ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags34f20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_466685.1| Oryza sativa (japonica cultivar-group), mRNA 131 1e-27
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 131 1e-27
3dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic D... 131 1e-27
4gb|AY105803.1| Zea mays PCO143734 mRNA sequence 107 2e-20
5ref|NM_203147.1| Arabidopsis thaliana ATARP9 (ACTIN-RELATED PROT... 42 0.84
6ref|NM_123716.2| Arabidopsis thaliana ATARP9 (ACTIN-RELATED PROT... 42 0.84
7gb|AE008591.1| Rickettsia conorii str. Malish 7, section 23 of 1... 42 0.84
8gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001... 42 0.84
9gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B0702... 42 0.84
10gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B5701... 42 0.84
11gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/... 42 0.84
12gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B1501... 42 0.84
13gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B1402... 42 0.84
14gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/... 42 0.84
15gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B0801... 42 0.84
16gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B1402... 42 0.84
17gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B0801... 42 0.84
18emb|AL773544.5| Human DNA sequence from clone DAQB-185I1 on chro... 42 0.84
19emb|AL662844.12| Human DNA sequence from clone XXbac-299F13 on c... 42 0.84
20emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chr... 42 0.84
21emb|BX571657.1| Wolinella succinogenes, complete genome; segment... 42 0.84
22emb|CR847794.5| Human DNA sequence from clone DAMA-213L4 on chro... 42 0.84
23emb|CR759815.3| Human DNA sequence from clone DAMC-88G10 on chro... 42 0.84
24emb|CR753819.5| Human DNA sequence from clone DADB-141O4 on chro... 42 0.84
25dbj|AB202104.1| Homo sapiens C6orf18 gene for chromosome 6 open ... 42 0.84
26gb|AY057568.1| Arabidopsis thaliana AT5g43500/MWF20_22 mRNA, com... 42 0.84
27gb|AC148703.1| Macaca mulatta Major Histocompatibility Complex B... 42 0.84
28gb|AC148691.1| Macaca mulatta Major Histocompatibility Complex B... 42 0.84
29dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 42 0.84
30emb|BX831574.1|CNS09ZS3 Arabidopsis thaliana Full-length cDNA Co... 42 0.84
31dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 42 0.84
32dbj|AK117749.1| Arabidopsis thaliana At5g43500 mRNA for putative... 42 0.84
33dbj|AB025638.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 0.84
34gb|AC004195.1|AC004195 Homo sapiens clone UWGC:y24c027 from 6p21... 42 0.84
35dbj|AB088104.1| Homo sapiens HCR gene for tricohyalin homologue,... 42 0.84
36dbj|AB029343.1| Homo sapiens HCR (a-helix coiled-coil rod homolo... 42 0.84
37dbj|AB023059.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 42 0.84
38ref|XM_809954.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 3.3
39gb|AC124529.3| Mus musculus BAC clone RP23-411I8 from chromosome... 40 3.3
40ref|XM_760343.1| Theileria parva strain Muguga hypothetical prot... 40 3.3
41emb|AL445649.15| Human DNA sequence from clone RP11-381O6 on chr... 40 3.3
42emb|AL157883.15| Human DNA sequence from clone RP11-360J12 on ch... 40 3.3
43gb|AF537190.1| Gallus gallus inducible nitric oxide synthase gen... 40 3.3
44gb|AC091305.9| Homo sapiens chromosome 18, clone RP11-644A7, com... 40 3.3
45dbj|AB210142.1| Pan troglodytes HCR gene for a-helix coiled-coil... 40 3.3
46dbj|AB210141.1| Pan troglodytes HCR gene for a-helix coiled-coil... 40 3.3
47gb|AC114648.25| Mus musculus chromosome 8, clone RP24-144H17, co... 40 3.3
48dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 40 3.3
49dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,... 40 3.3
50dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 3.3
51gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta... 40 3.3
52dbj|AP000228.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 3.3
53dbj|AP000140.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 3.3
54dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related... 40 3.3 
>ref|XM_466685.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 999

 Score =  131 bits (66), Expect = 1e-27
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 94  cacagaagagactccctctgttctcatcatagcattgcaatcatacaaagaggctttgat 153
           ||||||||| |||||||||||| |  ||| |||||||||||||||||| || ||||||||
Sbjct: 300 cacagaagaaactccctctgttattgtcacagcattgcaatcatacaaggaagctttgat 359

