ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags33c20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_187515.1| Oryza sativa (japonica cultivar-group), predic... 335 1e-88
2ref|XM_471952.1| Oryza sativa (japonica cultivar-group), predic... 198 2e-47
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 147 5e-32
4gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome... 147 5e-32
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 147 5e-32
6emb|AL606625.3|OSJN00039 Oryza sativa genomic DNA, chromosome 4,... 119 1e-23
7dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
8ref|XM_469442.1| Oryza sativa (japonica cultivar-group), mRNA 72 3e-09
9dbj|AK100023.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 3e-09
10gb|AY111816.1| Zea mays CL17799_1 mRNA sequence 68 4e-08
11gb|AC133334.8| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genom... 62 2e-06
12ref|XM_677013.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 0.57
13gb|AY357949.1| Arabidopsis thaliana ecotype C24 YDA (At1g63700) ... 44 0.57
14gb|AY357948.1| Arabidopsis thaliana ecotype Landsberg erecta YDA... 44 0.57
15gb|AC011622.6|AC011622 Arabidopsis thaliana chromosome 1 BAC F24... 44 0.57
16dbj|AB167408.1| Lotus japonicus LjM3Kalpha mRNA for mitogen-acti... 44 0.57
17ref|NM_105047.1| Arabidopsis thaliana YDA (YODA); ATP binding / ... 42 2.3
18gb|AC102417.11| Mus musculus chromosome 3, clone RP24-499J8, com... 42 2.3
19ref|NM_002578.2| Homo sapiens p21 (CDKN1A)-activated kinase 3 (P... 42 2.3
20gb|AC151710.1| Pan troglodytes chromosome X clone PTB-084K12 map... 42 2.3
21gb|AC121148.8| Mus musculus chromosome 3, clone RP24-369K4, comp... 42 2.3
22gb|AY357947.1| Arabidopsis thaliana ecotype Columbia YDA (At1g63... 42 2.3
23emb|AL117326.5|HSDJ944N9 Human DNA sequence from clone RP5-944N9... 42 2.3
24emb|CR857841.1| Pongo pygmaeus mRNA; cDNA DKFZp459P0162 (from cl... 42 2.3
25dbj|AK128022.1| Homo sapiens cDNA FLJ46141 fis, clone TESTI20529... 42 2.3
26dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.3
27gb|AC154745.3| Mus musculus BAC clone RP24-395F6 from chromosome... 42 2.3
28ref|NM_001009039.1| Pan troglodytes p21 (CDKN1A)-activated kinas... 42 2.3
29gb|AF155651.1|AF155651 Human P21 activated kinase-3 mRNA 42 2.3
30dbj|AP004080.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.3
31dbj|AB102661.1| Pongo pygmaeus PAK3 mRNA for p21-activated kinas... 42 2.3
32dbj|AB102660.1| Pan troglodytes PAK3 mRNA for p21-activated kina... 42 2.3
33dbj|AB102659.1| Homo sapiens PAK3 mRNA for p21-activated kinase ... 42 2.3
34dbj|AB102310.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
35dbj|AB102309.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
36dbj|AB102308.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
37dbj|AB102307.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
38dbj|AB102306.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
39dbj|AB102305.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
40dbj|AB102304.1| Pan troglodytes troglodytes PAK3 gene for p21-ac... 42 2.3
41dbj|AB102303.1| Pan troglodytes verus PAK3 gene for p21-activate... 42 2.3
42dbj|AB102302.1| Pan troglodytes verus PAK3 gene for p21-activate... 42 2.3
43dbj|AB102301.1| Pan troglodytes verus PAK3 gene for p21-activate... 42 2.3
44dbj|AB102300.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
45dbj|AB102299.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
46dbj|AB102298.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
47dbj|AB102297.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
48dbj|AB102296.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
49dbj|AB102295.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
50dbj|AB102294.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
51dbj|AB102293.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
52dbj|AB102292.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
53dbj|AB102291.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
54dbj|AB102290.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
55dbj|AB102289.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
56dbj|AB102288.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
57dbj|AB102287.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
58dbj|AB102286.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
59dbj|AB102285.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
60dbj|AB102284.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
