ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags34i20 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_192099.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1005 Score = 424 bits (214), Expect = e-115 Identities = 427/498 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 499 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 558 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 559 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 618 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 619 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 678 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 679 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 738 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 739 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 798 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 799 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 858 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 |||| ||||||| |||| ||||||| || ||||||||||||||||| |||||| |||| Sbjct: 859 cttaagcccgagatccctgtctccaagaaccagatgctctactgcacaagcttgaactgg 918 Query: 443 agcgcggatggcagcactctctatgctggttacactgatggaaccattcgcatctacaag 502 ||||| ||||| ||||| ||||||||||||||||| ||||||||||| | ||||||||| Sbjct: 919 agcgcagatggaagcaccctctatgctggttacacagatggaaccatcaggatctacaag 978 Query: 503 atctctgggttcagctac 520 ||||| || ||||||||| Sbjct: 979 atctcaggtttcagctac 996
>dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037K24, full insert sequence Length = 1358 Score = 424 bits (214), Expect = e-115 Identities = 427/498 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 597 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 656 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 657 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 716 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 717 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 776 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 777 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 836 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 837 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 896 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 897 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 956 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 |||| ||||||| |||| ||||||| || ||||||||||||||||| |||||| |||| Sbjct: 957 cttaagcccgagatccctgtctccaagaaccagatgctctactgcacaagcttgaactgg 1016 Query: 443 agcgcggatggcagcactctctatgctggttacactgatggaaccattcgcatctacaag 502 ||||| ||||| ||||| ||||||||||||||||| ||||||||||| | ||||||||| Sbjct: 1017 agcgcagatggaagcaccctctatgctggttacacagatggaaccatcaggatctacaag 1076 Query: 503 atctctgggttcagctac 520 ||||| || ||||||||| Sbjct: 1077 atctcaggtttcagctac 1094
>dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001N15, full insert sequence Length = 1256 Score = 424 bits (214), Expect = e-115 Identities = 427/498 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 568 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 627 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 628 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 687 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 688 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 747 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 748 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 807 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 808 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 867 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 868 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 927 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 |||| ||||||| |||| ||||||| || ||||||||||||||||| |||||| |||| Sbjct: 928 cttaagcccgagatccctgtctccaagaaccagatgctctactgcacaagcttgaactgg 987 Query: 443 agcgcggatggcagcactctctatgctggttacactgatggaaccattcgcatctacaag 502 ||||| ||||| ||||| ||||||||||||||||| ||||||||||| | ||||||||| Sbjct: 988 agcgcagatggaagcaccctctatgctggttacacagatggaaccatcaggatctacaag 1047 Query: 503 atctctgggttcagctac 520 ||||| || ||||||||| Sbjct: 1048 atctcaggtttcagctac 1065
>dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-011-A02, full insert sequence Length = 1351 Score = 424 bits (214), Expect = e-115 Identities = 427/498 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 591 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 650 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 651 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 710 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 711 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 770 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 771 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 830 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 831 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 890 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 891 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 950 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 |||| ||||||| |||| ||||||| || ||||||||||||||||| |||||| |||| Sbjct: 951 cttaagcccgagatccctgtctccaagaaccagatgctctactgcacaagcttgaactgg 1010 Query: 443 agcgcggatggcagcactctctatgctggttacactgatggaaccattcgcatctacaag 502 ||||| ||||| ||||| ||||||||||||||||| ||||||||||| | ||||||||| Sbjct: 1011 agcgcagatggaagcaccctctatgctggttacacagatggaaccatcaggatctacaag 1070 Query: 503 atctctgggttcagctac 520 ||||| || ||||||||| Sbjct: 1071 atctcaggtttcagctac 1088
>dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RWD mRNA for q group of receptor for activated C-kinase, complete cds Length = 1285 Score = 424 bits (214), Expect = e-115 Identities = 427/498 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 525 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 584 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 585 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 644 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 645 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 704 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 705 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 764 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 765 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 824 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 825 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 884 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 |||| ||||||| |||| ||||||| || ||||||||||||||||| |||||| |||| Sbjct: 885 cttaagcccgagatccctgtctccaagaaccagatgctctactgcacaagcttgaactgg 944 Query: 443 agcgcggatggcagcactctctatgctggttacactgatggaaccattcgcatctacaag 502 ||||| ||||| ||||| ||||||||||||||||| ||||||||||| | ||||||||| Sbjct: 945 agcgcagatggaagcaccctctatgctggttacacagatggaaccatcaggatctacaag 1004 Query: 503 atctctgggttcagctac 520 ||||| || ||||||||| Sbjct: 1005 atctcaggtttcagctac 1022
>dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001E12, full insert sequence Length = 1326 Score = 416 bits (210), Expect = e-113 Identities = 426/498 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 585 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 644 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 645 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 704 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 705 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 764 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 765 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 824 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 825 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 884 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || ||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 885 gcggcgacccaggactctatcaagatctggggtcttgagtcaaagcacattgtgcaggac 944 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 |||| ||||||| |||| ||||||| || ||||||||||||||||| |||||| |||| Sbjct: 945 cttaagcccgagatccctgtctccaagaaccagatgctctactgcacaagcttgaactgg 1004 Query: 443 agcgcggatggcagcactctctatgctggttacactgatggaaccattcgcatctacaag 502 ||||| ||||| ||||| ||||||||||||||||| ||||||||||| | ||||||||| Sbjct: 1005 agcgcagatggaagcaccctctatgctggttacacagatggaaccatcaggatctacaag 1064 Query: 503 atctctgggttcagctac 520 ||||| || ||||||||| Sbjct: 1065 atctcaggtttcagctac 1082
