ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags36j16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK098990.1| Oryza sativa (japonica cultivar-group) cDNA clon... 676 0.0
2dbj|AK065313.1| Oryza sativa (japonica cultivar-group) cDNA clon... 676 0.0
3dbj|AK104689.1| Oryza sativa (japonica cultivar-group) cDNA clon... 668 0.0
4gb|AY112340.1| Zea mays CL23674_1 mRNA sequence 660 0.0
5gb|AC136219.2| Oryza sativa (japonica cultivar-group) chromosome... 186 6e-44
6dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 186 6e-44
7emb|X82776.1|PSRP11 P.sativum mRNA for ribosomal protein L1 127 5e-26
8emb|BX823482.1|CNS0A5GD Arabidopsis thaliana Full-length cDNA Co... 127 5e-26
9ref|NM_116214.2| Arabidopsis thaliana RNA binding / structural c... 119 1e-23
10gb|AY133519.1| Arabidopsis thaliana At3g63490/MAA21_120 mRNA, co... 119 1e-23
11gb|AY059929.1| Arabidopsis thaliana chloroplast ribosomal L1-lik... 119 1e-23
12gb|AY053410.1| Arabidopsis thaliana AT3g63490/MAA21_120 mRNA, co... 119 1e-23
13emb|BX842134.1|CNS09YB5 Arabidopsis thaliana Full-length cDNA Co... 119 1e-23
14gb|BT001191.1| Arabidopsis thaliana chloroplast ribosomal L1-lik... 119 1e-23
15gb|DQ226667.1| Boechera divaricarpa isolate SLW-6-B05 mRNA sequence 98 4e-17
16ref|NM_202757.1| Arabidopsis thaliana RNA binding / structural c... 86 2e-13
17emb|X90855.1|ATRPL1GEN A.thaliana rpl1 gene 72 2e-09
18emb|AL163818.1|ATMAA21 Arabidopsis thaliana DNA chromosome 3, P1... 72 2e-09
19emb|X76932.1|SORPL1 S.oleracea mRNA for ribosomal protein L1 70 1e-08
20emb|BX823842.1|CNS0A5C2 Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
21emb|BX824263.1|CNS0A5MH Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
22emb|BX823424.1|CNS0A5EN Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
23dbj|AP006715.1| Porphyra yezoensis chloroplast DNA, complete genome 46 0.14
24emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete... 44 0.55
25emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome 44 0.55
26emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, comple... 44 0.55
27ref|XM_638063.1| Dictyostelium discoideum hypothetical protein (... 42 2.2
28gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold 42 2.2
29emb|CR955034.5| Wallaby DNA sequence from clone GRWB-130P10, com... 42 2.2
30emb|AL136966.27| Human DNA sequence from clone RP11-96M12 on chr... 42 2.2
31emb|Z11839.1|TMNUSGGE T.maritima nusG gene and genes for ribosom... 42 2.2
32gb|DQ118629.1| Pavlova lutheri isolate 487 chloroplast 50S ribos... 42 2.2
33gb|AC139854.21| Medicago truncatula clone mth2-16e16, complete s... 42 2.2
34gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 42 2.2
35gb|AC150442.2| Medicago truncatula chromosome 7 BAC clone mth2-2... 42 2.2
36gb|AC147583.3| Otolemur garnettii clone CH256-410D4, complete se... 42 2.2
37gb|AC114263.2| Dictyostelium discoideum chromosome 2 map 215673-... 42 2.2
38gb|AC146357.3| Otolemur garnettii clone CH256-396G19, complete s... 42 2.2
39gb|AE000512.1| Thermotoga maritima MSB8, complete genome 42 2.2
40gb|AC102139.5| Mus musculus chromosome 15, clone RP23-286F21, co... 42 2.2
41ref|XM_426195.1| PREDICTED: Gallus gallus similar to DEAD (Asp-G... 40 8.6
42ref|XM_747725.1| Aspergillus fumigatus Af293 aminotransferase (A... 40 8.6
43gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, comp... 40 8.6
44gb|AC144431.11| Medicago truncatula clone mth2-21i14, complete s... 40 8.6
45gb|AC149305.19| Medicago truncatula clone mth2-78k4, complete se... 40 8.6
46emb|AL513364.10| Human DNA sequence from clone RP11-480N10 on ch... 40 8.6
47emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 40 8.6
48dbj|AK046358.1| Mus musculus adult male corpora quadrigemina cDN... 40 8.6
49dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome 40 8.6
50gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete seq... 40 8.6
51emb|CR955007.2| Medicago truncatula chromosome 5 clone mte1-58b2... 40 8.6
52gb|AC139316.4| Mus musculus BAC clone RP24-500I24 from 3, comple... 40 8.6
53emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 8.6
54dbj|AP007287.1| Lotus japonicus genomic DNA, clone:LjT12M13, TM0... 40 8.6
55emb|AL627074.11| Mouse DNA sequence from clone RP23-465A17 on ch... 40 8.6 
>dbj|AK098990.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094L23, full
            insert sequence
          Length = 1429

 Score =  676 bits (341), Expect = 0.0
 Identities = 512/569 (89%)
 Strand = Plus / Plus

                                                                        
Query: 5    ttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaatttg 64
            ||||| ||||||||||||||||||||||| |||||||| ||||| |||||||| ||||||
Sbjct: 555  ttccgcatgaacctcgaccccaagtacaacgaccagcagctccgcgccacggttaatttg 614

                                                                        
Query: 65   cccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagatagat 124
            |||||||||||||| ||| | ||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 615  cccaaggggacgggccagtcggtgaagattgcggtcctcacacaaggtgagaagatagat 674

                                                                        
Query: 125  gaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaataaaa 184
             |||| || |||||||||||||||||||| ||   ||||||| ||||||| |||||||||
Sbjct: 675  caagcaagagctgcaggagctgatattgtcggtggagatgacctgattgaccaaataaaa 734

