 439
           |||||
Sbjct: 862 agatt 866



 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| ||||| ||
Sbjct: 465 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattaa 524

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 525 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 584

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 585 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 637



to top

>gb|AY087275.1| Arabidopsis thaliana clone 33506 mRNA, complete sequence
          Length = 1139

 Score =  129 bits (65), Expect = 1e-26
 Identities = 155/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 695 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 754

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||| || 
Sbjct: 755 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgggtaca 814

                                                                       
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcccgccaac 434
            | || || || ||||||||||| |||||||||||||||||||| || ||||| || |||
Sbjct: 815 ctaacagccattagagactggtttagagactacaagatcccagatggaaagcctgctaac 874

                
Query: 435 agatt 439
           |||||
Sbjct: 875 agatt 879



 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| ||||| ||
Sbjct: 478 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattaa 537

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 538 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 597

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 598 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 650



to top

>emb|AJ252210.1|ATH252210 Arabidopsis thaliana mRNA for inorganic pyrophosphatase (ppa gene)
          Length = 911

 Score =  129 bits (65), Expect = 1e-26
 Identities = 155/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 600 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 659

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||| || 
Sbjct: 660 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgggtaca 719

                                                                       
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcccgccaac 434
            | || || || ||||||||||| |||||||||||||||||||| || ||||| || |||
Sbjct: 720 ctaacagccattagagactggtttagagactacaagatcccagatggaaagcctgctaac 779

                
Query: 435 agatt 439
           |||||
Sbjct: 780 agatt 784



 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| ||||| ||
Sbjct: 383 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattaa 442

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 443 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 502

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 503 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 555



to top

>gb|BT014393.1| Lycopersicon esculentum clone 133698R, mRNA sequence
          Length = 1173

 Score =  115 bits (58), Expect = 2e-22
 Identities = 268/338 (79%)
 Strand = Plus / Plus

                                                                       
Query: 90  aacatcaactggaactatgggttacttccccagacatgggaggatccgacagctgcaaat 149
           ||||| |||||||||||||| || ||||| || || ||||| || ||  ||   ||||||
Sbjct: 482 aacattaactggaactatggattgcttcctcaaacctgggaagacccttcattggcaaat 541

                                                                       
Query: 150 gctgatgttgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaa 209
           ||||| ||||| || ||| ||||||| ||||| || |||||||||||||||||||| |||
Sbjct: 542 gctgaagttgagggggcatttggagataatgaccctgttgatgttgtcgagattggggaa 601

                                                                       
Query: 210 agacgggccaatattggggatgttcttagggtgaaaccattggcagctttagcgatgatt 269
           || || || || || ||  | ||  | | ||| ||||| || || ||||| || ||||||
Sbjct: 602 agtcgtgctaaaatgggccaggtcttgaaggtcaaacctttagctgctttggcaatgatt 661

                                                                       
Query: 270 gacgaaggagagcttgactggaaaattgtggccatttctttggacgatcccaaagcatct 329
           || |||||||| |||||||||||||| || || || ||| | || ||||||  ||| || 
Sbjct: 662 gatgaaggagaacttgactggaaaatagttgctatatctctagatgatccccgagcttca 721

                                                                       
Query: 330 cttgtgaatgatgtagatgatgtcgaggagcattttccgggaacgttgactgcaatcaga 389
           ||||| |||||| | |||||||| ||| ||||||| ||||| ||  |||| || ||||  
Sbjct: 722 cttgtcaatgatattgatgatgttgagaagcatttcccgggcactctgacagctatcatg 781

                                                 
Query: 390 gactggttcagagactacaagatcccagacgggaagcc 427
           |||||||| |||||||| ||||| || || ||||||||
Sbjct: 782 gactggtttagagactataagattcctgatgggaagcc 819



to top

>gb|DQ122898.1| Chlamydomonas incerta chloroplast inorganic pyrophosphatase (PpaI)
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 648