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 319 bits (161), Expect = 5e-84 Identities = 329/385 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 28324653 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 28324712 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 28324713 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 28324772 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 28324773 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 28324832 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 28324833 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 28324892 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 28324893 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 28324952 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 28324953 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 28325012 Query: 383 cttaggcccgaggtcccagtctcca 407 |||| ||||||| |||| ||||||| Sbjct: 28325013 cttaagcccgagatccctgtctcca 28325037 Score = 119 bits (60), Expect = 1e-23 Identities = 96/108 (88%) Strand = Plus / Plus Query: 413 cagatgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggt 472 ||||||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||||| Sbjct: 28326205 cagatgctctactgcacaagcttgaactggagcgcagatggaagcaccctctatgctggt 28326264 Query: 473 tacactgatggaaccattcgcatctacaagatctctgggttcagctac 520 ||||| ||||||||||| | |||||||||||||| || ||||||||| Sbjct: 28326265 tacacagatggaaccatcaggatctacaagatctcaggtttcagctac 28326312 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 119 tgcaagctccgctgcactcttgat 142 ||||||||||||||| |||||||| Sbjct: 28782983 tgcaagctccgctgctctcttgat 28783006 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 aaggtctggaacctcaccaa 117 |||||||||||||||||||| Sbjct: 19968928 aaggtctggaacctcaccaa 19968947
>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0478H03 Length = 167560 Score = 319 bits (161), Expect = 5e-84 Identities = 329/385 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 159160 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 159219 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 159220 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 159279 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 159280 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 159339 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 159340 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 159399 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 159400 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 159459 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 159460 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 159519 Query: 383 cttaggcccgaggtcccagtctcca 407 |||| ||||||| |||| ||||||| Sbjct: 159520 cttaagcccgagatccctgtctcca 159544 Score = 119 bits (60), Expect = 1e-23 Identities = 96/108 (88%) Strand = Plus / Plus Query: 413 cagatgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggt 472 ||||||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||||| Sbjct: 160712 cagatgctctactgcacaagcttgaactggagcgcagatggaagcaccctctatgctggt 160771 Query: 473 tacactgatggaaccattcgcatctacaagatctctgggttcagctac 520 ||||| ||||||||||| | |||||||||||||| || ||||||||| Sbjct: 160772 tacacagatggaaccatcaggatctacaagatctcaggtttcagctac 160819
>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0519D04 Length = 193068 Score = 319 bits (161), Expect = 5e-84 Identities = 329/385 (85%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| ||||||||||| ||||||||||||| |||| || ||||||||||| ||||| Sbjct: 39753 tgggtctcctgcgtccgcttctcccccaacaccttccagccaaccatcgtctctggctcc 39812 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| |||||||||| ||||||||||| ||||||||||| ||||||| || || Sbjct: 39813 tgggaccgcaccgtcaaggtgtggaacctcacgaactgcaagctgcgctgcaacctcgag 39872 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 |||||||| || || || | || || ||||||||||| |||||||| || ||||| || Sbjct: 39873 ggccatggcggctacgtcaacgctgtcgcggtcagccccgacggttctctgtgcgcgtcc 39932 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 |||||||| |||||||| || |||||||||| ||| | ||||||||||| || |||||| Sbjct: 39933 ggtggcaaagatggcgttaccctgctgtgggacttggctgagggcaagaggctgtactcg 39992 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 || || ||||| ||||| || |||| || || |||||||| |||||||||||||||||| Sbjct: 39993 cttgacgcgggttccatcattcactcgctctgcttctcgcccaaccgctactggctctgc 40052 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 |||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||| Sbjct: 40053 gcggcgacccaggactctatcaagatctgggatcttgagtcaaagcacattgtgcaggac 40112 Query: 383 cttaggcccgaggtcccagtctcca 407 |||| ||||||| |||| ||||||| Sbjct: 40113 cttaagcccgagatccctgtctcca 40137 Score = 119 bits (60), Expect = 1e-23 Identities = 96/108 (88%) Strand = Plus / Plus Query: 413 cagatgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggt 472 ||||||||||||||||| |||||| ||||||||| ||||| ||||| |||||||||||| Sbjct: 41305 cagatgctctactgcacaagcttgaactggagcgcagatggaagcaccctctatgctggt 41364 Query: 473 tacactgatggaaccattcgcatctacaagatctctgggttcagctac 520 ||||| ||||||||||| | |||||||||||||| || ||||||||| Sbjct: 41365 tacacagatggaaccatcaggatctacaagatctcaggtttcagctac 41412
>gb|BT016269.1| Zea mays clone Contig102 mRNA sequence Length = 1254 Score = 268 bits (135), Expect = 2e-68 Identities = 348/419 (83%) Strand = Plus / Plus Query: 65 accatcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaag 124 ||||| ||||| || || ||||||||| ||||||||||||||||||| || ||||||||| Sbjct: 607 accattgtctccggttcctgggaccgcaccgtcaaggtctggaaccttacgaactgcaag 666 Query: 125 ctccgctgcactcttgatggccatggtgggtatgttagtgccgttgcggtcagcccagac 184 || ||||||||||| ||||| ||||| || ||||||| ||||| || || ||||| || Sbjct: 667 ctgcgctgcactctcgatggtcatggcggatatgttaacgccgtcgccgtgagccccgat 726 Query: 185 ggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgag 244 || || ||||||||||| || || ||||| || || ||| |||||||||||||| | ||| Sbjct: 727 ggatcgctctgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgag 786 Query: 245 ggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcgccg 304 || ||||| || ||||||||||||||||| ||||| ||| |||| || || |||||||| Sbjct: 787 gggaagaggctgtactcgctggatgcgggctccatcatccactccctctgcttctcgccc 846 Query: 305 aaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtca 364 |||||||||||||||||||| ||||| ||||| || | ||||||||||| |||||||| Sbjct: 847 aaccgctactggctctgcgctgcgacccaggactctgttaagatctgggaccttgagtcg 906 Query: 365 aagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacagatgctctac 424 |||||| ||||||||||||| | ||| || ||| |||||| || ||||| || ||| Sbjct: 907 aagcacgtcgtgcaggacctcaagcctgacatccagatctccaagaaccagatcctgtac 966 Query: 425 tgcacttgcttgagctggagcgcggatggcagcactctctatgctggttacactgatgg 483 ||||| |||||||||||||||| ||||| ||||| ||||| |||| ||||| ||||| Sbjct: 967 tgcacaagcttgagctggagcgccgatggaagcaccctctacactggctacaccgatgg 1025
>gb|AY103919.1| Zea mays PCO099246 mRNA sequence Length = 1461 Score = 268 bits (135), Expect = 2e-68 Identities = 348/419 (83%) Strand = Plus / Plus Query: 65 accatcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaag 124 ||||| ||||| || || ||||||||| ||||||||||||||||||| || ||||||||| Sbjct: 764 accattgtctccggttcctgggaccgcaccgtcaaggtctggaaccttacgaactgcaag 823 Query: 125 ctccgctgcactcttgatggccatggtgggtatgttagtgccgttgcggtcagcccagac 184 || ||||||||||| ||||| ||||| || ||||||| ||||| || || ||||| || Sbjct: 824 ctgcgctgcactctcgatggtcatggcggatatgttaacgccgtcgccgtgagccccgat 883 Query: 185 ggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgag 244 || || ||||||||||| || || ||||| || || ||| |||||||||||||| | ||| Sbjct: 884 ggatcgctctgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgag 943 Query: 245 ggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcgccg 304 || ||||| || ||||||||||||||||| ||||| ||| |||| || || |||||||| Sbjct: 944 gggaagaggctgtactcgctggatgcgggctccatcatccactccctctgcttctcgccc 1003 Query: 305 aaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtca 364 |||||||||||||||||||| ||||| ||||| || | ||||||||||| |||||||| Sbjct: 1004 aaccgctactggctctgcgctgcgacccaggactctgttaagatctgggaccttgagtcg 1063 Query: 365 aagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacagatgctctac 424 |||||| ||||||||||||| | ||| || ||| |||||| || ||||| || ||| Sbjct: 1064 aagcacgtcgtgcaggacctcaagcctgacatccagatctccaagaaccagatcctgtac 1123 Query: 425 tgcacttgcttgagctggagcgcggatggcagcactctctatgctggttacactgatgg 483 ||||| |||||||||||||||| ||||| ||||| ||||| |||| ||||| ||||| Sbjct: 1124 tgcacaagcttgagctggagcgccgatggaagcaccctctacactggctacaccgatgg 1182
>gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence Length = 1281 Score = 260 bits (131), Expect = 4e-66 Identities = 347/419 (82%) Strand = Plus / Plus Query: 65 accatcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaag 124 ||||| ||||| || || ||||||||| ||||||||||||||||||| || ||||||||| Sbjct: 616 accattgtctccggttcctgggaccgcaccgtcaaggtctggaaccttacgaactgcaag 675 Query: 125 ctccgctgcactcttgatggccatggtgggtatgttagtgccgttgcggtcagcccagac 184 || ||||||||||| ||||| ||||| || ||||||| ||||| || || ||||| || Sbjct: 676 ctgcgctgcactctcgatggtcatggcggatatgttaacgccgtcgccgtgagccccgat 735 Query: 185 ggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgag 244 || || ||||||||||| || || ||||| || || ||| |||||||||||||| | ||| Sbjct: 736 ggatcgctctgcgcctccggcgggaaggacggtgttactctgctgtgggatttggctgag 795 Query: 245 ggcaagagactctactcgctggatgcgggatccattatcaactcactttgtttctcgccg 304 || ||||| || ||||||||||||||||| ||||| ||| |||| || || |||||||| Sbjct: 796 gggaagaggctgtactcgctggatgcgggctccatcatccactccctctgcttctcgccc 855 Query: 305 aaccgctactggctctgcgcggcgacacaggattccatcaagatctgggatcttgagtca 364 |||||||||||||||||||| ||||| ||||| || | ||||||||||| |||||||| Sbjct: 856 aaccgctactggctctgcgctgcgacccaggactctgttaagatctgggaccttgagtcg 915 Query: 365 aagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacagatgctctac 424 |||||| ||||||||||||| | ||| || ||| |||||| || ||||| || ||| Sbjct: 916 aagcacgtcgtgcaggacctcaagcctgacatccagatctccaagaaccagatcctgtac 975 Query: 425 tgcacttgcttgagctggagcgcggatggcagcactctctatgctggttacactgatgg 483 ||||| |||||||||||||||| ||||| ||| | ||||| |||| ||||| ||||| Sbjct: 976 tgcacaagcttgagctggagcgccgatggaagccccctctacactggctacaccgatgg 1034
>gb|BT016705.1| Zea mays clone Contig538 mRNA sequence Length = 1265 Score = 256 bits (129), Expect = 7e-65 Identities = 378/461 (81%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| |||||||| | |||||||| |||| |||| || ||||| ||||| || || Sbjct: 565 tgggtctcctgcgttaggttctccccaaacaccttccagcccaccattgtctccggatcc 624 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctccgctgcactcttgat 142 ||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||| ||| Sbjct: 625 tgggaccgcaccgtcaaggtctggaaccttaccaactgcaagctgcgctgcactctggat 684 Query: 143 ggccatggtgggtatgttagtgccgttgcggtcagcccagacggttcactctgcgcctct 202 || || ||||| ||||||| ||||| || || ||||| ||||| || || |||||||| Sbjct: 685 gggcacggtggctatgttaacgccgtcgctgtgagccccgacgggtcgctgtgcgcctcc 744 Query: 203 ggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcg 262 || || ||||| || || ||| |||||||||||||| | ||||| ||||| || |||||| Sbjct: 745 ggcgggaaggacggtgttactctgctgtgggatttggctgaggggaagaggctgtactcg 804 Query: 263 ctggatgcgggatccattatcaactcactttgtttctcgccgaaccgctactggctctgc 322 ||||| ||||| ||||| ||| |||| || || ||||| || |||||||||||||||||| Sbjct: 805 ctggacgcgggctccatcatccactctctctgcttctcacccaaccgctactggctctgc 864 Query: 323 gcggcgacacaggattccatcaagatctgggatcttgagtcaaagcacatcgtgcaggac 382 || ||||| ||||| || ||||||||||||| || ||||| |||||| | ||||||||| Sbjct: 865 gctgcgacgcaggactctgtcaagatctgggacctcgagtcgaagcacgttgtgcaggac 924 Query: 383 cttaggcccgaggtcccagtctccagcaaacagatgctctactgcacttgcttgagctgg 442 || | |||||| ||| ||||||| || ||||| || ||||| || ||||||||||| Sbjct: 925 ctcaagcccgacatccaggtctccaagaaccagatcctgtactgtacaagcttgagctgg 984 Query: 443 agcgcggatggcagcactctctatgctggttacactgatgg 483 || ||||| || ||||| ||||| |||| ||||| ||||| Sbjct: 985 agtgcggacggaagcaccctctacactggctacaccgatgg 1025
>ref|XM_475866.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1011 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 775 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 834 Query: 356 cttgagtcaaagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacag 415 || ||||| |||| | || |||||||||| | ||| || |||| | || || | ||| Sbjct: 835 ctcgagtccaagctcgtcatgcaggacctcaagccagaagtccaggccttcaagagccag 894 Query: 416 atgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggttac 475 ||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| ||| Sbjct: 895 atgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggctac 954 Query: 476 actgatggaac 486 ||||||||||| Sbjct: 955 actgatggaac 965 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 486 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 545 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 546 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 605
>dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034P13, full insert sequence Length = 1385 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 850 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 909 Query: 356 cttgagtcaaagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacag 415 || ||||| |||| | || |||||||||| | ||| || |||| | || || | ||| Sbjct: 910 ctcgagtccaagctcgtcatgcaggacctcaagccagaagtccaggccttcaagagccag 969 Query: 416 atgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggttac 475 ||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| ||| Sbjct: 970 atgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggctac 1029 Query: 476 actgatggaac 486 ||||||||||| Sbjct: 1030 actgatggaac 1040 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 561 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 620 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 621 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 680
>dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002L07, full insert sequence Length = 1227 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 843 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 902 Query: 356 cttgagtcaaagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacag 415 || ||||| |||| | || |||||||||| | ||| || |||| | || || | ||| Sbjct: 903 ctcgagtccaagctcgtcatgcaggacctcaagccagaagtccaggccttcaagagccag 962 Query: 416 atgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggttac 475 ||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| ||| Sbjct: 963 atgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggctac 1022 Query: 476 actgatggaac 486 ||||||||||| Sbjct: 1023 actgatggaac 1033 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 554 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 613 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 614 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 673
>dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D07, full insert sequence Length = 1412 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 852 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 911 Query: 356 cttgagtcaaagcacatcgtgcaggaccttaggcccgaggtcccagtctccagcaaacag 415 || ||||| |||| | || |||||||||| | ||| || |||| | || || | ||| Sbjct: 912 ctcgagtccaagctcgtcatgcaggacctcaagccagaagtccaggccttcaagagccag 971 Query: 416 atgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggttac 475 ||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| ||| Sbjct: 972 atgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggctac 1031 Query: 476 actgatggaac 486 ||||||||||| Sbjct: 1032 actgatggaac 1042 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Plus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 563 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 622 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 623 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 682