                                                                        
Query: 185  ggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggttgct 244
            |||||||| ||||| ||||||||  ||||||||||||||||||||||||||||||| || 
Sbjct: 735  ggaggatttatggaatttgacaagctgattgcatcacctgatatgatgcctaaggtcgcc 794

                                                                        
Query: 245  agcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcactgtt 304
             | ||||| |||||||||||||| |||||| | ||||| |||||||||||||| ||||||
Sbjct: 795  ggattgggaaagattctaggaccgagaggacttatgcctaaccccaaagctgggactgtt 854

                                                                        
Query: 305  tctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcagagtt 364
            ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||
Sbjct: 855  tctccaaacataactcaggctatcgaagagttcaagaaaggtaaagttgaatacagagtt 914

                                                                        
Query: 365  gataagacagggattgctcacattccttttggcaaggttaacttccctgaagaagacctt 424
            || ||||||||||||| ||||||||| ||||| |||||| | || |||||||||||||||
Sbjct: 915  gacaagacagggattgttcacattccctttgggaaggttgattttcctgaagaagacctt 974

                                                                        
Query: 425  attgcaaacttcatggctgttgttcgctctattgagaggaacaagccatctggtgcaaaa 484
            |||||||||||||||||||||||||||||| | || |||||||| |||||||||||||| 
Sbjct: 975  attgcaaacttcatggctgttgttcgctctgtcgaaaggaacaaaccatctggtgcaaag 1034

                                                                        
Query: 485  gggatatactggaaaacggcatatgtatgctcatcaatgggaccttcaatcaagctaaac 544
            |||||||||||||||||||||||  |||||||||||||||| |||||||||||| |||||
Sbjct: 1035 gggatatactggaaaacggcatacttatgctcatcaatggggccttcaatcaagttaaac 1094

                                         
Query: 545  ataaaagaaatgctcgactatggcgcaga 573
            || ||||||||||| ||||||||| ||||
Sbjct: 1095 atcaaagaaatgcttgactatggctcaga 1123
to top
>dbj|AK065313.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002O22, full
            insert sequence
          Length = 1455

 Score =  676 bits (341), Expect = 0.0
 Identities = 512/569 (89%)
 Strand = Plus / Plus

                                                                        
Query: 5    ttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaatttg 64
            ||||| ||||||||||||||||||||||| |||||||| ||||| |||||||| ||||||
Sbjct: 564  ttccgcatgaacctcgaccccaagtacaacgaccagcagctccgcgccacggttaatttg 623

                                                                        
Query: 65   cccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagatagat 124
            |||||||||||||| ||| | ||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 624  cccaaggggacgggccagtcggtgaagattgcggtcctcacacaaggtgagaagatagat 683

                                                                        
Query: 125  gaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaataaaa 184
             |||| || |||||||||||||||||||| ||   ||||||| ||||||| |||||||||
Sbjct: 684  caagcaagagctgcaggagctgatattgtcggtggagatgacctgattgaccaaataaaa 743

                                                                        
Query: 185  ggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggttgct 244
            |||||||| ||||| ||||||||  ||||||||||||||||||||||||||||||| || 
Sbjct: 744  ggaggatttatggaatttgacaagctgattgcatcacctgatatgatgcctaaggtcgcc 803

                                                                        
Query: 245  agcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcactgtt 304
             | ||||| |||||||||||||| |||||| | ||||| |||||||||||||| ||||||
Sbjct: 804  ggattgggaaagattctaggaccgagaggacttatgcctaaccccaaagctgggactgtt 863

                                                                        
Query: 305  tctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcagagtt 364
            ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||
Sbjct: 864  tctccaaacataactcaggctatcgaagagttcaagaaaggtaaagttgaatacagagtt 923

                                                                        
Query: 365  gataagacagggattgctcacattccttttggcaaggttaacttccctgaagaagacctt 424
            || ||||||||||||| ||||||||| ||||| |||||| | || |||||||||||||||
Sbjct: 924  gacaagacagggattgttcacattccctttgggaaggttgattttcctgaagaagacctt 983

                                                                        
Query: 425  attgcaaacttcatggctgttgttcgctctattgagaggaacaagccatctggtgcaaaa 484
            |||||||||||||||||||||||||||||| | || |||||||| |||||||||||||| 
Sbjct: 984  attgcaaacttcatggctgttgttcgctctgtcgaaaggaacaaaccatctggtgcaaag 1043

                                                                        
Query: 485  gggatatactggaaaacggcatatgtatgctcatcaatgggaccttcaatcaagctaaac 544
            |||||||||||||||||||||||  |||||||||||||||| |||||||||||| |||||
Sbjct: 1044 gggatatactggaaaacggcatacttatgctcatcaatggggccttcaatcaagttaaac 1103

                                         
Query: 545  ataaaagaaatgctcgactatggcgcaga 573
            || ||||||||||| ||||||||| ||||
Sbjct: 1104 atcaaagaaatgcttgactatggctcaga 1132
to top
>dbj|AK104689.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-F09, full
            insert sequence
          Length = 1415

 Score =  668 bits (337), Expect = 0.0
 Identities = 511/569 (89%)
 Strand = Plus / Plus

                                                                        
Query: 5    ttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaatttg 64
            ||||| ||||||||||||||||||||||| |||||||| ||||| |||||||| ||||||
Sbjct: 560  ttccgcatgaacctcgaccccaagtacaacgaccagcagctccgcgccacggttaatttg 619

                                                                        
Query: 65   cccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagatagat 124
            |||||||||||||| ||| | ||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 620  cccaaggggacgggccagtcggtgaagattgcggtcctcacacaaggtgagaagatagat 679

                                                                        
Query: 125  gaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaataaaa 184
             |||| || |||||||||||||||||||| ||   ||||||| ||||||| |||||||||
Sbjct: 680  caagcaagagctgcaggagctgatattgtcggtggagatgacctgattgaccaaataaaa 739