61dbj|AB102283.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
62dbj|AB102282.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
63dbj|AB102281.1| Homo sapiens PAK3 gene for p21-activated kinase ... 42 2.3
64dbj|AK062956.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.3
65gb|AC161802.7| Mus musculus chromosome 5, clone RP23-477G6, comp... 42 2.3
66gb|AF068864.1|AF068864 Homo sapiens p21-activated kinase 3 (PAK3... 42 2.3
67emb|CT025551.9| Mouse DNA sequence from clone RP23-414I10 on chr... 42 2.3
68ref|NM_019210.1| Rattus norvegicus p21 (CDKN1A)-activated kinase... 40 8.9
69gb|AY347273.1| Caenorhabditis elegans AMP-activated protein kina... 40 8.9
70gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 8.9
71ref|XM_866375.1| PREDICTED: Bos taurus similar to p21-activated ... 40 8.9
72ref|XM_878292.1| PREDICTED: Bos taurus similar to p21-activated ... 40 8.9
73ref|XM_614322.2| PREDICTED: Bos taurus similar to p21-activated ... 40 8.9
74gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 8.9
75gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 8.9
76gb|AF312696.1| Pneumocystis carinii mekk mRNA, complete cds 40 8.9
77gb|U58726.1| Caenorhabditis elegans cosmid T01C8, complete sequence 40 8.9
78gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome... 40 8.9
79gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, co... 40 8.9
80gb|AC115904.13| Mus musculus chromosome 16, clone RP24-472P22, c... 40 8.9
81ref|XM_858510.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
82ref|XM_846255.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
83ref|XM_858464.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
84ref|XM_858440.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
85ref|XM_858419.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
86ref|XM_858402.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
87ref|XM_858383.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
88ref|XM_858358.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
89ref|XM_858334.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
90ref|XM_549187.2| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
91ref|XM_858293.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
92ref|XM_858267.1| PREDICTED: Canis familiaris similar to Serine/t... 40 8.9
93gb|AC124807.11| Mus musculus chromosome 3, clone RP23-137I13, co... 40 8.9
94gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, co... 40 8.9
95emb|Z48717.1|CET10B9 Caenorhabditis elegans Cosmid T10B9, comple... 40 8.9
96gb|AC112926.7| Mus musculus chromosome 3, clone RP23-215M7, comp... 40 8.9
97gb|CP000001.1| Bacillus cereus E33L, complete genome 40 8.9
98gb|AC157596.5| Mus musculus BAC clone RP23-240B9 from chromosome... 40 8.9
99gb|AC112001.6| Rattus norvegicus 2 BAC CH230-54E3 (Children's Ho... 40 8.9
100emb|AL163975.1|ATT15B3 Arabidopsis thaliana DNA chromosome 3, BA... 40 8.9
101emb|AL161533.2|ATCHRIV33 Arabidopsis thaliana DNA chromosome 4, ... 40 8.9
102emb|AL049638.1|ATF16J13 Arabidopsis thaliana DNA chromosome 4, B... 40 8.9
103emb|AL590616.23| Mouse DNA sequence from clone RP23-231P12 on ch... 40 8.9
104emb|BX294132.11| Zebrafish DNA sequence from clone DKEY-16L23 in... 40 8.9
105gb|AC151277.3| Mus musculus BAC clone RP24-170B23 from chromosom... 40 8.9
106ref|NM_001029697.2| Caenorhabditis elegans AMP-Activated Kinase ... 40 8.9
107ref|NM_078309.3| Caenorhabditis elegans AMP-Activated Kinase fam... 40 8.9
108ref|NM_078310.4| Caenorhabditis elegans AMP-Activated Kinase fam... 40 8.9
109ref|XM_396779.2| PREDICTED: Apis mellifera similar to mitogen-ac... 40 8.9
110gb|AC027123.7| Homo sapiens chromosome 3 clone RP11-392M7 map 3p... 40 8.9
111emb|BX088584.14| Mouse DNA sequence from clone RP23-390E22 on ch... 40 8.9
112gb|AC158475.2| Postia placenta clone JGIACWS-5G19, complete sequ... 40 8.9
113gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 8.9
114gb|U33314.1|RNU33314 Rattus norvegicus serine/threonine kinase b... 40 8.9
115gb|U67304.1|DMU67304 Drosophila melanogaster 70 kDa S6 kinase (S... 40 8.9
116gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 8.9
117gb|AY621630.1| Penicillium marneffei PakA (pakA) gene, complete cds 40 8.9
118gb|AC093471.8| Mus musculus chromosome 3, clone RP23-29M11, comp... 40 8.9
119emb|AL731679.9| Mouse DNA sequence from clone RP23-33J13 on chro... 40 8.9
120gb|AC157476.2| Mus musculus BAC clone RP24-174O15 from chromosom... 40 8.9