>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23, complete sequence Length = 191765 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Minus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 115946 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 115887 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 115886 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 115827 Score = 89.7 bits (45), Expect = 9e-15 Identities = 78/89 (87%) Strand = Plus / Minus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 115657 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 115598 Query: 356 cttgagtcaaagcacatcgtgcaggacct 384 || ||||| |||| | || |||||||||| Sbjct: 115597 ctcgagtccaagctcgtcatgcaggacct 115569 Score = 73.8 bits (37), Expect = 5e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 414 agatgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggtt 473 ||||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| | Sbjct: 114448 agatgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggct 114389 Query: 474 acactgatggaac 486 ||||||||||||| Sbjct: 114388 acactgatggaac 114376
>gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0560C03, complete sequence Length = 177861 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Minus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 172374 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 172315 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 172314 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 172255 Score = 89.7 bits (45), Expect = 9e-15 Identities = 78/89 (87%) Strand = Plus / Minus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 172085 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 172026 Query: 356 cttgagtcaaagcacatcgtgcaggacct 384 || ||||| |||| | || |||||||||| Sbjct: 172025 ctcgagtccaagctcgtcatgcaggacct 171997 Score = 73.8 bits (37), Expect = 5e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 414 agatgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggtt 473 ||||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| | Sbjct: 170876 agatgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggct 170817 Query: 474 acactgatggaac 486 ||||||||||||| Sbjct: 170816 acactgatggaac 170804
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 103 bits (52), Expect = 6e-19 Identities = 104/120 (86%), Gaps = 1/120 (0%) Strand = Plus / Minus Query: 8 cgagggcc-caccggctgggtgtcctgcgtccgtttctcccccaacaacttcgccccgac 66 |||||||| |||||| ||||| ||||||||| | |||||||||||| | | ||||| || Sbjct: 27240978 cgagggccacaccgggtgggtctcctgcgtcagattctcccccaaccccatggcccccac 27240919 Query: 67 catcgtctcgggctcatgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||||||| ||||| ||||| ||| ||||||||||||||||||||| ||||||||||| Sbjct: 27240918 catcgtctccggctcgtgggatcgcagcgtcaaggtctggaacctcacgaactgcaagct 27240859 Score = 89.7 bits (45), Expect = 9e-15 Identities = 78/89 (87%) Strand = Plus / Minus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctgggat 355 |||||||| |||||||||||||||||||| |||||| |||| ||| ||||||||||||| Sbjct: 27240689 ttctcgcccaaccgctactggctctgcgccgcgacagaggactccgtcaagatctgggac 27240630 Query: 356 cttgagtcaaagcacatcgtgcaggacct 384 || ||||| |||| | || |||||||||| Sbjct: 27240629 ctcgagtccaagctcgtcatgcaggacct 27240601 Score = 73.8 bits (37), Expect = 5e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 414 agatgctctactgcacttgcttgagctggagcgcggatggcagcactctctatgctggtt 473 ||||||| |||||||| | |||||||||||||| ||||||||||| |||| ||||| | Sbjct: 27239480 agatgctgtactgcacaagtttgagctggagcgctgatggcagcaccctcttcgctggct 27239421 Query: 474 acactgatggaac 486 ||||||||||||| Sbjct: 27239420 acactgatggaac 27239408
>emb|Y08678.1|MSGB1 Medicago sativa mRNA for G protein beta subunit-like protein (gbl gene) Length = 1259 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 185 ggttcactctgcgcctctggtggcaaggatggcgtcactttgctgtgggatttgaccgag 244 ||||| ||||| || |||||||| || ||||| || | |||||||||||||||| | ||| Sbjct: 656 ggttctctctgtgcttctggtgggaaagatggagtgattttgctgtgggatttggctgag 715 Query: 245 ggcaagagactctactcgctggatgcgggatccattat 282 || |||||||| ||||| || ||||| || |||||||| Sbjct: 716 ggaaagagactttactctcttgatgctggttccattat 753
>gb|DQ284489.1| Solanum tuberosum clone 042G03 ArcA2 protein-like mRNA, complete cds Length = 1098 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 206 ggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactcgctg 265 ||||||||||| || | |||||| ||||||||| | |||||||||| |||||||||||| Sbjct: 713 ggcaaggatggagttattttgctctgggatttggctgagggcaagaaactctactcgctt 772 Query: 266 gatgc 270 ||||| Sbjct: 773 gatgc 777
>emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein beta subunit-like polypeptide Length = 2314 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctggga 354 |||||||| |||||||||||||| ||||| || || ||| ||||||||||||||||| Sbjct: 1578 ttctcgcccaaccgctactggctgtgcgccgccacccagtcctccatcaagatctggga 1636 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 99 aggtctggaacctcaccaactgcaagct 126 ||||||||||||| |||||||||||||| Sbjct: 1381 aggtctggaacctgaccaactgcaagct 1408
>gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like polypeptide (cblP) mRNA, partial cds Length = 843 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgcggcgacacaggattccatcaagatctggga 354 |||||||| |||||||||||||| ||||| || || ||| ||||||||||||||||| Sbjct: 736 ttctcgcccaaccgctactggctgtgcgccgccacccagtcctccatcaagatctggga 794 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 98 aaggtctggaacctcaccaactgcaagct 126 |||||||||||||| |||||||||||||| Sbjct: 538 aaggtctggaacctgaccaactgcaagct 566
>emb|BX067788.1|CNS09OGW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 230 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 278 attatcaactcactttgtttctcgccgaaccgctactggctctgcg 323 ||||||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 203 attatcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158
>gb|DQ073455.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1) mRNA, complete cds Length = 1427 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctc 127 |||||||| |||||||||||||| | || ||||||||||||||| Sbjct: 597 tgggaccgtaccgtcaaggtctggcatcttaccaactgcaagctc 641 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 191 ctctgcgcctctggtggcaaggat 214 |||||||||||||||||||||||| Sbjct: 705 ctctgcgcctctggtggcaaggat 728
>gb|AF368031.1|AF368031 Heliothis virescens receptor for activated protein kinase C RACK1 mRNA, complete cds Length = 1071 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagctc 127 ||||||||| | || ||||||||| |||| ||||||||||||||| Sbjct: 508 tgggaccgcactgttaaggtctggcaccttaccaactgcaagctc 552 Score = 40.1 bits (20), Expect = 7.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 182 gacggttcactctgcgcctctggtggcaagga 213 |||||||| |||||||| || ||||||||||| Sbjct: 607 gacggttctctctgcgcttccggtggcaagga 638
>gb|AY439929.1| Armigeres subalbatus ASAP ID: 38955 receptor for activated protein kinase C mRNA sequence Length = 689 Score = 48.1 bits (24), Expect = 0.031 Identities = 84/104 (80%) Strand = Plus / Plus Query: 23 tgggtgtcctgcgtccgtttctcccccaacaacttcgccccgaccatcgtctcgggctca 82 ||||| || |||||||||||||| || ||| ||| ||||| |||||| |||| | Sbjct: 544 tgggtttcktgcgtccgtttctcgccgaaccactcgaacccgatcatcgtgtcggccggt 603 Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 604 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 647
>gb|AY431533.1| Aedes aegypti ASAP ID: 34655 Receptor for activated protein kinase C (RACK) mRNA sequence Length = 1066 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 521 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 564 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 tccatcaagatctgggatct 357 |||||||||||||||||||| Sbjct: 776 tccatcaagatctgggatct 795
>gb|DQ440042.1| Aedes aegypti clone AE-2850 activated protein kinase C receptor mRNA, complete cds Length = 936 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 508 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 551 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 tccatcaagatctgggatct 357 |||||||||||||||||||| Sbjct: 763 tccatcaagatctgggatct 782