                                                                        
Query: 185  ggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggttgct 244
            |||||||| ||||| ||||||||  ||||||||||||||||||||||||||||||| || 
Sbjct: 740  ggaggatttatggaatttgacaagctgattgcatcacctgatatgatgcctaaggtcgcc 799

                                                                        
Query: 245  agcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcactgtt 304
             | ||||| |||||||||||||| |||||| | ||||| |||||||||||||| ||||||
Sbjct: 800  ggattgggaaagattctaggaccgagaggacttatgcctaaccccaaagctgggactgtt 859

                                                                        
Query: 305  tctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcagagtt 364
            ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||
Sbjct: 860  tctccaaacataactcaggctatcgaagagttcaagaaaggtaaagttgaatacagagtt 919

                                                                        
Query: 365  gataagacagggattgctcacattccttttggcaaggttaacttccctgaagaagacctt 424
            || ||||||||||||| ||||||||| ||||| |||||| | || |||||||||||||||
Sbjct: 920  gacaagacagggattgttcacattccctttgggaaggttgattttcctgaagaagacctt 979

                                                                        
Query: 425  attgcaaacttcatggctgttgttcgctctattgagaggaacaagccatctggtgcaaaa 484
            |||||||||||||||||||||||||||||| | || |||||||| |||||||||||||| 
Sbjct: 980  attgcaaacttcatggctgttgttcgctctgtcgaaaggaacaaaccatctggtgcaaag 1039

                                                                        
Query: 485  gggatatactggaaaacggcatatgtatgctcatcaatgggaccttcaatcaagctaaac 544
            ||| |||||||||||||||||||  |||||||||||||||| |||||||||||| |||||
Sbjct: 1040 ggggtatactggaaaacggcatacttatgctcatcaatggggccttcaatcaagttaaac 1099

                                         
Query: 545  ataaaagaaatgctcgactatggcgcaga 573
            || ||||||||||| ||||||||| ||||
Sbjct: 1100 atcaaagaaatgcttgactatggctcaga 1128
to top
>gb|AY112340.1| Zea mays CL23674_1 mRNA sequence
          Length = 1344

 Score =  660 bits (333), Expect = 0.0
 Identities = 540/609 (88%)
 Strand = Plus / Minus

                                                                       
Query: 5   ttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaatttg 64
           ||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 856 ttccgcatgaacctcgaccccaagtacaatgaccagcagctccgggccacggtgaatttg 797

                                                                       
Query: 65  cccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagatagat 124
           |||||||| || || ||| | ||||| ||||| |||||||| ||||||||||||||||||
Sbjct: 796 cccaagggaacaggccagtcggtgaagattgcggttctcacacaaggtgagaagatagat 737

                                                                       
Query: 125 gaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaataaaa 184
           ||||| || ||||||||||||||||| || ||   ||| || ||||||||||||||||||
Sbjct: 736 gaagctagagctgcaggagctgatatcgtaggtggagaagatttgattgaacaaataaaa 677

                                                                       
Query: 185 ggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggttgct 244
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 676 ggaggatttatggagtttgacaaattgattgcatcacctgatatgatgcctaaggttgcg 617

                                                                       
Query: 245 agcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcactgtt 304
            |||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||
Sbjct: 616 ggcttaggtaagattctaggaccaagaggactgatgcctaaccccaaagctggcactgtt 557

                                                                       
Query: 305 tctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcagagtt 364
           ||| |||| |||||||||||||| || |||||||||||||| || ||||||| |||||||
Sbjct: 556 tcttcaaatattactcaggctatagaagagttcaagaaagggaaggttgaatacagagtt 497

                                                                       
Query: 365 gataagacagggattgctcacattccttttggcaaggttaacttccctgaagaagacctt 424
           |||||  |||| ||||  || ||||| |||||||||||| |||| || || ||||| || 
Sbjct: 496 gataaatcaggaattgtccatattccctttggcaaggttgactttccagaggaagatctc 437

                                                                       
Query: 425 attgcaaacttcatggctgttgttcgctctattgagaggaacaagccatctggtgcaaaa 484
           ||||||||||||||| ||||||||||||||  |||||||||||||||||||||||| || 
Sbjct: 436 attgcaaacttcatgtctgttgttcgctctgctgagaggaacaagccatctggtgctaag 377

                                                                       
Query: 485 gggatatactggaaaacggcatatgtatgctcatcaatgggaccttcaatcaagctaaac 544
           |||||||||||||||||||| ||  | |||||||| ||||||||||| ||||||||||||
Sbjct: 376 gggatatactggaaaacggcgtacttgtgctcatccatgggaccttctatcaagctaaac 317

                                                                       
Query: 545 ataaaagaaatgctcgactatggcgcagattcgtctaactagatgtcaccacgagcacca 604
           |||||||||||||| ||||||||    || || ||| ||||||||| |||||  ||||||
Sbjct: 316 ataaaagaaatgcttgactatggtttggaatcatctgactagatgtgaccacaggcacca 257

                    
Query: 605 attaagtca 613
            ||||||||
Sbjct: 256 gttaagtca 248
to top
>gb|AC136219.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0073E05,
              complete sequence
          Length = 178013

 Score =  186 bits (94), Expect = 6e-44
 Identities = 121/130 (93%)
 Strand = Plus / Plus

                                                                          
Query: 319    tcaggctatcgatgagttcaagaaaggtaaagttgaattcagagttgataagacagggat 378
              |||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 121853 tcaggctatcgaagagttcaagaaaggtaaagttgaatacagagttgacaagacagggat 121912

                                                                          
Query: 379    tgctcacattccttttggcaaggttaacttccctgaagaagaccttattgcaaacttcat 438
              || ||||||||| ||||| |||||| | || |||||||||||||||||||||||||||||
Sbjct: 121913 tgttcacattccctttgggaaggttgattttcctgaagaagaccttattgcaaacttcat 121972

