ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bags33k09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT017621.1| Zea mays clone EL01N0435E12.c mRNA sequence Length = 1144 Score = 178 bits (90), Expect = 6e-42 Identities = 167/193 (86%) Strand = Plus / Plus Query: 79 atggaactccctaccaagggcggcttcagcttcgacctgtgccgcaggaacgccatgctg 138 ||||| ||||| |||||||||| ||||||||||||||||||||| ||||| ||||||| Sbjct: 112 atggatctcccggccaagggcgggttcagcttcgacctgtgccgccggaacaacatgctg 171 Query: 139 gagaagacgggccacaagatgcccgggttcaggaagaccgggactaccatcgncggtctc 198 ||||||| || | |||| | || || ||||||||||||||||| ||||||| ||| ||| Sbjct: 172 gagaagaacgggctcaaggtcccgggattcaggaagaccgggacaaccatcgtcggcctc 231 Query: 199 gtgtttacggatggagttgttcttggggcagacacaagggcgaccgagggtcctatagtt 258 || ||| |||||| |||||||||||||||||||||||||| || ||||| || |||||| Sbjct: 232 gtctttcaggatggggttgttcttggggcagacacaagggcaactgagggccccatagtt 291 Query: 259 gctgataagaact 271 ||||||||||||| Sbjct: 292 gctgataagaact 304
>gb|AY105052.1| Zea mays PCO138078 mRNA sequence Length = 1368 Score = 170 bits (86), Expect = 1e-39 Identities = 166/193 (86%) Strand = Plus / Plus Query: 79 atggaactccctaccaagggcggcttcagcttcgacctgtgccgcaggaacgccatgctg 138 ||||| ||||| |||||||||| ||||||||||||||||| ||| ||||| ||||||| Sbjct: 206 atggatctcccggccaagggcgggttcagcttcgacctgtgtcgccggaacaacatgctg 265 Query: 139 gagaagacgggccacaagatgcccgggttcaggaagaccgggactaccatcgncggtctc 198 ||||||| || | |||| | || || ||||||||||||||||| ||||||| ||| ||| Sbjct: 266 gagaagaacggactcaaggtcccgggattcaggaagaccgggacaaccatcgtcggcctc 325 Query: 199 gtgtttacggatggagttgttcttggggcagacacaagggcgaccgagggtcctatagtt 258 || ||| |||||| |||||||||||||||||||||||||| || ||||| || |||||| Sbjct: 326 gtctttcaggatggggttgttcttggggcagacacaagggcaactgagggccccatagtt 385 Query: 259 gctgataagaact 271 ||||||||||||| Sbjct: 386 gctgataagaact 398
>dbj|AK103126.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119N09, full insert sequence Length = 1195 Score = 143 bits (72), Expect = 3e-31 Identities = 173/207 (83%) Strand = Plus / Plus Query: 65 ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 124 ||||||||||| ||| ||| ||||| | |||||||| ||||||| |||| ||| | Sbjct: 216 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 275 Query: 125 ggaacgccatgctggagaagacgggccacaagatgcccgggttcaggaagaccgggacta 184 ||||||||||||| | | ||| |||| |||||||| |||||| ||||||||||||| Sbjct: 276 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 335 Query: 185 ccatcgncggtctcgtgtttacggatggagttgttcttggggcagacacaagggcgaccg 244 |||||| |||| | || ||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 336 ccatcgtcggtttggtctttcaggatggtgttgttcttggggcagacacgagggccaccg 395 Query: 245 agggtcctatagttgctgataagaact 271 ||||||||||||||||||||||||||| Sbjct: 396 agggtcctatagttgctgataagaact 422
>dbj|AB026564.1| Oryza sativa (japonica cultivar-group) OsPBB1 mRNA for beta 2 subunit of 20S proteasome, complete cds Length = 1122 Score = 143 bits (72), Expect = 3e-31 Identities = 173/207 (83%) Strand = Plus / Plus Query: 65 ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 124 ||||||||||| ||| ||| ||||| | |||||||| ||||||| |||| ||| | Sbjct: 109 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 168 Query: 125 ggaacgccatgctggagaagacgggccacaagatgcccgggttcaggaagaccgggacta 184 ||||||||||||| | | ||| |||| |||||||| |||||| ||||||||||||| Sbjct: 169 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 228 Query: 185 ccatcgncggtctcgtgtttacggatggagttgttcttggggcagacacaagggcgaccg 244 |||||| |||| | || ||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 229 ccatcgtcggtttggtctttcaggatggtgttgttcttggggcagacacgagggccaccg 288 Query: 245 agggtcctatagttgctgataagaact 271 ||||||||||||||||||||||||||| Sbjct: 289 agggtcctatagttgctgataagaact 315