 Score =  115 bits (58), Expect = 2e-22
 Identities = 106/122 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggaggtcgccaccgacgaggcctacactcccatcaagcaggacaccaagaagggcaac 71
           |||||||||||||| |||||||||| ||| |||||||||||||||   ||||||||||| 
Sbjct: 319 atggaggtcgccacggacgaggcctgcacccccatcaagcaggacgtgaagaagggcaag 378

                                                                       
Query: 72  ctccgttactacccgtacaacatcaactggaactatgggttacttccccagacatgggag 131
           ||||| | |||||| |||||||||||||||||||| ||  | || |||||||| ||||||
Sbjct: 379 ctccgcttctacccctacaacatcaactggaactacggcatgctgccccagacctgggag 438

             
Query: 132 ga 133
           ||
Sbjct: 439 ga 440



to top

>emb|AJ298231.1|CRE298231 Chlamydomonas reinhardtii partial mRNA for inorganic
           pyrophosphatase precursor (ppaI gene)
          Length = 1147

 Score =  107 bits (54), Expect = 5e-20
 Identities = 105/122 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  atggaggtcgccaccgacgaggcctacactcccatcaagcaggacaccaagaagggcaac 71
           |||||||||||||| |||||| ||  ||| |||||||||||||||   ||||||||||| 
Sbjct: 346 atggaggtcgccacggacgagccccgcacccccatcaagcaggacgtgaagaagggcaag 405

                                                                       
Query: 72  ctccgttactacccgtacaacatcaactggaactatgggttacttccccagacatgggag 131
           ||||| | ||||||||||||||||||||||||||| ||  | || |||||||| ||||||
Sbjct: 406 ctccgcttctacccgtacaacatcaactggaactacggcatgctgccccagacctgggag 465

             
Query: 132 ga 133
           ||
Sbjct: 466 ga 467



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 393 tggttcagagactacaagatcccagacgggaagcccgccaaca 435
           |||||| | |||||||| ||||| ||||| |||||||||||||
Sbjct: 724 tggttccgggactacaaaatccctgacggcaagcccgccaaca 766



to top

>emb|BX830340.1|CNS0A1HN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1094

 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 255 gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
           |||||||| |||||||| ||||| |||||  ||||||| ||||| |||||||||||||| 
Sbjct: 663 gctttagctatgattgatgaaggtgagctaaactggaagattgttgccatttctttggat 722

                                                                       
Query: 315 gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgggaacg 374
           || || |||||   ||||||||||||||| || ||||| ||| | ||| | ||||| || 
Sbjct: 723 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatctcccgggtaca 782

                                                                
Query: 375 ttgactgcaatcagagactggttcagagactacaagatcccagacgggaagcc 427
            | || || || ||||||||||| |||||||||||||||||||| || |||||
Sbjct: 783 ctcacagccattagagactggtttagagactacaagatcccagatggaaagcc 835



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 38  cactcccatcaagcaggacaccaagaagggcaacctccgttactacccgtacaacatcaa 97
           |||||| || |||||||| || |||||||| || ||| | || || ||||| |||||  |
Sbjct: 446 cactcctattaagcaggatactaagaaggggaagctcagatattatccgtataacattca 505

                                                                       
Query: 98  ctggaactatgggttacttccccagacatgggaggatccgacagctgcaaatgctgatgt 157
           ||||||||||||||| ||||| || |||||||| |||||  |   ||||||| |||| ||
Sbjct: 506 ctggaactatgggttgcttcctcaaacatgggaagatccatctcatgcaaattctgaagt 565

                                                                
Query: 158 tgaaggagcacttggagacaatgatccagttgatgttgtcgagattggtgaaa 210
           |||||||    |||| || |||||||||||||||||||| |||||||||||||
Sbjct: 566 tgaaggatgttttggggataatgatccagttgatgttgttgagattggtgaaa 618



to top

>gb|AY109365.1| Zea mays CL4861_1 mRNA sequence
          Length = 1506

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 82/93 (88%), Gaps = 4/93 (4%)
 Strand = Plus / Plus