                        
Query: 439    ggctgttgtt 448
              ||||||||||
Sbjct: 121973 ggctgttgtt 121982



 Score =  159 bits (80), Expect = 1e-35
 Identities = 119/132 (90%)
 Strand = Plus / Plus

                                                                          
Query: 109    aggtgagaagatagatgaagcgagggctgcaggagctgatattgttggctcagatgactt 168
              |||||||||||||||| |||| || |||||||||||||||||||| ||   ||||||| |
Sbjct: 119658 aggtgagaagatagatcaagcaagagctgcaggagctgatattgtcggtggagatgacct 119717

                                                                          
Query: 169    gattgaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgatat 228
              |||||| ||||||||||||||||| ||||| ||||||||  |||||||||||||||||||
Sbjct: 119718 gattgaccaaataaaaggaggatttatggaatttgacaagctgattgcatcacctgatat 119777

                          
Query: 229    gatgcctaaggt 240
              ||||||||||||
Sbjct: 119778 gatgcctaaggt 119789



 Score =  153 bits (77), Expect = 8e-34
 Identities = 104/113 (92%)
 Strand = Plus / Plus

                                                                          
Query: 461    aggaacaagccatctggtgcaaaagggatatactggaaaacggcatatgtatgctcatca 520
              |||||||| |||||||||||||| |||||||||||||||||||||||  |||||||||||
Sbjct: 122076 aggaacaaaccatctggtgcaaaggggatatactggaaaacggcatacttatgctcatca 122135

                                                                   
Query: 521    atgggaccttcaatcaagctaaacataaaagaaatgctcgactatggcgcaga 573
              ||||| |||||||||||| ||||||| ||||||||||| ||||||||| ||||
Sbjct: 122136 atggggccttcaatcaagttaaacatcaaagaaatgcttgactatggctcaga 122188



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                          
Query: 248    ttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcactgtttct 307
              ||||| |||||||||||||| |||||| | ||||| |||||||||||||| |||||||||
Sbjct: 120258 ttgggaaagattctaggaccgagaggacttatgcctaaccccaaagctgggactgtttct 120317

                              
Query: 308    ccaaacattactcagg 323
              |||||||| |||||||
Sbjct: 120318 ccaaacataactcagg 120333



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                   
Query: 5      ttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggt 57
              ||||| ||||||||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 119178 ttccgcatgaacctcgaccccaagtacaacgaccagcagctccgcgccacggt 119230



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                     
Query: 59     aatttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtg 113
              |||||||||||||||||||| ||| | ||||| ||||| || ||||| |||||||
Sbjct: 119342 aatttgcccaaggggacgggccagtcggtgaagattgcggtcctcacacaaggtg 119396
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  186 bits (94), Expect = 6e-44
 Identities = 121/130 (93%)
 Strand = Plus / Plus

                                                                            
Query: 319      tcaggctatcgatgagttcaagaaaggtaaagttgaattcagagttgataagacagggat 378
                |||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 18648738 tcaggctatcgaagagttcaagaaaggtaaagttgaatacagagttgacaagacagggat 18648797

                                                                            
Query: 379      tgctcacattccttttggcaaggttaacttccctgaagaagaccttattgcaaacttcat 438
                || ||||||||| ||||| |||||| | || |||||||||||||||||||||||||||||
Sbjct: 18648798 tgttcacattccctttgggaaggttgattttcctgaagaagaccttattgcaaacttcat 18648857

                          
Query: 439      ggctgttgtt 448
                ||||||||||
Sbjct: 18648858 ggctgttgtt 18648867



 Score =  159 bits (80), Expect = 1e-35
 Identities = 119/132 (90%)
 Strand = Plus / Plus

                                                                            
Query: 109      aggtgagaagatagatgaagcgagggctgcaggagctgatattgttggctcagatgactt 168
                |||||||||||||||| |||| || |||||||||||||||||||| ||   ||||||| |
Sbjct: 18646543 aggtgagaagatagatcaagcaagagctgcaggagctgatattgtcggtggagatgacct 18646602

                                                                            
Query: 169      gattgaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgatat 228
                |||||| ||||||||||||||||| ||||| ||||||||  |||||||||||||||||||
Sbjct: 18646603 gattgaccaaataaaaggaggatttatggaatttgacaagctgattgcatcacctgatat 18646662

                            
Query: 229      gatgcctaaggt 240
                ||||||||||||
Sbjct: 18646663 gatgcctaaggt 18646674



 Score =  153 bits (77), Expect = 8e-34
 Identities = 104/113 (92%)
 Strand = Plus / Plus

                                                                            
Query: 461      aggaacaagccatctggtgcaaaagggatatactggaaaacggcatatgtatgctcatca 520
                |||||||| |||||||||||||| |||||||||||||||||||||||  |||||||||||
Sbjct: 18648961 aggaacaaaccatctggtgcaaaggggatatactggaaaacggcatacttatgctcatca 18649020

                                                                     
Query: 521      atgggaccttcaatcaagctaaacataaaagaaatgctcgactatggcgcaga 573
                ||||| |||||||||||| ||||||| ||||||||||| ||||||||| ||||
Sbjct: 18649021 atggggccttcaatcaagttaaacatcaaagaaatgcttgactatggctcaga 18649073



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Plus

                                                                            
Query: 248      ttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcactgtttct 307
                ||||| |||||||||||||| |||||| | ||||| |||||||||||||| |||||||||
Sbjct: 18647143 ttgggaaagattctaggaccgagaggacttatgcctaaccccaaagctgggactgtttct 18647202

                                
Query: 308      ccaaacattactcagg 323
                |||||||| |||||||
Sbjct: 18647203 ccaaacataactcagg 18647218



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                     
Query: 5        ttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggt 57
                ||||| ||||||||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 18646063 ttccgcatgaacctcgaccccaagtacaacgaccagcagctccgcgccacggt 18646115