                                                                       
Query: 154 gaatgatgatgaagcaaaaattgcagagatagagtcctttttactttctattgaggatga 213
            |||||||||||| ||||| | || |||||||||  ||||||| | ||||||||||| ||
Sbjct: 360 taatgatgatgaaacaaaagtcgctgagatagaggactttttattctctattgaggagga 419

                                     
Query: 214 gaaaatttctctaatgagcaaaatca 239
           ||||| ||||||  ||||||||||||
Sbjct: 420 gaaaaattctcttttgagcaaaatca 445
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  131 bits (66), Expect = 1e-27
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                            
Query: 94       cacagaagagactccctctgttctcatcatagcattgcaatcatacaaagaggctttgat 153
                ||||||||| |||||||||||| |  ||| |||||||||||||||||| || ||||||||
Sbjct: 24112394 cacagaagaaactccctctgttattgtcacagcattgcaatcatacaaggaagctttgat 24112453

                                                                            
Query: 154      gaatgatgatgaagcaaaaattgcagagatagagtcctttttactttctattgaggatga 213
                 |||||||||||| ||||| | || |||||||||  ||||||| | ||||||||||| ||
Sbjct: 24112454 taatgatgatgaaacaaaagtcgctgagatagaggactttttattctctattgaggagga 24112513

                                          
Query: 214      gaaaatttctctaatgagcaaaatca 239
                ||||| ||||||  ||||||||||||
Sbjct: 24112514 gaaaaattctcttttgagcaaaatca 24112539
to top
>dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1004_A05
          Length = 174290

 Score =  131 bits (66), Expect = 1e-27
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                         
Query: 94    cacagaagagactccctctgttctcatcatagcattgcaatcatacaaagaggctttgat 153
             ||||||||| |||||||||||| |  ||| |||||||||||||||||| || ||||||||
Sbjct: 71135 cacagaagaaactccctctgttattgtcacagcattgcaatcatacaaggaagctttgat 71194

                                                                         
Query: 154   gaatgatgatgaagcaaaaattgcagagatagagtcctttttactttctattgaggatga 213
              |||||||||||| ||||| | || |||||||||  ||||||| | ||||||||||| ||
Sbjct: 71195 taatgatgatgaaacaaaagtcgctgagatagaggactttttattctctattgaggagga 71254

                                       
Query: 214   gaaaatttctctaatgagcaaaatca 239
             ||||| ||||||  ||||||||||||
Sbjct: 71255 gaaaaattctcttttgagcaaaatca 71280
to top
>gb|AY105803.1| Zea mays PCO143734 mRNA sequence
          Length = 1421

 Score =  107 bits (54), Expect = 2e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                       
Query: 155 aatgatgatgaagcaaaaattgcagagatagagtcctttttactttctattgaggatgag 214
           ||||||||||||||||||  ||| |||||||||||||||||||||||||| |||||||||
Sbjct: 467 aatgatgatgaagcaaaagctgctgagatagagtcctttttactttctatcgaggatgag 526

                                         
Query: 215 aaaatttctctaatgagcaaaatcactgct 244
           ||||  |||||  ||| |||||||||||||
Sbjct: 527 aaaaactctcttttgaacaaaatcactgct 556



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                      
Query: 4   gaggccgacgagtctgcgcagnacggccacgcaggaggatacagaaactgaagttactg 62
           |||||||||||| | |||||| ||||| ||||||||||||  |||||| ||||||||||
Sbjct: 317 gaggccgacgaggccgcgcag-acggcgacgcaggaggatttagaaaccgaagttactg 374
to top
>ref|NM_203147.1| Arabidopsis thaliana ATARP9 (ACTIN-RELATED PROTEIN 9); protein
           binding AT5G43500 (ATARP9) transcript variant
           AT5G43500.2 mRNA, complete cds
          Length = 1961

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 205 tgaggatgagaaaatttctct 225
           |||||||||||||||||||||
Sbjct: 431 tgaggatgagaaaatttctct 451
to top
>ref|NM_123716.2| Arabidopsis thaliana ATARP9 (ACTIN-RELATED PROTEIN 9); protein
           binding AT5G43500 (ATARP9) transcript variant
           AT5G43500.1 mRNA, complete cds
          Length = 2187