                                                                       
Query: 249 ttggcagctttagcgatgattgacgaaggag----agcttgactggaaaattgtggccat 304
           |||||||||||||| |||||||| || ||||    | |||||||||||||||||||||||
Sbjct: 44  ttggcagctttagcaatgattgatgagggaggtcgaccttgactggaaaattgtggccat 103

                                            
Query: 305 ttctttggacgatcccaaagcatctcttgtgaa 337
           ||||||||| || || |||||||||||||||||
Sbjct: 104 ttctttggatgacccgaaagcatctcttgtgaa 136



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 376 tgactgcaatcagagactggttcagagactacaagat 412
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 175 tgactgccatcagagactggttcagagactacaagat 211



to top

>dbj|AB020752.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTH16
          Length = 68098

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                         
Query: 255   gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
             |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 12678 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 12619

                                                                    
Query: 315   gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgg 369
             || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||
Sbjct: 12618 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgg 12564



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 387   agagactggttcagagactacaagatcccagacgggaagcccgccaacagatt 439
             ||||||||||| |||||||||||||||||||| || ||||| || ||||||||
Sbjct: 12461 agagactggtttagagactacaagatcccagatggaaagcctgctaacagatt 12409



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 90    aacatcaactggaactatgggttacttccccagacatgggaggatcc 136
             ||||| ||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 12932 aacattaactggaactatgggttgcttcctcaaacatgggaagatcc 12886



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 185   agttgatgttgtcgagattggtgaaa 210
             |||||||||||| |||||||||||||
Sbjct: 12748 agttgatgttgttgagattggtgaaa 12723



to top

>emb|AL353994.1|ATF17I14 Arabidopsis thaliana DNA chromosome 5, BAC clone F17I14 (ESSA project)
          Length = 92491

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Plus

                                                                         
Query: 255   gctttagcgatgattgacgaaggagagcttgactggaaaattgtggccatttctttggac 314
             |||||||| |||||||| ||||| ||||| |||||||| ||||| |||||||||||||| 
Sbjct: 56906 gctttagctatgattgatgaaggtgagctagactggaagattgttgccatttctttggat 56965

                                                                    
Query: 315   gatcccaaagcatctcttgtgaatgatgtagatgatgtcgaggagcattttccgg 369
             || || |||||   ||||||||||||||| || ||||| ||| | ||||| ||||
Sbjct: 56966 gacccaaaagctcatcttgtgaatgatgttgaagatgttgagaaacatttcccgg 57020



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                  
Query: 387   agagactggttcagagactacaagatcccagacgggaagcccgccaacagatt 439
             ||||||||||| |||||||||||||||||||| || ||||| || ||||||||
Sbjct: 57123 agagactggtttagagactacaagatcccagatggaaagcctgctaacagatt 57175



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 90    aacatcaactggaactatgggttacttccccagacatgggaggatcc 136
             ||||| ||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 56652 aacattaactggaactatgggttgcttcctcaaacatgggaagatcc 56698



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 185   agttgatgttgtcgagattggtgaaa 210
             |||||||||||| |||||||||||||
Sbjct: 56836 agttgatgttgttgagattggtgaaa 56861



to top

>ref|XM_960051.1| Neurospora crassa OR74A hypothetical protein (NCU00951.1) partial
           mRNA
          Length = 1413

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||||||||||||||| |||||
Sbjct: 748 cccatcaagcaggacaccaagaagggcaagctccg 782



to top

>ref|XM_325130.1| Neurospora crassa OR74A hypothetical protein (NCU00951.1) partial
           mRNA
          Length = 1413

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||||||||||||||| |||||
Sbjct: 748 cccatcaagcaggacaccaagaagggcaagctccg 782



to top

>emb|BX842629.1| Neurospora crassa DNA linkage group I BAC contig B20J13
          Length = 126048