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                       
Query: 59       aatttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtg 113
                |||||||||||||||||||| ||| | ||||| ||||| || ||||| |||||||
Sbjct: 18646227 aatttgcccaaggggacgggccagtcggtgaagattgcggtcctcacacaaggtg 18646281
to top
>emb|X82776.1|PSRP11 P.sativum mRNA for ribosomal protein L1
          Length = 626

 Score =  127 bits (64), Expect = 5e-26
 Identities = 118/136 (86%)
 Strand = Plus / Plus

                                                                       
Query: 168 tgattgaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgata 227
           |||| ||||| |||||||||||||||||||| ||||| ||||| ||||| || || ||||
Sbjct: 457 tgatagaacagataaaaggaggattcatggaatttgataaattaattgcttctccagata 516

                                                                       
Query: 228 tgatgcctaaggttgctagcttgggtaagattctaggaccaagaggattgatgcccaacc 287
           |||||||||||||||||||| | || |||||||| || ||||||||| | ||||| || |
Sbjct: 517 tgatgcctaaggttgctagcctaggaaagattctggggccaagaggactcatgccaaatc 576

                           
Query: 288 ccaaagctggcactgt 303
           | ||||||||||||||
Sbjct: 577 ctaaagctggcactgt 592
to top
>emb|BX823482.1|CNS0A5GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS42ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1316

 Score =  127 bits (64), Expect = 5e-26
 Identities = 319/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 507 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 566

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 567 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 626

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 627 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 686

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 687 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 746

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| ||||||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 747 gctggcttgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 806

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 807 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 866

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 867 gcagacaaaactgggattgttcacattccatttgggaaagttaa 910
to top
>ref|NM_116214.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT3G63490 transcript variant AT3G63490.1 mRNA,
           complete cds
          Length = 1920

 Score =  119 bits (60), Expect = 1e-23
 Identities = 318/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 511 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 570

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 571 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 630

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 631 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 690

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 691 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 750

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| || |||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 751 gctggcctgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 810

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 811 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 870

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 871 gcagacaaaactgggattgttcacattccatttgggaaagttaa 914
to top
>gb|AY133519.1| Arabidopsis thaliana At3g63490/MAA21_120 mRNA, complete cds
          Length = 1041

 Score =  119 bits (60), Expect = 1e-23
 Identities = 318/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 457 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 516

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 517 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 576

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 577 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 636

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 637 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 696

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| || |||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 697 gctggcctgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 756

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 757 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 816

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 817 gcagacaaaactgggattgttcacattccatttgggaaagttaa 860
to top
>gb|AY059929.1| Arabidopsis thaliana chloroplast ribosomal L1-like protein
           (At3g63490; MAA21_120) mRNA, complete cds
          Length = 1341

 Score =  119 bits (60), Expect = 1e-23
 Identities = 318/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 510 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 569

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 570 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 629

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 630 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 689

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 690 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 749

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| || |||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 750 gctggcctgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 809

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 810 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 869

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 870 gcagacaaaactgggattgttcacattccatttgggaaagttaa 913
to top
>gb|AY053410.1| Arabidopsis thaliana AT3g63490/MAA21_120 mRNA, complete cds
          Length = 1340

 Score =  119 bits (60), Expect = 1e-23
 Identities = 318/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 511 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 570

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 571 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 630

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 631 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 690

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 691 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 750

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| || |||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 751 gctggcctgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 810

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 811 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 870

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 871 gcagacaaaactgggattgttcacattccatttgggaaagttaa 914
to top
>emb|BX842134.1|CNS09YB5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS47ZA05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1277

 Score =  119 bits (60), Expect = 1e-23
 Identities = 318/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 480 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 539

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 540 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 599

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 600 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 659

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 660 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 719

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| || |||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 720 gctggcctgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 779

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 780 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 839

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 840 gcagacaaaactgggattgttcacattccatttgggaaagttaa 883
to top
>gb|BT001191.1| Arabidopsis thaliana chloroplast ribosomal L1-like protein
           (At3g63490) mRNA, complete cds
          Length = 1252

 Score =  119 bits (60), Expect = 1e-23
 Identities = 318/404 (78%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 457 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 516

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 517 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 576

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 577 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 636

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 637 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 696

                                                                       
Query: 242 gctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaagctggcact 301
           ||| || |||| |||||||| |||||| | ||  | ||||| || ||||| ||||| || 
Sbjct: 697 gctggcctgggaaagattcttggaccacgggggctcatgccaaatcccaaggctggtaca 756

                                                                       
Query: 302 gtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagttgaattcaga 361
           ||  |  | |||||| | |||||||| || ||||||||||| || |||||||||||||||
Sbjct: 757 gtcacagcgaacattccccaggctattgaagagttcaagaaggggaaagttgaattcaga 816

                                                       
Query: 362 gttgataagacagggattgctcacattccttttggcaaggttaa 405
           |  || || || ||||||| ||||||||| ||||| || |||||
Sbjct: 817 gcagacaaaactgggattgttcacattccatttgggaaagttaa 860
to top
>gb|DQ226667.1| Boechera divaricarpa isolate SLW-6-B05 mRNA sequence
          Length = 270

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 106/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 gaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatg 232
           |||||||| |||||||| ||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 145 gaacaaattaaaggaggtttcatggagtttgacaagttgattgcatccccagatatgatg 204

                                                                       
Query: 233 cctaaggttgctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaa 292
              ||||||||| || |||| |||||||| || ||| | ||| | ||||| |||||||| 
Sbjct: 205 gtcaaggttgctggcctgggaaagattctcggcccacggggactcatgccaaaccccaag 264

                
Query: 293 gctgg 297
           |||||
Sbjct: 265 gctgg 269
to top
>ref|NM_202757.1| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT3G63490 transcript variant AT3G63490.2 mRNA,
           complete cds
          Length = 1910

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 211/267 (79%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 511 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 570

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 571 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 630

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 631 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 690

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  |||||||||| || |||||||||   ||||||
Sbjct: 691 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatggtcaaggtt 750