>gb|BT012967.1| Lycopersicon esculentum clone 114159R, mRNA sequence Length = 1324 Score = 48.1 bits (24), Expect = 0.031 Identities = 51/60 (85%) Strand = Plus / Plus Query: 202 tggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactc 261 ||||||||||||||| || | |||||| ||||||||| | ||||| |||| |||||||| Sbjct: 711 tggtggcaaggatggagttattttgctctgggatttggctgaggggaagaagctctactc 770 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 102 tctggaacctcaccaactgcaagct 126 ||||||||||||||||||| ||||| Sbjct: 611 tctggaacctcaccaactgtaagct 635
>emb|BX019636.1|CNS08NBC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcgc 324 |||||| |||| || |||||||| |||||||||||||| ||||| Sbjct: 812 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcgc 855
>emb|CR938394.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YA14AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 776 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 599 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 642
>emb|CR938393.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 3-prime end of clone KW0AAA2YA14BBM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 789 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Minus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 526 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 483 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 338 tccatcaagatctgggatct 357 |||||||||||||||||||| Sbjct: 271 tccatcaagatctgggatct 252
>emb|CR938316.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YD09AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 803 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 601 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 644
>emb|CR938134.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YJ08AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 821 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 592 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 635
>emb|CR938117.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YJ23AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 856 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 601 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 644
>emb|CR938087.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YK23AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 829 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 597 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 640
>emb|CR938067.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YL12AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 775 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 606 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 649
>emb|CR938027.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YM22AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 830 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 83 tgggaccgctccgtcaaggtctggaacctcaccaactgcaagct 126 ||||| ||| |||||||||||||||| || ||||||||||||| Sbjct: 601 tgggatcgcaccgtcaaggtctggaatctggccaactgcaagct 644
>gb|DQ122924.1| Chlamydomonas incerta G protein beta subunit-like polypeptide (cblP) gene, partial cds Length = 1471 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 99 aggtctggaacctcaccaactgcaagct 126 ||||||||||||| |||||||||||||| Sbjct: 1227 aggtctggaacctgaccaactgcaagct 1254 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 296 ttctcgccgaaccgctactggctctgcgc 324 |||||||| |||||||||||||| ||||| Sbjct: 1424 ttctcgcccaaccgctactggctgtgcgc 1452
>gb|DQ073456.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1) gene, complete cds Length = 2925 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 191 ctctgcgcctctggtggcaaggat 214 |||||||||||||||||||||||| Sbjct: 1695 ctctgcgcctctggtggcaaggat 1718
>dbj|AB022687.1| Lycopersicon esculentum mRNA for LeArcA2 protein, complete cds Length = 1115 Score = 48.1 bits (24), Expect = 0.031 Identities = 51/60 (85%) Strand = Plus / Plus Query: 202 tggtggcaaggatggcgtcactttgctgtgggatttgaccgagggcaagagactctactc 261 ||||||||||||||| || | |||||| ||||||||| | ||||| |||| |||||||| Sbjct: 676 tggtggcaaggatggagttattttgctctgggatttggctgaggggaagaagctctactc 735 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 102 tctggaacctcaccaactgcaagct 126 ||||||||||||||||||| ||||| Sbjct: 576 tctggaacctcaccaactgtaagct 600
>dbj|AB180244.1| Fusarium oxysporum fgb2 gene for G-protein beta like WD repeat protein, complete cds Length = 1796 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 182 gacggttcactctgcgcctctggtggcaagga 213 |||||||| || |||||||||||||||||||| Sbjct: 1190 gacggttctctgtgcgcctctggtggcaagga 1221
>gb|U49437.1|BGU49437 Biomphalaria glabrata RACK mRNA, complete cds Length = 1235 Score = 46.1 bits (23), Expect = 0.12 Identities = 32/35 (91%) Strand = Plus / Plus Query: 179 ccagacggttcactctgcgcctctggtggcaagga 213 |||||||| || || |||||||||||||||||||| Sbjct: 665 ccagacggctcgctgtgcgcctctggtggcaagga 699
>ref|XM_414243.1| PREDICTED: Gallus gallus similar to U3 small nucleolar RNA interacting protein 2 (U3 small nucleolar ribonucleoproptein-associated 55-kDa protein) (U3 snoRNP-associated 55-kDa protein) (U3-55K) (LOC415888), mRNA Length = 1936 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 86 gaccgctccgtcaaggtctggaa 108 ||||||||||||||||||||||| Sbjct: 1063 gaccgctccgtcaaggtctggaa 1085
>emb|BX053466.1|CNS09DF2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 360 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 318
>emb|BX053465.1|CNS09DF1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 813 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 855
>emb|BX053355.1|CNS09DBZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304
>emb|BX053354.1|CNS09DBY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 801 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 843
>emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX024636.1|CNS08R68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830
>emb|BX072073.1|CNS09RRX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 453 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 349 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 307
>emb|BX071929.1|CNS09RNX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301
>emb|BX071928.1|CNS09RNW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1065 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841
>emb|BX071907.1|CNS09RNB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293
>emb|BX071775.1|CNS09RJN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 341 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 299
>emb|BX071774.1|CNS09RJM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851
>emb|BX071717.1|CNS09RI1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304
>emb|BX071716.1|CNS09RI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX071585.1|CNS09RED Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 350 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 308
>emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 329 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 287
>emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 798 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 840
>emb|BX071037.1|CNS09QZ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839
>emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 345 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 303
>emb|BX070941.1|CNS09QWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX070940.1|CNS09QWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838
>emb|BX070678.1|CNS09QP6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285
>emb|BX070378.1|CNS09QGU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839
>emb|BX070186.1|CNS09QBI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 385 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158
>emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 332 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 290
>emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839
>emb|BX069810.1|CNS09Q12 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 328 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 286