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 42    cccatcaagcaggacaccaagaagggcaacctccg 76
             ||||||||||||||||||||||||||||| |||||
Sbjct: 13436 cccatcaagcaggacaccaagaagggcaagctccg 13470



to top

>ref|XM_655480.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2968.2), mRNA
          Length = 906

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 42  cccatcaagcaggacaccaagaagggcaa 70
           |||||||||||||||||||||||||||||
Sbjct: 202 cccatcaagcaggacaccaagaagggcaa 230



to top

>ref|XM_363672.1| Magnaporthe grisea 70-15 hypothetical protein (MG01598.4) partial
           mRNA
          Length = 873

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||||| |||||||||||| |||||
Sbjct: 208 cccatcaagcaggacatcaagaagggcaagctccg 242



to top

>dbj|AB010076.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUB3
          Length = 82188

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 264  atgattgacgaaggagagcttgactggaaaattgtggccatttctttgga 313
            |||||||| ||||||||||| || ||||| ||||| || |||||||||||
Sbjct: 2977 atgattgatgaaggagagctagattggaagattgttgcgatttctttgga 2928



 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 185  agttgatgttgtcgagattggtga 208
            |||||||||||| |||||||||||
Sbjct: 3036 agttgatgttgttgagattggtga 3013



to top

>ref|XM_757124.1| Ustilago maydis 521 hypothetical protein (UM06070.1) partial mRNA
          Length = 987

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 46  tcaagcaggacaccaagaagggcaa 70
           |||||||||||||||||||||||||
Sbjct: 320 tcaagcaggacaccaagaagggcaa 344



to top

>ref|XM_380672.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG00496.1) partial mRNA
          Length = 873

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 42  cccatcaagcaggacaccaagaagggcaa 70
           |||||||||||||||| ||||||||||||
Sbjct: 208 cccatcaagcaggacatcaagaagggcaa 236



to top

>dbj|AK110681.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-H04, full
           insert sequence
          Length = 1100

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 46  tcaagcaggacaccaagaagggcaa 70
           |||||||||||||||||||||||||
Sbjct: 350 tcaagcaggacaccaagaagggcaa 374



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
             sequence
          Length = 1507550

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 42    cccatcaagcaggacaccaagaagggcaacctccg 76
             ||||||||||||||||  ||||||||||| |||||
Sbjct: 48254 cccatcaagcaggacattaagaagggcaagctccg 48288



to top

>ref|XM_571083.1| Cryptococcus neoformans var. neoformans JEC21 inorganic
           diphosphatase (CNE00210) partial mRNA
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 270 cccatcaagcaggacattaagaagggcaagctccg 304



to top

>ref|XM_505378.1| Yarrowia lipolytica CLIB122, YALI0F13541g predicted mRNA
          Length = 864

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           |||||||  |||||||||||||||||||| |||||
Sbjct: 205 cccatcatccaggacaccaagaagggcaagctccg 239



to top

>gb|DQ437939.1| Cryptococcus neoformans var. neoformans strain 92-27 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 366

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437938.1| Cryptococcus neoformans var. neoformans strain 92-18 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437937.1| Cryptococcus neoformans var. neoformans strain MMRL760 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 366

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437936.1| Cryptococcus neoformans var. neoformans strain Y 494-91 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437935.1| Cryptococcus neoformans var. neoformans strain Y 290-90 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437934.1| Cryptococcus neoformans var. neoformans strain Y 286-90 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437933.1| Cryptococcus neoformans var. neoformans strain CAP 67-2 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437932.1| Cryptococcus neoformans var. neoformans strain B3179 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437931.1| Cryptococcus neoformans var. neoformans strain 11 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 366

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437929.1| Cryptococcus neoformans var. neoformans strain J9 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>gb|DQ437928.1| Cryptococcus neoformans var. neoformans strain B3501 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 368