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 205 tgaggatgagaaaatttctct 225
           |||||||||||||||||||||
Sbjct: 657 tgaggatgagaaaatttctct 677
to top
>gb|AE008591.1| Rickettsia conorii str. Malish 7, section 23 of 114 of the complete
            genome
          Length = 11906

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 156  atgatgatgaagcaaaaattg 176
            |||||||||||||||||||||
Sbjct: 2462 atgatgatgaagcaaaaattg 2482
to top
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic
              sequence
          Length = 346809

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 221044 ggctttgatgaatgatgatga 221064
to top
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103
              genomic sequence
          Length = 341361

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 224043 ggctttgatgaatgatgatga 224063
to top
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic
              sequence
          Length = 265420

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 224208 ggctttgatgaatgatgatga 224228
to top
>gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
              sequence
          Length = 338517

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 220345 ggctttgatgaatgatgatga 220365
to top
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401
              genomic sequence
          Length = 351341

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 235965 ggctttgatgaatgatgatga 235985
to top
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
              sequence
          Length = 363675

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 235767 ggctttgatgaatgatgatga 235787
to top
>gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
              sequence
          Length = 328871

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 221329 ggctttgatgaatgatgatga 221349
to top
>gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B080101/HLA-Cw070101 genomic
              sequence
          Length = 338544

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 232009 ggctttgatgaatgatgatga 232029
to top
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
              sequence
          Length = 336776

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 214872 ggctttgatgaatgatgatga 214892
to top
>gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B080101/HLA-Cw070101 genomic
              sequence
          Length = 342745

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 212622 ggctttgatgaatgatgatga 212642
to top
>emb|AL773544.5| Human DNA sequence from clone DAQB-185I1 on chromosome 6 Contains the
             C6orf15 gene for chromosome 6 open reading frame 15, the
             CDSN gene for corneodesmosin, the PSORS1C1 gene for
             psoriasis susceptibility 1 candidate 1, the PSORS1C2 gene
             for psoriasis susceptibility 1 candidate 2, the POLR2LP
             pseudogene for polymerase (RNA) II (DNA directed)
             polypeptide L, the C6orf18 gene for chromosome 6 open
             reading frame 18, the TCF19 gene for transcription factor
             19 (SC1), the POU5F1 gene for POU domain, class 5,
             transcription factor 1, the PSORS1C3 gene for psoriasis
             susceptibility 1 candidate 3, and 1 CpG island, complete
             sequence
          Length = 113388

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 76804 ggctttgatgaatgatgatga 76784
to top
>emb|AL662844.12| Human DNA sequence from clone XXbac-299F13 on chromosome 6 contains the
             gene for STG protein, the CDSN gene for corneodesmosin,
             the gene for SEEK1 protein, the gene for SPR1 protein, the
             gene for HCR, the TCF19 gene for transcription factor 19,
             the POU5F1 gene for POU domain, class 5, transcription
             factor 1, a putative novel transcript and four CpG
             islands, complete sequence
          Length = 204298

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 94468 ggctttgatgaatgatgatga 94448
to top
>emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chromosome 6 contains the
             gene for HCR, the TCF19 gene for  transcription factor 19,
             the POU5F1 gene for POU domain, class 5, transcription
             factor 1, a putative novel transcript, the HLA-C gene for
             major histocompatibility complex, class I, C, a ubiquitin
             specific protease 8 (USP8) pseudogene, a ribosomal protein
             L3 (RPL3) pseudogene, a WAS protein family, member 3
             (WASF3) pseudogene and  three CpG islands, complete
             sequence
          Length = 168887

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 16127 ggctttgatgaatgatgatga 16107
to top
>emb|BX571657.1| Wolinella succinogenes, complete genome; segment 1/7
          Length = 347961

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 128   ttgcaatcatacaaagaggct 148
             |||||||||||||||||||||
Sbjct: 98699 ttgcaatcatacaaagaggct 98679
to top
>emb|CR847794.5| Human DNA sequence from clone DAMA-213L4 on chromosome 6, complete
             sequence
          Length = 59046