>emb|BX069809.1|CNS09Q11 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 792 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 834
>emb|BX069778.1|CNS09Q06 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 328 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158
>emb|BX069777.1|CNS09Q05 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 807 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 849
>emb|BX069457.1|CNS09PR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 818 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 860
>emb|BX069079.1|CNS09PGR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301
>emb|BX069078.1|CNS09PGQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 832 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 874
>emb|BX068759.1|CNS09P7V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 360 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 318
>emb|BX068758.1|CNS09P7U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 814 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 856
>emb|BX068670.1|CNS09P5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 867 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 795 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 837
>emb|BX068658.1|CNS09P52 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 354 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 312
>emb|BX068657.1|CNS09P51 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852
>emb|BX068642.1|CNS09P4M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298
>emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851
>emb|BX068364.1|CNS09OWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 305 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 263
>emb|BX068249.1|CNS09OTP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 713 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 277 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 235
>emb|BX068234.1|CNS09OTA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 365 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 323
>emb|BX068233.1|CNS09OT9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852
>emb|BX068228.1|CNS09OT4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293
>emb|BX068198.1|CNS09OSA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 316 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 274
>emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 801 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 843
>emb|BX068108.1|CNS09OPS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX068107.1|CNS09OPR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX068050.1|CNS09OO6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 352 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 310
>emb|BX068049.1|CNS09OO5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1025 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 811 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 853
>emb|BX068035.1|CNS09ONR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 718 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 760
>emb|BX068018.1|CNS09ONA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 829 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 342 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 300
>emb|BX068017.1|CNS09ON9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852
>emb|BX067955.1|CNS09OLJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 317 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 278 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 236
>emb|BX067894.1|CNS09OJU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 510 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 324 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 282
>emb|BX067874.1|CNS09OJA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 697 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 739
>emb|BX067850.1|CNS09OIM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 334 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 292
>emb|BX067849.1|CNS09OIL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841
>emb|BX067804.1|CNS09OHC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293
>emb|BX067803.1|CNS09OHB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 805 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 847
>emb|BX067787.1|CNS09OGV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839
>emb|BX067705.1|CNS09OEL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX067646.1|CNS09OCY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX067645.1|CNS09OCX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838
>emb|BX067635.1|CNS09OCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841
>emb|BX067585.1|CNS09OB9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 464 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 339 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 297
>emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 862 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 904
>emb|BX067492.1|CNS09O8O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301
>emb|BX067491.1|CNS09O8N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 794 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 836
>emb|BX066978.1|CNS09NUE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 765 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 807
>emb|BX066951.1|CNS09NTN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 360 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 318
>emb|BX066950.1|CNS09NTM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1026 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 824 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 866
>emb|BX066945.1|CNS09NTH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 425 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 344 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 302
>emb|BX066944.1|CNS09NTG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX066941.1|CNS09NTD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 348 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 306
>emb|BX066940.1|CNS09NTC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 509 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 551
>emb|BX066917.1|CNS09NSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 354 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 312
>emb|BX066916.1|CNS09NSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 802 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 844
>emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852
>emb|BX066716.1|CNS09NN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 240 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158
>emb|BX066638.1|CNS09NKY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 356 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 314
>emb|BX066637.1|CNS09NKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1056 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851
>emb|BX066110.1|CNS09N6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298
>emb|BX066109.1|CNS09N69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835
>emb|BX066047.1|CNS09N4J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 341 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 200 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 158
>emb|BX066046.1|CNS09N4I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833
>emb|BX065996.1|CNS09N34 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 511 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 553
>emb|BX065949.1|CNS09N1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 337 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 295
>emb|BX065948.1|CNS09N1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 862 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 904
