>emb|AL159171.15| Human DNA sequence from clone RP11-280G19 on chromosome 10 Contains a
             novel pseudogene (HSPC031) and a thyroid autoantigen 70kDa
             (Ku antigen)(G22P1) pseudogene, complete sequence
          Length = 168145

 Score = 42.1 bits (21), Expect = 0.64
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 13    tgttctgttgcccagcttgga 33
             |||||||||||||||||||||
Sbjct: 18271 tgttctgttgcccagcttgga 18291

>emb|AL772363.15| Human DNA sequence from clone RP11-974F22 on chromosome 9 Contains the
             5' end of the CACNA1B gene for alpha 1B subunit of L type
             voltage-dependent calcium channel and two CpG islands,
             complete sequence
          Length = 121478

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    cacgaggaccgttcctctcc 67
             ||||||||||||||||||||
Sbjct: 45151 cacgaggaccgttcctctcc 45132

>emb|AL139424.21| Human DNA sequence from clone RP4-736L20 on chromosome 1p36.12-36.23
             Contains the 3' end of the KIF1B gene for kinesin family
             member 1B (KIAA0591), the PGD gene for phosphogluconate
             dehydrogenase, the 5' end of the CORT gene for cortistatin
             (LOC374945) and two CpG islands, complete sequence
          Length = 86720

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    gttctgttgcccagcttgga 33
             ||||||||||||||||||||
Sbjct: 47993 gttctgttgcccagcttgga 47974

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 9       ccggtgttctgttgcccagcttgg 32
               ||||||||||||||||| ||||||
Sbjct: 1710604 ccggtgttctgttgccctgcttgg 1710581

>gb|BC105835.1| Rattus norvegicus cDNA clone IMAGE:7453109
          Length = 1805

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 154 acaaaatcacaaggaactt 172
           |||||||||||||||||||
Sbjct: 151 acaaaatcacaaggaactt 169

>gb|AC144383.2| Pan troglodytes BAC clone CH251-321N7 from X, complete sequence
          Length = 149315

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     tgttctgttgcccagcttg 31
              |||||||||||||||||||
Sbjct: 131615 tgttctgttgcccagcttg 131633



 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    tgttctgttgcccagcttg 31
             |||||||||||||||||||
Sbjct: 16752 tgttctgttgcccagcttg 16734

>gb|AC146267.3| Pan troglodytes BAC clone CH251-55N11 from X, complete sequence
          Length = 172439

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    tgttctgttgcccagcttg 31
             |||||||||||||||||||
Sbjct: 51170 tgttctgttgcccagcttg 51188

>gb|AC149631.3| Rhinolophus ferrumequinum clone VMRC7-80B12, complete sequence
          Length = 142320

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 154   acaaaatcacaaggaactt 172
             |||||||||||||||||||
Sbjct: 40705 acaaaatcacaaggaactt 40687

>emb|AL390059.10| Human DNA sequence from clone RP11-399E10 on chromosome 4, complete
              sequence
          Length = 200379

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     ttctgttgcccagcttgga 33
              |||||||||||||||||||
Sbjct: 119661 ttctgttgcccagcttgga 119643

>emb|AL732314.18| Human DNA sequence from clone RP13-465B17 on chromosome X Contains the
             5' end of the gene for protein phosphatase 2A 48 kDa
             regulatory subunit (PR48), a fatty acid binding protein 5
             (psoriasis-associated) (FABP5) pseudogene, a pseudogene
             similar to part of keratin 18 (KRT18) and nine CpG
             islands, complete sequence
          Length = 218723

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    ttctgttgcccagcttgga 33
             |||||||||||||||||||
Sbjct: 22627 ttctgttgcccagcttgga 22645

>emb|AL590325.10| Human DNA sequence from clone RP11-85L21 on chromosome Xq25-26.3
             Contains a nucleolin (NCL) pseudogene, a zinc finger
             family pseudogene, three novel genes, the 3' end of a
             novel gene and a CpG island, complete sequence
          Length = 84879

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    tgttctgttgcccagcttg 31
             |||||||||||||||||||
Sbjct: 61770 tgttctgttgcccagcttg 61752

>emb|AL356414.11| Human DNA sequence from clone RP11-352D3 on chromosome 20 Contains the
             RPL21P2 gene for ribosomal protein L21 pseudogene 2 and a
             novel gene, complete sequence
          Length = 72540

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    tctgttgcccagcttggat 34
             |||||||||||||||||||
Sbjct: 67370 tctgttgcccagcttggat 67388

>emb|AL157819.15| Human DNA sequence from clone RP11-480G1 on chromosome 13q13.1-14.3
              Contains a novel gene, complete sequence
          Length = 110911

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     tgcccagcttggatccttc 39
              |||||||||||||||||||
Sbjct: 110146 tgcccagcttggatccttc 110128

>emb|AL139421.12| Human DNA sequence from clone RP4-717I23 on chromosome 1p21.2-22.3
             Contains the 3' end of the NY-SAR-41 gene for sarcoma
             antigen NY-SAR-41, a ribosomal protein L39 (RPL39)
             pseudogene and the 3' end of a novel gene, complete
             sequence
          Length = 82367

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    tgttctgttgcccagcttg 31
             |||||||||||||||||||
Sbjct: 68300 tgttctgttgcccagcttg 68282