                                      
Query: 242 gctagcttgggtaagattctaggacca 268
           ||| || |||| |||||||| ||||||
Sbjct: 751 gctggcctgggaaagattcttggacca 777



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 332 gagttcaagaaaggtaaagttgaattcagagttgataagacagggattgctcacattcct 391
           ||||||||||| || ||||||||||||||||  || || || ||||||| ||||||||| 
Sbjct: 831 gagttcaagaaggggaaagttgaattcagagcagacaaaactgggattgttcacattcca 890

                         
Query: 392 tttggcaaggttaa 405
           ||||| || |||||
Sbjct: 891 tttgggaaagttaa 904
to top
>emb|X90855.1|ATRPL1GEN A.thaliana rpl1 gene
          Length = 2413

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                        
Query: 318  ctcaggctatcgatgagttcaagaaaggtaaagttgaattcagagttgataagacaggga 377
            |||||||||| || ||||||||||| || ||||||||||||||||  || || || ||||
Sbjct: 1802 ctcaggctattgaagagttcaagaaggggaaagttgaattcagagcagacaaaactggga 1861

                                        
Query: 378  ttgctcacattccttttggcaaggttaa 405
            ||| ||||||||| ||||| || |||||
Sbjct: 1862 ttgttcacattccatttgggaaagttaa 1889



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 182  aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatg 232
            |||||||| |||||||||||||||||  |||||||||| || |||||||||
Sbjct: 1470 aaaggaggcttcatggagtttgacaagctgattgcatccccggatatgatg 1520



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagca 42
           ||||||||| | ||| |||| || |||||||||||||||||
Sbjct: 937 catttccgtctcaacatcgatcctaagtacaatgaccagca 977
to top
>emb|AL163818.1|ATMAA21 Arabidopsis thaliana DNA chromosome 3, P1 clone MAA21 (ESSA project)
          Length = 79153

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                         
Query: 318   ctcaggctatcgatgagttcaagaaaggtaaagttgaattcagagttgataagacaggga 377
             |||||||||| || ||||||||||| || ||||||||||||||||  || || || ||||
Sbjct: 67964 ctcaggctattgaagagttcaagaaggggaaagttgaattcagagcagacaaaactggga 68023

                                         
Query: 378   ttgctcacattccttttggcaaggttaa 405
             ||| ||||||||| ||||| || |||||
Sbjct: 68024 ttgttcacattccatttgggaaagttaa 68051



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                         
Query: 136   tgcaggagctgatattgttggctcagatgacttgattgaacaaataaaaggaggattcat 195
             |||||| || |||||||| |||   ||||| || || ||||| || |||||||| |||||
Sbjct: 67586 tgcaggggcagatattgtgggcagtgatgatttaatcgaacagattaaaggaggcttcat 67645

                                                  
Query: 196   ggagtttgacaaattgattgcatcacctgatatgatg 232
             ||||||||||||  |||||||||| || |||||||||
Sbjct: 67646 ggagtttgacaagctgattgcatccccggatatgatg 67682



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 2     catttccgtatgaacctcgaccccaagtacaatgaccagca 42
             ||||||||| | ||| |||| || |||||||||||||||||
Sbjct: 67099 catttccgtctcaacatcgatcctaagtacaatgaccagca 67139
to top
>emb|X76932.1|SORPL1 S.oleracea mRNA for ribosomal protein L1
          Length = 1426

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatg 232
           ||||||||||| || ||||||||||| ||||| || ||||||||| || |||| ||||||
Sbjct: 700 gaacaaataaaggggggattcatggactttgataagttgattgcaacatctgacatgatg 759

                      
Query: 233 cctaaggttgc 243
            ||||||||||
Sbjct: 760 gctaaggttgc 770



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 318 ctcaggctatcgatgagttcaagaaaggtaaagttgaattcagagttgataagacaggga 377
           |||||||| | || || ||||||||||| || || || || ||||||||||| ||||| |
Sbjct: 845 ctcaggctgtggaggaattcaagaaaggcaaggtcgagtttagagttgataaaacaggaa 904

                                           
Query: 378 ttgctcacattccttttggcaaggttaacttc 409
           ||| ||||||||| ||||| ||| | ||||||
Sbjct: 905 ttgttcacattccctttggaaagttgaacttc 936
to top
>emb|BX823842.1|CNS0A5C2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS81ZG01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1188

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 210/267 (78%), Gaps = 1/267 (0%)
 Strand = Plus / Plus

                                                                       
Query: 2   catttccgtatgaacctcgaccccaagtacaatgaccagcaactccgggccacggtcaat 61
           ||||||||| | ||| |||| || ||||||||||||||||| || || || ||||| |  
Sbjct: 474 catttccgtctcaacatcgatcctaagtacaatgaccagcagctgcgtgcaacggtgagc 533

                                                                       
Query: 62  ttgcccaaggggacggggcagaccgtgaaaattgcagttctcacccaaggtgagaagata 121
            |||| ||||| || || ||||| || | | | || |||||  | |||||||||||| | 
Sbjct: 534 ctgcctaagggaactggccagactgttatagtcgctgttcttgcacaaggtgagaaggtt 593

                                                                       
Query: 122 gatgaagcgagggctgcaggagctgatattgttggctcagatgacttgattgaacaaata 181
           |||||||| |    |||||| || |||||||| |||   ||||| || || ||||| || 
Sbjct: 594 gatgaagccaaaagtgcaggggcagatattgtgggcagtgatgatttaatcgaacagatt 653

                                                                       
Query: 182 aaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatgcctaaggtt 241
           |||||||| |||||||||||||||||  | |||||||| || |||||||||   ||||||
Sbjct: 654 aaaggaggcttcatggagtttgacaagct-attgcatccccggatatgatggtcaaggtt 712

                                      
Query: 242 gctagcttgggtaagattctaggacca 268
           ||| || |||| |||||||| ||||||
Sbjct: 713 gctggcctgggaaagattcttggacca 739