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 42  cccatcaagcaggacaccaagaagggcaacctccg 76
           ||||||||||||||||  ||||||||||| |||||
Sbjct: 96  cccatcaagcaggacattaagaagggcaagctccg 130



to top

>dbj|AB226094.1| Aspergillus oryzae cDNA, contig sequence: AoEST2951
          Length = 1060

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 42  cccatcaagcaggacaccaagaagggcaacctccgttac 80
           ||||||||||||||   |||||||||||| |||||||||
Sbjct: 321 cccatcaagcaggatgtcaagaagggcaagctccgttac 359



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 42      cccatcaagcaggacaccaagaagggcaacctccgttac 80
               ||||||||||||||   |||||||||||| |||||||||
Sbjct: 3808511 cccatcaagcaggatgtcaagaagggcaagctccgttac 3808549



to top

>ref|NM_079125.2| Drosophila melanogaster Nucleosome remodeling factor - 38kD
           CG4634-RA (Nurf-38), mRNA
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 41  tcccatcaagcaggacaccaagaaggg 67
           ||||||||||||||||| |||||||||
Sbjct: 378 tcccatcaagcaggacatcaagaaggg 404



to top

>gb|AY075479.1| Drosophila melanogaster RE37074 full length cDNA
          Length = 1193

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 41  tcccatcaagcaggacaccaagaaggg 67
           ||||||||||||||||| |||||||||
Sbjct: 377 tcccatcaagcaggacatcaagaaggg 403



to top

>gb|AC007574.6|AC007574 Drosophila melanogaster, chromosome 2R, region 60D-60D, BAC clone
             BACR11C07, complete sequence
          Length = 171151

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 41    tcccatcaagcaggacaccaagaaggg 67
             ||||||||||||||||| |||||||||
Sbjct: 95643 tcccatcaagcaggacatcaagaaggg 95617



to top

>emb|AL391749.4|CNS06C8I Human chromosome 14 DNA sequence BAC R-233L14 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195007

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 140    agctgcaaatgctgatgttgaag 162
              |||||||||||||||||||||||
Sbjct: 123991 agctgcaaatgctgatgttgaag 123969



to top

>gb|AE003464.2| Drosophila melanogaster chromosome 2R, section 71 of 73 of the complete
              sequence
          Length = 310958

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 41     tcccatcaagcaggacaccaagaaggg 67
              ||||||||||||||||| |||||||||
Sbjct: 183696 tcccatcaagcaggacatcaagaaggg 183670



to top

>gb|AF085601.1|AF085601 Drosophila melanogaster inorganic pyrophosphatase NURF-38 (Nurf-38)
           mRNA, complete cds
          Length = 873

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 41  tcccatcaagcaggacaccaagaaggg 67
           ||||||||||||||||| |||||||||
Sbjct: 207 tcccatcaagcaggacatcaagaaggg 233



to top

>gb|AF085600.1|AF085600 Drosophila melanogaster inorganic pyrophosphatase NURF-38 (Nurf-38)
            gene, complete cds
          Length = 2826

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 41   tcccatcaagcaggacaccaagaaggg 67
            ||||||||||||||||| |||||||||
Sbjct: 1356 tcccatcaagcaggacatcaagaaggg 1382



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 42      cccatcaagcaggacaccaagaagggcaacctccg 76
               |||||||  |||||||||||||||||||| |||||
Sbjct: 1815222 cccatcatccaggacaccaagaagggcaagctccg 1815188



to top

>ref|XM_414212.1| PREDICTED: Gallus gallus similar to Sulfotransferase family 5A,
            member 1 (LOC415852), mRNA
          Length = 1290

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 338  tgatgtagatgatgtcgaggag 359
            ||||||||||||||||||||||
Sbjct: 1283 tgatgtagatgatgtcgaggag 1262



to top

>ref|NM_123986.3| Arabidopsis thaliana unknown protein AT5G46170 mRNA, complete cds
          Length = 1691