>emb|AL662868.15| Mouse DNA sequence from clone RP23-144P24 on chromosome 11 Contains
             three novel genes, the 5' end of the Galnt9 gene for
             UDP-N-acetyl-alpha-D-galactosamine: polypeptide
             N-acetylgalactosaminyltransferase 9 and a CpG island,
             complete sequence
          Length = 198647

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 152   gaacaaaatcacaaggaac 170
             |||||||||||||||||||
Sbjct: 52059 gaacaaaatcacaaggaac 52041

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 147   ttcttgaacaaaatcacaaggaa 169
             |||||||||||| ||||||||||
Sbjct: 13861 ttcttgaacaaattcacaaggaa 13839

>gb|AC096970.2| Homo sapiens chromosome 3 clone RP11-321A23, complete sequence
          Length = 171297

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     tctgttgcccagcttggat 34
              |||||||||||||||||||
Sbjct: 154786 tctgttgcccagcttggat 154768

>gb|AC097714.3| Homo sapiens BAC clone RP11-324H7 from 4, complete sequence
          Length = 181756

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     ttctgttgcccagcttgga 33
              |||||||||||||||||||
Sbjct: 114695 ttctgttgcccagcttgga 114677

>gb|AC010252.4| Homo sapiens chromosome 5 clone CTC-428I3, complete sequence
          Length = 209112

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 15     ttctgttgcccagcttgga 33
              |||||||||||||||||||
Sbjct: 175988 ttctgttgcccagcttgga 176006

>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold
          Length = 1756392

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 154     acaaaatcacaaggaactt 172
               |||||||||||||||||||
Sbjct: 1528052 acaaaatcacaaggaactt 1528034

>gb|AC010585.6|AC010585 Homo sapiens chromosome 5 clone CTC-315O24, complete sequence
          Length = 174882

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     ttctgttgcccagcttgga 33
              |||||||||||||||||||
Sbjct: 114938 ttctgttgcccagcttgga 114920

>gb|AC011737.10| Homo sapiens BAC clone RP11-33N4 from 2, complete sequence
          Length = 176709

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 68     aagcttcttacatcatcag 86
              |||||||||||||||||||
Sbjct: 124596 aagcttcttacatcatcag 124578

>gb|AC079802.6| Homo sapiens BAC clone RP11-723P4 from 2, complete sequence
          Length = 179009

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 67    caagcttcttacatcatca 85
             |||||||||||||||||||
Sbjct: 13095 caagcttcttacatcatca 13077

>gb|AC012039.10|AC012039 Homo sapiens 3 BAC RP11-154F9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 156673

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    tgcccagcttggatccttc 39
             |||||||||||||||||||
Sbjct: 83833 tgcccagcttggatccttc 83851

>dbj|AP006212.1| Homo sapiens genomic DNA, chromosome 20, clone:CTB-271B20, complete
              sequence
          Length = 129610

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     tctgttgcccagcttggat 34
              |||||||||||||||||||
Sbjct: 108545 tctgttgcccagcttggat 108563

>gb|AC148372.3| Carollia perspicillata clone 102I5, complete sequence
          Length = 161035

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 154    acaaaatcacaaggaactt 172
              |||||||||||||||||||
Sbjct: 160117 acaaaatcacaaggaactt 160099

>gb|AC005516.1|AC005516 Homo sapiens Chromosome 4p16.3 BAC clone 399e10 containing Huntington's
              Disease gene; exons 1-67, complete sequence
          Length = 200348

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 15     ttctgttgcccagcttgga 33
              |||||||||||||||||||
Sbjct: 119631 ttctgttgcccagcttgga 119613

>emb|CT025532.15| Mouse DNA sequence from clone RP23-231K10 on chromosome 9, complete
             sequence
          Length = 196153

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 163   caaggaacttctccgatga 181
             |||||||||||||||||||
Sbjct: 24144 caaggaacttctccgatga 24162

>emb|Z69650.1|HSL69F7B Human DNA sequence from clone LA04NC01-69F7 on chromosome 4, complete
            sequence
          Length = 16851

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 15   ttctgttgcccagcttgga 33
            |||||||||||||||||||
Sbjct: 3651 ttctgttgcccagcttgga 3633

>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold
          Length = 1501503

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 154     acaaaatcacaaggaactt 172
               |||||||||||||||||||
Sbjct: 1500585 acaaaatcacaaggaactt 1500567

>emb|AL591381.17| Human DNA sequence from clone RP11-690C2 on chromosome Xq26.1-26.3,
             complete sequence
          Length = 114815

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    tgttctgttgcccagcttg 31
             |||||||||||||||||||
Sbjct: 93965 tgttctgttgcccagcttg 93983

>emb|AL590282.6| Human DNA sequence from clone RP13-210D15 on chromosome Xq26.1-26.3,
             complete sequence
          Length = 139296

 Score = 38.2 bits (19), Expect = 10.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    tgttctgttgcccagcttg 31
             |||||||||||||||||||
Sbjct: 40579 tgttctgttgcccagcttg 40597


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,510,025
Number of Sequences: 3902068
Number of extensions: 1510025
Number of successful extensions: 126322
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 126232
Number of HSP's gapped (non-prelim): 90
length of query: 200
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 178
effective length of database: 17,147,199,772
effective search space: 3052201559416
effective search space used: 3052201559416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)