>emb|BX065904.1|CNS09N0K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 648 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 356 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 314
>emb|BX065815.1|CNS09MY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 347 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 305
>emb|BX065814.1|CNS09MY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX065711.1|CNS09MV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 633 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289
>emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838
>emb|BX065604.1|CNS09MS8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1041 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835
>emb|BX065506.1|CNS09MPI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 351 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 309
>emb|BX065505.1|CNS09MPH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841
>emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 337 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 295
>emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1042 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 800 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 842
>emb|BX065353.1|CNS09ML9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 800 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 842
>emb|BX065157.1|CNS09MFT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 506 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 548
>emb|BX065023.1|CNS09MC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 325 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 302 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 260
>emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 767 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 809
>emb|BX064965.1|CNS09MAH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 325 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 283
>emb|BX064964.1|CNS09MAG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 771 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 813
>emb|BX064854.1|CNS09M7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 243 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 201
>emb|BX064853.1|CNS09M7D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 702 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 744
>emb|BX064529.1|CNS09LYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 329 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 287
>emb|BX064405.1|CNS09LUX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 363 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 321
>emb|BX064360.1|CNS09LTO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 816 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 858
>emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 341 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 299
>emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1037 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833
>emb|BX064233.1|CNS09LQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301
>emb|BX064232.1|CNS09LQ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 806 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 848
>emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 798 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 840
>emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 324 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 282
>emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833
>emb|BX063936.1|CNS09LHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 797 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 839
>emb|BX063919.1|CNS09LHF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 366 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 324
>emb|BX063918.1|CNS09LHE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 816 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 858
>emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301
>emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 809 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 851
>emb|BX063359.1|CNS09L1V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285
>emb|BX063358.1|CNS09L1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 773 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 815
>emb|BX063357.1|CNS09L1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 316 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 274
>emb|BX063356.1|CNS09L1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 777 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 819
>emb|BX063204.1|CNS09KXK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 344 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 302
>emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1032 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX063052.1|CNS09KTC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX063051.1|CNS09KTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 732 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 774
>emb|BX063016.1|CNS09KSC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 589 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 358 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 316
>emb|BX063014.1|CNS09KSA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 530 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 358 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 316
>emb|BX062938.1|CNS09KQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 517 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 330 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 288
>emb|BX062802.1|CNS09KME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 612 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 352 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 310
>emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289
>emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830
>emb|BX062775.1|CNS09KLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291
>emb|BX062774.1|CNS09KLM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 798 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 840
>emb|BX062707.1|CNS09KJR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 335 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 293
>emb|BX062706.1|CNS09KJQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 699 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 741
>emb|BX062617.1|CNS09KH9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 336 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 294
>emb|BX062616.1|CNS09KH8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 789 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 831
>emb|BX062615.1|CNS09KH7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298
>emb|BX062614.1|CNS09KH6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1062 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830
>emb|BX062265.1|CNS09K7H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291
>emb|BX062264.1|CNS09K7G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 759 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 801
>emb|BX062196.1|CNS09K5K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289
>emb|BX062195.1|CNS09K5J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1076 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 795 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 837
>emb|BX062152.1|CNS09K4C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1028 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX062151.1|CNS09K4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1094 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835
>emb|BX062132.1|CNS09K3S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 342 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 300