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 234  cttagggtgaaaccattggcagctt 258
            ||||||||||||||||| |||||||
Sbjct: 1047 cttagggtgaaaccattagcagctt 1071



to top

>gb|AY431337.1| Aedes aegypti ASAP ID: 35937 inorganic pyrophosphatase mRNA
           sequence
          Length = 779

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 42  cccatcaagcaggacaccaagaagggcaa 70
           |||||||||||||||  ||||||||||||
Sbjct: 476 cccatcaagcaggacgtcaagaagggcaa 504



to top

>gb|DQ440278.1| Aedes aegypti clone AET-3565 inorganic pyrophosphatase mRNA,
           complete cds
          Length = 885

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 42  cccatcaagcaggacaccaagaagggcaa 70
           |||||||||||||||  ||||||||||||
Sbjct: 220 cccatcaagcaggacgtcaagaagggcaa 248



to top

>gb|AY142657.1| Arabidopsis thaliana unknown protein (At5g46170) mRNA, complete cds
          Length = 1219

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 234 cttagggtgaaaccattggcagctt 258
           ||||||||||||||||| |||||||
Sbjct: 919 cttagggtgaaaccattagcagctt 943



to top

>gb|AY070105.1| Arabidopsis thaliana unknown protein (At5g46170) mRNA, complete cds
          Length = 1698

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 234  cttagggtgaaaccattggcagctt 258
            ||||||||||||||||| |||||||
Sbjct: 1047 cttagggtgaaaccattagcagctt 1071



to top

>emb|CR938565.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YH03AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 680

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 42  cccatcaagcaggacaccaagaagggcaa 70
           |||||||||||||||  ||||||||||||
Sbjct: 475 cccatcaagcaggacgtcaagaagggcaa 503



to top

>gb|U55373.2| Caenorhabditis elegans cosmid F26F12, complete sequence
          Length = 42467

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 244  aaccattggcagctttagcga 264
            |||||||||||||||||||||
Sbjct: 4567 aaccattggcagctttagcga 4547



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 42     cccatcaagcaggacaccaagaagggcaa 70
              |||||||  ||||||||||||||||||||
Sbjct: 658973 cccatcatccaggacaccaagaagggcaa 658945



to top

>ref|NM_072122.3| Caenorhabditis elegans LEThal family member (let-418) (let-418) mRNA,
            complete cds
          Length = 5685

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 244  aaccattggcagctttagcga 264
            |||||||||||||||||||||
Sbjct: 4283 aaccattggcagctttagcga 4263



to top

>gb|AF308445.1|AF308445 Caenorhabditis elegans LET-418 (let-418) mRNA, complete cds
          Length = 5689

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 244  aaccattggcagctttagcga 264
            |||||||||||||||||||||
Sbjct: 4305 aaccattggcagctttagcga 4285



to top

>dbj|AB006698.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCL19
          Length = 84510

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 234   cttagggtgaaaccattggcagctt 258
             ||||||||||||||||| |||||||
Sbjct: 73583 cttagggtgaaaccattagcagctt 73559



to top

>ref|NM_210229.1| Eremothecium gossypii AER015Cp (AER015C), mRNA
          Length = 864

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 42  cccatcaagcaggacaccaagaagggcaa 70
           |||||||  ||||||||||||||||||||
Sbjct: 202 cccatcatccaggacaccaagaagggcaa 230



to top

>gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, complete sequence
          Length = 187046

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   acttccccagacatgggagg 132
             ||||||||||||||||||||
Sbjct: 84365 acttccccagacatgggagg 84346



to top

>gb|BT017827.1| Zea mays clone EL01N0508E10.c mRNA sequence
          Length = 966

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 478 tgaaggtgatagaggaaacc 497
           ||||||||||||||||||||
Sbjct: 649 tgaaggtgatagaggaaacc 668



to top

>gb|AC119670.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0007H22, complete sequence
          Length = 160938