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 332 gagttcaagaaaggtaaagttgaattcagag 362
           ||||||||||| || ||||||||||||||||
Sbjct: 793 gagttcaagaaggggaaagttgaattcagag 823
to top
>emb|BX824263.1|CNS0A5MH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZG12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1351

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 176/224 (78%)
 Strand = Plus / Plus

                                                                       
Query: 173 gaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatg 232
           ||||| || |||||||| |||||||||||| |||   | |||||||| || ||||| |||
Sbjct: 735 gaacagattaaaggaggcttcatggagtttcacacgctcattgcatccccggatatcatg 794

                                                                       
Query: 233 cctaaggttgctagcttgggtaagattctaggaccaagaggattgatgcccaaccccaaa 292
              ||||| ||| || |||| |||||||| |||||| | || || ||||| || ||||| 
Sbjct: 795 gtcaaggtcgctggcctgggaaagattcttggaccacgggggttcatgccaaatcccaac 854

                                                                       
Query: 293 gctggcactgtttctccaaacattactcaggctatcgatgagttcaagaaaggtaaagtt 352
           ||||| || ||  |  |  ||||| | |||||||| || ||||||||||| || ||||||
Sbjct: 855 gctggtacagtcaccgcgcacattccccaggctattgaagagttcaagaaggggaaagtt 914

                                                       
Query: 353 gaattcagagttgataagacagggattgctcacattccttttgg 396
           |||||||| |  || || || ||||||| ||||||||| |||||
Sbjct: 915 gaattcagcgcagacaacactgggattgttcacattccatttgg 958
to top
>emb|BX823424.1|CNS0A5EN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZB03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1341

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 gaacaaataaaaggaggattcatggagtttgacaaattgattgcatcacctgatatgatg 232
           ||||| || |||||||| |||||||||||||||||  ||||||| ||  | |||||||||
Sbjct: 652 gaacagattaaaggaggcttcatggagtttgacaagctgattgcgtccgcggatatgatg 711

                                               
Query: 233 cctaaggttgctagcttgggtaagattctaggacca 268
              ||||||||| || |||| |||||||| ||||||
Sbjct: 712 gtcaaggttgctggcgtgggaaagattcttggacca 747
to top
>dbj|AP006715.1| Porphyra yezoensis chloroplast DNA, complete genome
          Length = 191952

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 455    attgagaggaacaagccatctggtgcaaaagggatatactggaaaac 501
              ||||| || |||||||| ||||| ||||||||||  |||||||||||
Sbjct: 130366 attgatagaaacaagccttctggagcaaaagggaagtactggaaaac 130412



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 344    ggtaaagttgaattcagagttgata 368
              ||||||||||||| |||||||||||
Sbjct: 130255 ggtaaagttgaatacagagttgata 130279
to top
>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 253    taagattctaggaccaagaggattgatgcc 282
              ||||||| |||||||||||||||| |||||
Sbjct: 266204 taagattttaggaccaagaggattaatgcc 266233
to top
>emb|CR925677.1| Ehrlichia ruminantium str. Gardel, complete genome
          Length = 1499920

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 253    taagattctaggaccaagaggattgatgcc 282
              ||||||| |||||||||||||||| |||||
Sbjct: 263326 taagattttaggaccaagaggattaatgcc 263355
to top
>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 253    taagattctaggaccaagaggattgatgcc 282
              ||||||| |||||||||||||||| |||||
Sbjct: 285960 taagattttaggaccaagaggattaatgcc 285989
to top
>ref|XM_638063.1| Dictyostelium discoideum hypothetical protein (DDB0167089), partial
           mRNA
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 335 ttcaagaaaggtaaagttgaa 355
           |||||||||||||||||||||
Sbjct: 145 ttcaagaaaggtaaagttgaa 165
to top
>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 395     ggcaaggttaacttccctgaa 415
               |||||||||||||||||||||
Sbjct: 1128955 ggcaaggttaacttccctgaa 1128935
to top
>emb|CR955034.5| Wallaby DNA sequence from clone GRWB-130P10, complete sequence
          Length = 176287

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 341    aaaggtaaagttgaattcaga 361
              |||||||||||||||||||||
Sbjct: 107698 aaaggtaaagttgaattcaga 107718
to top
>emb|AL136966.27| Human DNA sequence from clone RP11-96M12 on chromosome 13 Contains part
             of a novel gene, complete sequence
          Length = 112884

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 292   agctggcactgtttctccaaa 312
             |||||||||||||||||||||
Sbjct: 25000 agctggcactgtttctccaaa 25020
to top
>emb|Z11839.1|TMNUSGGE T.maritima nusG gene and genes for ribosomal proteins
          Length = 5788

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 254  aagattctaggaccaagaggattgatgcc 282
            |||||||| ||||||||||| ||||||||
Sbjct: 2989 aagattctgggaccaagaggtttgatgcc 3017
to top
>gb|DQ118629.1| Pavlova lutheri isolate 487 chloroplast 50S ribosomal protein L1
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 638

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 18  tcgaccccaagtacaatgaccagca 42
           |||||||||||||||| ||||||||
Sbjct: 286 tcgaccccaagtacaacgaccagca 310
to top
>gb|AC139854.21| Medicago truncatula clone mth2-16e16, complete sequence
          Length = 117864

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 538    gctaaacataaaagaaatgct 558
              |||||||||||||||||||||
Sbjct: 114898 gctaaacataaaagaaatgct 114918
to top
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                            
Query: 247     cttgggtaagattctaggaccaagaggattgatgcccaaccccaa 291
               ||||||| ||||||| || ||| | ||||||||||| ||||||||
Sbjct: 4007455 cttgggtcagattctcggtccacgcggattgatgcctaaccccaa 4007411
to top
>gb|AC150442.2| Medicago truncatula chromosome 7 BAC clone mth2-2o12, complete sequence
          Length = 89504