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 13111 ggctttgatgaatgatgatga 13091
to top
>emb|CR759815.3| Human DNA sequence from clone DAMC-88G10 on chromosome 6, complete
             sequence
          Length = 102782

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 21617 ggctttgatgaatgatgatga 21597
to top
>emb|CR753819.5| Human DNA sequence from clone DADB-141O4 on chromosome 6, complete
             sequence
          Length = 81418

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 76187 ggctttgatgaatgatgatga 76167
to top
>dbj|AB202104.1| Homo sapiens C6orf18 gene for chromosome 6 open reading frame 18,
            complete cds
          Length = 15802

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 145  ggctttgatgaatgatgatga 165
            |||||||||||||||||||||
Sbjct: 2914 ggctttgatgaatgatgatga 2934
to top
>gb|AY057568.1| Arabidopsis thaliana AT5g43500/MWF20_22 mRNA, complete cds
          Length = 2129

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 205 tgaggatgagaaaatttctct 225
           |||||||||||||||||||||
Sbjct: 657 tgaggatgagaaaatttctct 677
to top
>gb|AC148703.1| Macaca mulatta Major Histocompatibility Complex BAC MMU326I17, complete
              sequence
          Length = 175689

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 120504 ggctttgatgaatgatgatga 120484
to top
>gb|AC148691.1| Macaca mulatta Major Histocompatibility Complex BAC MMU234G08, complete
              sequence
          Length = 200068

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 152852 ggctttgatgaatgatgatga 152832
to top
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 145     ggctttgatgaatgatgatga 165
               |||||||||||||||||||||
Sbjct: 1294403 ggctttgatgaatgatgatga 1294423
to top
>emb|BX831574.1|CNS09ZS3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH16ZC02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1897

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 205 tgaggatgagaaaatttctct 225
           |||||||||||||||||||||
Sbjct: 431 tgaggatgagaaaatttctct 451
to top
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 145    ggctttgatgaatgatgatga 165
              |||||||||||||||||||||
Sbjct: 787100 ggctttgatgaatgatgatga 787120
to top
>dbj|AK117749.1| Arabidopsis thaliana At5g43500 mRNA for putative actin, complete
           cds, clone: RAFL17-43-K02
          Length = 1924

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 205 tgaggatgagaaaatttctct 225
           |||||||||||||||||||||
Sbjct: 394 tgaggatgagaaaatttctct 414
to top
>dbj|AB025638.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWF20
          Length = 91193

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 205   tgaggatgagaaaatttctct 225
             |||||||||||||||||||||
Sbjct: 85971 tgaggatgagaaaatttctct 85991
to top
>gb|AC004195.1|AC004195 Homo sapiens clone UWGC:y24c027 from 6p21, complete sequence
          Length = 40878

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 10441 ggctttgatgaatgatgatga 10461
to top
>dbj|AB088104.1| Homo sapiens HCR gene for tricohyalin homologue, complete cds
          Length = 15814

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 145  ggctttgatgaatgatgatga 165
            |||||||||||||||||||||
Sbjct: 2914 ggctttgatgaatgatgatga 2934
to top
>dbj|AB029343.1| Homo sapiens HCR (a-helix coiled-coil rod homologue) gene, complete
            cds
          Length = 14483

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 145  ggctttgatgaatgatgatga 165
            |||||||||||||||||||||
Sbjct: 1940 ggctttgatgaatgatgatga 1960
to top
>dbj|AB023059.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region,
             clone:TY1G9, complete sequence
          Length = 27494

 Score = 42.1 bits (21), Expect = 0.84
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 145   ggctttgatgaatgatgatga 165
             |||||||||||||||||||||
Sbjct: 21455 ggctttgatgaatgatgatga 21475
to top
>ref|XM_809954.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506957.120) partial mRNA
          Length = 6354

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 140  aaagaggctttgatgaatga 159
            ||||||||||||||||||||
Sbjct: 1822 aaagaggctttgatgaatga 1841
to top
>gb|AC124529.3| Mus musculus BAC clone RP23-411I8 from chromosome 3, complete sequence
          Length = 192341