>ref|XM_476072.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 819 Score = 139 bits (70), Expect = 5e-30 Identities = 171/205 (83%) Strand = Plus / Plus Query: 67 atggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgcagg 126 ||||||||| ||| ||| ||||| | |||||||| ||||||| |||| ||| ||| Sbjct: 1 atggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcgagg 60 Query: 127 aacgccatgctggagaagacgggccacaagatgcccgggttcaggaagaccgggactacc 186 ||||||||||| | | ||| |||| |||||||| |||||| ||||||||||||||| Sbjct: 61 aacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggactacc 120 Query: 187 atcgncggtctcgtgtttacggatggagttgttcttggggcagacacaagggcgaccgag 246 |||| |||| | || ||| |||||| |||||||||||||||||||| ||||| |||||| Sbjct: 121 atcgtcggtttggtctttcaggatggtgttgttcttggggcagacacgagggccaccgag 180 Query: 247 ggtcctatagttgctgataagaact 271 ||||||||||||||||||||||||| Sbjct: 181 ggtcctatagttgctgataagaact 205
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 105 bits (53), Expect = 7e-20 Identities = 62/65 (95%) Strand = Plus / Plus Query: 207 ggatggagttgttcttggggcagacacaagggcgaccgagggtcctatagttgctgataa 266 |||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| Sbjct: 5278640 ggatggtgttgttcttggggcagacacgagggccaccgagggtcctatagttgctgataa 5278699 Query: 267 gaact 271 ||||| Sbjct: 5278700 gaact 5278704 Score = 56.0 bits (28), Expect = 6e-05 Identities = 105/131 (80%) Strand = Plus / Plus Query: 65 ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 124 ||||||||||| ||| ||| ||||| | |||||||| ||||||| |||| ||| | Sbjct: 5278011 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 5278070 Query: 125 ggaacgccatgctggagaagacgggccacaagatgcccgggttcaggaagaccgggacta 184 ||||||||||||| | | ||| |||| |||||||| |||||| ||||||||||||| Sbjct: 5278071 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 5278130 Query: 185 ccatcgncggt 195 |||||| |||| Sbjct: 5278131 ccatcgtcggt 5278141
>gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1097_A12, complete sequence Length = 88725 Score = 105 bits (53), Expect = 7e-20 Identities = 62/65 (95%) Strand = Plus / Plus Query: 207 ggatggagttgttcttggggcagacacaagggcgaccgagggtcctatagttgctgataa 266 |||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| Sbjct: 15341 ggatggtgttgttcttggggcagacacgagggccaccgagggtcctatagttgctgataa 15400 Query: 267 gaact 271 ||||| Sbjct: 15401 gaact 15405 Score = 56.0 bits (28), Expect = 6e-05 Identities = 105/131 (80%) Strand = Plus / Plus Query: 65 ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 124 ||||||||||| ||| ||| ||||| | |||||||| ||||||| |||| ||| | Sbjct: 14712 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 14771 Query: 125 ggaacgccatgctggagaagacgggccacaagatgcccgggttcaggaagaccgggacta 184 ||||||||||||| | | ||| |||| |||||||| |||||| ||||||||||||| Sbjct: 14772 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 14831 Query: 185 ccatcgncggt 195 |||||| |||| Sbjct: 14832 ccatcgtcggt 14842
