>gb|AY112210.1| Zea mays CL16630_1 mRNA sequence
          Length = 604

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 60  tcggcggcgtacctngagacggacgagaacctggaggccctcatc 104
           |||||||||||||  ||  |||||||||||||||||||| |||||
Sbjct: 61  tcggcggcgtaccctgatgcggacgagaacctggaggccatcatc 105

>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16
          Length = 347137

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     cgagatggcttcggcggcg 68
              |||||||||||||||||||
Sbjct: 209072 cgagatggcttcggcggcg 209090

>emb|BX640433.1| Bordetella parapertussis strain 12822, complete genome; segment 11/14
          Length = 349305

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     cgagatggcttcggcggcg 68
              |||||||||||||||||||
Sbjct: 145561 cgagatggcttcggcggcg 145579

>emb|BX640421.1| Bordetella pertussis strain Tohama I, complete genome; segment 11/12
          Length = 349726

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 50     cgagatggcttcggcggcg 68
              |||||||||||||||||||
Sbjct: 282964 cgagatggcttcggcggcg 282946

>dbj|AB085464.1| Uncultured bacterium gene for putative formyltetrahydrofolate
           synthetase, partial cds, clone:FNF07
          Length = 1057

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 82  acgagaacctggaggccct 100
           |||||||||||||||||||
Sbjct: 645 acgagaacctggaggccct 663

>dbj|AB085462.1| Uncultured bacterium gene for putative formyltetrahydrofolate
           synthetase, partial cds, clone:FNF05
          Length = 1057

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 82  acgagaacctggaggccct 100
           |||||||||||||||||||
Sbjct: 645 acgagaacctggaggccct 663

>dbj|AB085267.1| Uncultured bacterium gene for putative formyltetrahydrofolate
           synthetase, partial cds, clone:BND01
          Length = 1057

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 82  acgagaacctggaggccct 100
           |||||||||||||||||||
Sbjct: 645 acgagaacctggaggccct 663


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 425,827
Number of Sequences: 3902068
Number of extensions: 425827
Number of successful extensions: 32681
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32660
Number of HSP's gapped (non-prelim): 21
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)