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   tacaaagaggctttgatgaa 156
             ||||||||||||||||||||
Sbjct: 59786 tacaaagaggctttgatgaa 59805
to top
>ref|XM_760343.1| Theileria parva strain Muguga hypothetical protein (TP02_0868)
            partial mRNA
          Length = 4140

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 53   gaagttactgaggacactgt 72
            ||||||||||||||||||||
Sbjct: 2344 gaagttactgaggacactgt 2363
to top
>emb|AL445649.15| Human DNA sequence from clone RP11-381O6 on chromosome 13, complete
              sequence
          Length = 190126

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    atgatgaagcaaaaattgca 178
              ||||||||||||||||||||
Sbjct: 117958 atgatgaagcaaaaattgca 117939
to top
>emb|AL157883.15| Human DNA sequence from clone RP11-360J12 on chromosome 9q21.12-21.32
             Contains an orthodenticle homolog 2 (Drosophila) (OTX2)
             pseudogene, complete sequence
          Length = 176870

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   agcattgcaatcatacaaag 143
             ||||||||||||||||||||
Sbjct: 45163 agcattgcaatcatacaaag 45182
to top
>gb|AF537190.1| Gallus gallus inducible nitric oxide synthase gene, partial cds
          Length = 494

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 38  gaggatacagaaactgaagt 57
           ||||||||||||||||||||
Sbjct: 185 gaggatacagaaactgaagt 166
to top
>gb|AC091305.9| Homo sapiens chromosome 18, clone RP11-644A7, complete sequence
          Length = 118401

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   atgaagcaaaaattgcagag 181
             ||||||||||||||||||||
Sbjct: 69486 atgaagcaaaaattgcagag 69505
to top
>dbj|AB210142.1| Pan troglodytes HCR gene for a-helix coiled-coil rod homologue,
            complete cds, cell_line: Ericka
          Length = 15840

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 146  gctttgatgaatgatgatga 165
            ||||||||||||||||||||
Sbjct: 2911 gctttgatgaatgatgatga 2930
to top
>dbj|AB210141.1| Pan troglodytes HCR gene for a-helix coiled-coil rod homologue,
            complete cds, cell_line: Borie
          Length = 15840

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 146  gctttgatgaatgatgatga 165
            ||||||||||||||||||||
Sbjct: 2911 gctttgatgaatgatgatga 2930
to top
>gb|AC114648.25| Mus musculus chromosome 8, clone RP24-144H17, complete sequence
          Length = 171191

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    ttctgtgggcacagaagaga 104
             ||||||||||||||||||||
Sbjct: 38432 ttctgtgggcacagaagaga 38413
to top
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    gctttgatgaatgatgatga 165
              ||||||||||||||||||||
Sbjct: 358081 gctttgatgaatgatgatga 358100
to top
>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete
             sequences
          Length = 203521

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   aaaatcactgctttggatgc 252
             ||||||||||||||||||||
Sbjct: 86834 aaaatcactgctttggatgc 86815
to top
>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    aaaatcactgctttggatgc 252
              ||||||||||||||||||||
Sbjct: 281548 aaaatcactgctttggatgc 281529
to top
>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     gcaggaggatacagaaactg 53
              ||||||||||||||||||||
Sbjct: 377594 gcaggaggatacagaaactg 377613
to top
>dbj|AP000228.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region,
             clone:R49K20, complete sequence
          Length = 75698

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   aaaatcactgctttggatgc 252
             ||||||||||||||||||||
Sbjct: 75050 aaaatcactgctttggatgc 75031
to top
>dbj|AP000140.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone
             B2291C14-R44F3, segment 5/10, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   aaaatcactgctttggatgc 252
             ||||||||||||||||||||
Sbjct: 80844 aaaatcactgctttggatgc 80825
to top
>dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related, B2291C14-T1533
             region, segment 5/7
          Length = 161014

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 233   aaaatcactgctttggatgc 252
             ||||||||||||||||||||
Sbjct: 80844 aaaatcactgctttggatgc 80825


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,998,491
Number of Sequences: 3902068
Number of extensions: 2998491
Number of successful extensions: 69770
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69637
Number of HSP's gapped (non-prelim): 133
length of query: 257
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 235
effective length of database: 17,147,199,772
effective search space: 4029591946420
effective search space used: 4029591946420
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top