>emb|BX062131.1|CNS09K3R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1080 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 793 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 835
>emb|BX062052.1|CNS09K1K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 418 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 329 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 287
>emb|BX061984.1|CNS09JZO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 347 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 305
>emb|BX061983.1|CNS09JZN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841
>emb|BX061962.1|CNS09JZ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304
>emb|BX061961.1|CNS09JZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 789 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 831
>emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 330 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 288
>emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 792 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 834
>emb|BX061867.1|CNS09JWF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 339 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 297
>emb|BX061866.1|CNS09JWE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 792 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 834
>emb|BX061808.1|CNS09JUS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 874 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 325 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 283
>emb|BX061807.1|CNS09JUR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 790 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 832
>emb|BX061804.1|CNS09JUO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 328 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 286
>emb|BX061803.1|CNS09JUN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 799 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 841
>emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 332 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 290
>emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 790 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 832
>emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 338 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 296
>emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1013 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 819 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 861
>emb|BX061589.1|CNS09JOP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298
>emb|BX061588.1|CNS09JOO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 795 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 837
>emb|BX061562.1|CNS09JNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 343 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 301
>emb|BX061561.1|CNS09JNX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 803 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 845
>emb|BX061522.1|CNS09JMU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304
>emb|BX061521.1|CNS09JMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 788 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 830
>emb|BX061174.1|CNS09JD6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 303 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 261
>emb|BX061173.1|CNS09JD5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 689 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 731
>emb|BX060748.1|CNS09J1C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 880 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 319 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 277
>emb|BX060747.1|CNS09J1B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 776 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 818
>emb|BX060414.1|CNS09IS2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 654 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291
>emb|BX060410.1|CNS09IRY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 348 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 306
>emb|BX060409.1|CNS09IRX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1056 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 810 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 852
>emb|BX060393.1|CNS09IRH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 330 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 288
>emb|BX060392.1|CNS09IRG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 787 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 829
>emb|BX060282.1|CNS09IOE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 605 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 340 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 298
>emb|BX060281.1|CNS09IOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 768 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 810
>emb|BX060076.1|CNS09IIO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 715 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 757
>emb|BX060049.1|CNS09IHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 333 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 291
>emb|BX060048.1|CNS09IHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 790 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 832
>emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 773 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 815
>emb|BX059637.1|CNS09I6H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 791 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 833
>emb|BX059608.1|CNS09I5O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 560 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 475 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 517
>emb|BX059419.1|CNS09I0F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 336 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 294
>emb|BX059418.1|CNS09I0E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 804 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 846
>emb|BX059402.1|CNS09HZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 346 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 304
>emb|BX059401.1|CNS09HZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 846 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 888
>emb|BX059380.1|CNS09HZC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 350 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 308
>emb|BX059379.1|CNS09HZB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1025 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 800 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 842
>emb|BX059205.1|CNS09HUH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 327 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 285
>emb|BX059204.1|CNS09HUG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 796 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 838
>emb|BX059163.1|CNS09HTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Minus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 331 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 289
>emb|BX059162.1|CNS09HTA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 281 atcaactcactttgtttctcgccgaaccgctactggctctgcg 323 |||||| |||| || |||||||| |||||||||||||| |||| Sbjct: 794 atcaacgcactgtgcttctcgcccaaccgctactggctgtgcg 836 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,827,061 Number of Sequences: 3902068 Number of extensions: 3827061 Number of successful extensions: 152110 Number of sequences better than 10.0: 1255 Number of HSP's better than 10.0 without gapping: 1255 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 149436 Number of HSP's gapped (non-prelim): 2666 length of query: 560 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 537 effective length of database: 17,143,297,704 effective search space: 9205950867048 effective search space used: 9205950867048 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