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    caagcaggacaccaagaagg 66
             ||||||||||||||||||||
Sbjct: 23345 caagcaggacaccaagaagg 23326



to top

>ref|XM_421589.1| PREDICTED: Gallus gallus similar to SAR1a protein (LOC423711), mRNA
          Length = 3324

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 170  tggagacaatgatccagttgatgt 193
            |||||||||||||||| |||||||
Sbjct: 1080 tggagacaatgatccaattgatgt 1103



to top

>gb|AY568281.1| Halanaerobium congolense rhodanese (rdlA) gene, complete cds
          Length = 903

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 ctgcaaatgctgatgttgaa 161
           ||||||||||||||||||||
Sbjct: 79  ctgcaaatgctgatgttgaa 60



to top

>emb|Z68882.1|CEC47E12 Caenorhabditis elegans Cosmid C47E12, complete sequence
          Length = 37855

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 171   ggagacaatgatccagttgatgtt 194
             ||||||||||||||| ||||||||
Sbjct: 27394 ggagacaatgatccaattgatgtt 27371



to top

>gb|DQ437947.1| Cryptococcus neoformans var. grubii strain KNA-14 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 371

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 102 atcaagcaggacattaagaagggcaagctccg 133



to top

>gb|DQ437946.1| Cryptococcus neoformans var. grubii strain DUMC 127.92 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 373

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 100 atcaagcaggacattaagaagggcaagctccg 131



to top

>gb|DQ437945.1| Cryptococcus neoformans var. grubii strain 125.91 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 371

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 102 atcaagcaggacattaagaagggcaagctccg 133



to top

>gb|DQ437944.1| Cryptococcus neoformans var. grubii strain H99 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 101 atcaagcaggacattaagaagggcaagctccg 132



to top

>gb|DQ437943.1| Cryptococcus neoformans var. grubii strain 78.5.98 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 101 atcaagcaggacattaagaagggcaagctccg 132



to top

>gb|DQ437942.1| Cryptococcus neoformans var. grubii strain 46F.5.02 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 101 atcaagcaggacattaagaagggcaagctccg 132



to top

>gb|DQ437941.1| Cryptococcus neoformans var. grubii strain 98 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 101 atcaagcaggacattaagaagggcaagctccg 132



to top

>gb|DQ437940.1| Cryptococcus neoformans var. grubii strain 55 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 101 atcaagcaggacattaagaagggcaagctccg 132



to top

>gb|DQ437930.1| Cryptococcus neoformans var. grubii strain 20021.064 inorganic
           diphosphatase (CNE00210) gene, partial cds
          Length = 367

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 45  atcaagcaggacaccaagaagggcaacctccg 76
           |||||||||||||  ||||||||||| |||||
Sbjct: 101 atcaagcaggacattaagaagggcaagctccg 132



to top

>emb|AL662802.14| Mouse DNA sequence from clone RP23-34N10 on chromosome 11, complete
              sequence
          Length = 224024

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 513    aaattggtgaagaggaaaat 532
              ||||||||||||||||||||
Sbjct: 145406 aaattggtgaagaggaaaat 145425



to top

>emb|BX901978.14| Zebrafish DNA sequence from clone DKEY-155M6 in linkage group 18,
              complete sequence
          Length = 168101

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 595    acattctttcagtgacatac 614
              ||||||||||||||||||||
Sbjct: 128798 acattctttcagtgacatac 128817



to top

>emb|CR407274.1| Gallus gallus finished cDNA, clone ChEST356i23
          Length = 1050

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 170 tggagacaatgatccagttgatgt 193
           |||||||||||||||| |||||||
Sbjct: 209 tggagacaatgatccaattgatgt 232



to top

>ref|NM_061649.2| Caenorhabditis elegans F45C12.10 (F45C12.10) mRNA, complete cds
          Length = 826

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 505 catgggagaaattggtgaag 524
           ||||||||||||||||||||
Sbjct: 284 catgggagaaattggtgaag 303



to top

>ref|NM_001027905.2| Caenorhabditis elegans inorganic PYroPhosphatase family member
           (pyp-1) (pyp-1) mRNA, complete cds
          Length = 1287