>gb|AF011889.1|AF011889 Human Xq28 cosmids U126G1, U142F2, U69B6, U145C10, U169A5, U84H1, U24D12, U80A7, U153E6, L35485, and R7-163A8 containing iduronate 2-sulfatase gene and pseudogene, complete sequence Length = 326663 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 52 gagatcagccgcaggatggcc 72 ||||||||||||||||||||| Sbjct: 78362 gagatcagccgcaggatggcc 78342
>emb|CT574592.2| Pan troglodytes chromosome X clone PTB-082B15 map Xq28, complete sequence Length = 228540 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 52 gagatcagccgcaggatggcc 72 ||||||||||||||||||||| Sbjct: 38105 gagatcagccgcaggatggcc 38085
>emb|CT573418.2| Pan troglodytes chromosome X clone PTB-046H01 map Xq28, complete sequence Length = 161084 Score = 42.1 bits (21), Expect = 0.89 Identities = 21/21 (100%) Strand = Plus / Minus Query: 52 gagatcagccgcaggatggcc 72 ||||||||||||||||||||| Sbjct: 123648 gagatcagccgcaggatggcc 123628
>gb|BC098835.1| Rattus norvegicus proteasome (prosome, macropain) subunit, beta type 10, mRNA (cDNA clone MGC:112890 IMAGE:7378841), complete cds Length = 1021 Score = 42.1 bits (21), Expect = 0.89 Identities = 29/32 (90%) Strand = Plus / Plus Query: 172 aagaccgggactaccatcgncggtctcgtgtt 203 ||||||||||||||||||| ||| || ||||| Sbjct: 223 aagaccgggactaccatcgccggacttgtgtt 254
>ref|NM_001025637.1| Rattus norvegicus proteasome (prosome, macropain) subunit, beta type 10 (Psmb10), mRNA Length = 1021 Score = 42.1 bits (21), Expect = 0.89 Identities = 29/32 (90%) Strand = Plus / Plus Query: 172 aagaccgggactaccatcgncggtctcgtgtt 203 ||||||||||||||||||| ||| || ||||| Sbjct: 223 aagaccgggactaccatcgccggacttgtgtt 254
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tccgagatcagccgcaggat 68 |||||||||||||||||||| Sbjct: 1791914 tccgagatcagccgcaggat 1791895
>emb|AJ132364.1|PST132364 Pseudomonas stutzeri (strain JM300) pilD, pilC, pilB and pilA genes and ORFX Length = 5625 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 agccgcaggatggccggatc 77 |||||||||||||||||||| Sbjct: 4045 agccgcaggatggccggatc 4026
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tccgagatcagccgcaggat 68 |||||||||||||||||||| Sbjct: 4616281 tccgagatcagccgcaggat 4616300
>gb|AC006067.4| Arabidopsis thaliana chromosome 2 clone T13P21 map mi398, complete sequence Length = 126337 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Plus Query: 220 cttggggcagacacaagggcgaccgagggtcctatagttgctgataagaact 271 |||||||| || ||| |||| || || || ||||| |||||||||||||||| Sbjct: 73800 cttggggctgatacacgggcaactgaagggcctattgttgctgataagaact 73851
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tccgagatcagccgcaggat 68 |||||||||||||||||||| Sbjct: 1789597 tccgagatcagccgcaggat 1789578
>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome Length = 2056416 Score = 40.1 bits (20), Expect = 3.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 51 cgagatcagccgcaggatggccggatcg 78 ||||||||||||||| ||||||||||| Sbjct: 880828 cgagatcagccgcagtctggccggatcg 880801 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,369,465 Number of Sequences: 3902068 Number of extensions: 1369465 Number of successful extensions: 21019 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 20873 Number of HSP's gapped (non-prelim): 135 length of query: 271 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 249 effective length of database: 17,147,199,772 effective search space: 4269652743228 effective search space used: 4269652743228 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