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 538   gctaaacataaaagaaatgct 558
             |||||||||||||||||||||
Sbjct: 14659 gctaaacataaaagaaatgct 14679
to top
>gb|AC147583.3| Otolemur garnettii clone CH256-410D4, complete sequence
          Length = 144487

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 395   ggcaaggttaacttccctgaa 415
             |||||||||||||||||||||
Sbjct: 92140 ggcaaggttaacttccctgaa 92120
to top
>gb|AC114263.2| Dictyostelium discoideum chromosome 2 map 215673-367476 strain AX4,
              complete sequence
          Length = 151802

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 335    ttcaagaaaggtaaagttgaa 355
              |||||||||||||||||||||
Sbjct: 120861 ttcaagaaaggtaaagttgaa 120841
to top
>gb|AC146357.3| Otolemur garnettii clone CH256-396G19, complete sequence
          Length = 181866

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 395   ggcaaggttaacttccctgaa 415
             |||||||||||||||||||||
Sbjct: 22904 ggcaaggttaacttccctgaa 22884
to top
>gb|AE000512.1| Thermotoga maritima MSB8, complete genome
          Length = 1860725

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 254    aagattctaggaccaagaggattgatgcc 282
              |||||||| ||||||||||| ||||||||
Sbjct: 476806 aagattctgggaccaagaggtttgatgcc 476834
to top
>gb|AC102139.5| Mus musculus chromosome 15, clone RP23-286F21, complete sequence
          Length = 152946

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 336   tcaagaaaggtaaagttgaat 356
             |||||||||||||||||||||
Sbjct: 76218 tcaagaaaggtaaagttgaat 76198
to top
>ref|XM_426195.1| PREDICTED: Gallus gallus similar to DEAD (Asp-Glu-Ala-Asp) box
            polypeptide 43; DEAD-box protein 43 (LOC428637), mRNA
          Length = 1404

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 320  caggctatcgatgagttcaagaaaggtaaagt 351
            |||||| | ||||| |||||||||||||||||
Sbjct: 1237 caggctttagatgacttcaagaaaggtaaagt 1268
to top
>ref|XM_747725.1| Aspergillus fumigatus Af293 aminotransferase (Afu1g14490) partial
           mRNA
          Length = 1341

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tgctcatcaatgggaccttc 531
           ||||||||||||||||||||
Sbjct: 932 tgctcatcaatgggaccttc 951
to top
>gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, complete sequence
          Length = 224790

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   attgaacaaataaaaggagg 189
             ||||||||||||||||||||
Sbjct: 17575 attgaacaaataaaaggagg 17556
to top
>gb|AC144431.11| Medicago truncatula clone mth2-21i14, complete sequence
          Length = 154482

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 536  aagctaaacataaaagaaat 555
            ||||||||||||||||||||
Sbjct: 9627 aagctaaacataaaagaaat 9608
to top
>gb|AC149305.19| Medicago truncatula clone mth2-78k4, complete sequence
          Length = 118017

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 426    ttgcaaacttcatggctgtt 445
              ||||||||||||||||||||
Sbjct: 106216 ttgcaaacttcatggctgtt 106197
to top
>emb|AL513364.10| Human DNA sequence from clone RP11-480N10 on chromosome 1, complete
             sequence
          Length = 74951

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 402   ttaacttccctgaagaagacctta 425
             |||| |||||||||||||||||||
Sbjct: 37304 ttaatttccctgaagaagacctta 37281
to top
>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 512    tgctcatcaatgggaccttc 531
              ||||||||||||||||||||
Sbjct: 219557 tgctcatcaatgggaccttc 219538
to top
>dbj|AK046358.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230374P19
            product:unclassifiable, full insert sequence
          Length = 1246

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  cactgtttctccaaacatta 317
            ||||||||||||||||||||
Sbjct: 1042 cactgtttctccaaacatta 1023
to top
>dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome
          Length = 1738505

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 234     ctaaggttgctagcttgggt 253
               ||||||||||||||||||||
Sbjct: 1212220 ctaaggttgctagcttgggt 1212201
to top
>gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete sequence
          Length = 1332022

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 288    ccaaagctggcactgtttctccaa 311
              |||| |||||||||||||||||||
Sbjct: 957591 ccaatgctggcactgtttctccaa 957568
to top
>emb|CR955007.2| Medicago truncatula chromosome 5 clone mte1-58b20, COMPLETE SEQUENCE
          Length = 108616

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 536   aagctaaacataaaagaaat 555
             ||||||||||||||||||||
Sbjct: 99557 aagctaaacataaaagaaat 99538
to top
>gb|AC139316.4| Mus musculus BAC clone RP24-500I24 from 3, complete sequence
          Length = 187000

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 298   cactgtttctccaaacatta 317
             ||||||||||||||||||||
Sbjct: 53450 cactgtttctccaaacatta 53469
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 408     tccctgaagaagaccttatt 427
               ||||||||||||||||||||
Sbjct: 3164942 tccctgaagaagaccttatt 3164961
to top
>dbj|AP007287.1| Lotus japonicus genomic DNA, clone:LjT12M13, TM0054b, complete
           sequence
          Length = 77961

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 125 gaagcgagggctgcaggagctgatattgttgg 156
           ||||| || ||||||||||||||||| |||||
Sbjct: 519 gaagctagagctgcaggagctgatatagttgg 550
to top
>emb|AL627074.11| Mouse DNA sequence from clone RP23-465A17 on chromosome 3, complete
              sequence
          Length = 177133

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    attgaacaaataaaaggagg 189
              ||||||||||||||||||||
Sbjct: 155046 attgaacaaataaaaggagg 155027


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,458,757
Number of Sequences: 3902068
Number of extensions: 5458757
Number of successful extensions: 98808
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98525
Number of HSP's gapped (non-prelim): 273
length of query: 628
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 605
effective length of database: 17,143,297,704
effective search space: 10371695110920
effective search space used: 10371695110920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top