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 171 ggagacaatgatccagttgatgtt 194
           ||||||||||||||| ||||||||
Sbjct: 775 ggagacaatgatccaattgatgtt 798



to top

>ref|NM_001027903.2| Caenorhabditis elegans inorganic PYroPhosphatase family member
           (pyp-1) (pyp-1) mRNA, complete cds
          Length = 1287

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 171 ggagacaatgatccagttgatgtt 194
           ||||||||||||||| ||||||||
Sbjct: 775 ggagacaatgatccaattgatgtt 798



to top

>ref|NM_001027904.1| Caenorhabditis elegans inorganic PYroPhosphatase family member
           (pyp-1) (pyp-1) mRNA, complete cds
          Length = 1350

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 171 ggagacaatgatccagttgatgtt 194
           ||||||||||||||| ||||||||
Sbjct: 838 ggagacaatgatccaattgatgtt 861



to top

>ref|NM_001027902.1| Caenorhabditis elegans inorganic PYroPhosphatase family member
           (pyp-1) (pyp-1) mRNA, complete cds
          Length = 1277

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 171 ggagacaatgatccagttgatgtt 194
           ||||||||||||||| ||||||||
Sbjct: 505 ggagacaatgatccaattgatgtt 528



to top

>emb|BX933929.2| Gallus gallus finished cDNA, clone ChEST130l7
          Length = 1220

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 170 tggagacaatgatccagttgatgt 193
           |||||||||||||||| |||||||
Sbjct: 380 tggagacaatgatccaattgatgt 403



to top

>emb|CR352483.1| Gallus gallus finished cDNA, clone ChEST179i7
          Length = 1214

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 170 tggagacaatgatccagttgatgt 193
           |||||||||||||||| |||||||
Sbjct: 374 tggagacaatgatccaattgatgt 397



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 47      caagcaggacaccaagaagg 66
               ||||||||||||||||||||
Sbjct: 6863506 caagcaggacaccaagaagg 6863525



to top

>emb|BX930000.1| Gallus gallus finished cDNA, clone ChEST766c12
          Length = 1203

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 170 tggagacaatgatccagttgatgt 193
           |||||||||||||||| |||||||
Sbjct: 363 tggagacaatgatccaattgatgt 386



to top

>gb|AF016684.1| Caenorhabditis elegans cosmid F45C12, complete sequence
          Length = 38456

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 505  catgggagaaattggtgaag 524
            ||||||||||||||||||||
Sbjct: 4672 catgggagaaattggtgaag 4691



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 48      aagcaggacaccaagaagggcaacctcc 75
               ||||||| || |||||||||||||||||
Sbjct: 1214905 aagcaggccatcaagaagggcaacctcc 1214878



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 47      caagcaggacaccaagaagg 66
               ||||||||||||||||||||
Sbjct: 6929973 caagcaggacaccaagaagg 6929992



to top

>emb|AL590969.12| Mouse DNA sequence from clone RP23-281C18 on chromosome 11, complete
             sequence
          Length = 250353

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 518   ggtgaagaggaaaatcccgg 537
             ||||||||||||||||||||
Sbjct: 87583 ggtgaagaggaaaatcccgg 87564



to top

>gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, complete sequence
          Length = 211079

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   acttccccagacatgggagg 132
             ||||||||||||||||||||
Sbjct: 44503 acttccccagacatgggagg 44484


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,744,792
Number of Sequences: 3902068
Number of extensions: 4744792
Number of successful extensions: 89279
Number of sequences better than 10.0: 105
Number of HSP's better than 10.0 without gapping: 105
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88919
Number of HSP's gapped (non-prelim): 332
length of query: 648
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 625
effective length of database: 17,143,297,704
effective search space: 10714561065000
effective search space used: 10714561065000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top