>ref|NM_187515.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1983

 Score =  335 bits (169), Expect = 1e-88
 Identities = 340/397 (85%)
 Strand = Plus / Plus

                                                                        
Query: 5    aatggatccgtgaagcttgcggactttggacttgctaagcagacctccaaactcaatgtg 64
            |||||||||||||| ||||| |||||||| ||||||||| |||   ||||| |||| |||
Sbjct: 1357 aatggatccgtgaaacttgctgactttggtcttgctaaggagattaccaaattcaacgtg 1416

                                                                        
Query: 65   ctaaaatcatgcaaaggaactgtatattggatggcacctgaggtcgtcaatcccaagaag 124
            || ||||| |||||||||||||| |||||||||||||||||||| |||||||||||||  
Sbjct: 1417 cttaaatcgtgcaaaggaactgtttattggatggcacctgaggttgtcaatcccaagaca 1476

                                                                        
Query: 125  acatatggacctgcagctgatatatggagtctgggttgcacggtcctagagatgttgaca 184
            ||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 1477 acatatggacctgaagctgatatatggagtctgggctgcacagtcctagagatgttgaca 1536

                                                                        
Query: 185  cgtcaacttccctatccagatctggagtggacacaagccctatacaggattggcaagggt 244
            ||||||||||||||||| | |||||| |||||||||||  ||||||||||||| ||||| 
Sbjct: 1537 cgtcaacttccctatcctggtctggaatggacacaagctttatacaggattgggaagggg 1596

                                                                        
Query: 245  gaaccaccagcaattccaagtgctatttcgaaggaagctcgagatttcattagccagtgt 304
            ||||||||||||||||||| |    |||| | ||| ||||| ||||| || |||||||| 
Sbjct: 1597 gaaccaccagcaattccaaattgcctttctagggatgctcgtgattttataagccagtgc 1656

                                                                        
Query: 305  gtaaaaccgaacccagaagacagaccttctgcgtccaaacttctggaccatccctttgtg 364
            |||||||| || ||  |||||||||| |||||  | || || ||||| ||||| || || 
Sbjct: 1657 gtaaaacccaatccgcaagacagaccctctgcagcaaagctgctggagcatcctttcgtt 1716

                                                 
Query: 365  aatagatctatgcgatctatacggtccatgaggacat 401
            ||||| || ||||| || ||| |||| ||||||||||
Sbjct: 1717 aataggtcaatgcggtcgataaggtctatgaggacat 1753



to top

>ref|XM_471952.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 447

 Score =  198 bits (100), Expect = 2e-47
 Identities = 301/368 (81%)
 Strand = Plus / Plus

                                                                       
Query: 4   gaatggatccgtgaagcttgcggactttggacttgctaagcagacctccaaactcaatgt 63
           ||||||||| ||||| ||||| |||||||| |||||||||||||    |||| |||   |
Sbjct: 66  gaatggatctgtgaaacttgccgactttggtcttgctaagcagataaacaaattcagcat 125

                                                                       
Query: 64  gctaaaatcatgcaaaggaactgtatattggatggcacctgaggtcgtcaatcccaagaa 123
           ||| ||||||||  |||||| ||| |||||||||||||| ||||| ||||||||||||| 
Sbjct: 126 gcttaaatcatgtgaaggaagtgtttattggatggcacccgaggttgtcaatcccaagag 185

                                                                       
Query: 124 gacatatggacctgcagctgatatatggagtctgggttgcacggtcctagagatgttgac 183
           |||||||||| | |||||||||||||||||||| |||||||| ||||| |||||||||||
Sbjct: 186 gacatatggaacggcagctgatatatggagtctcggttgcacagtcctggagatgttgac 245

                                                                       
Query: 184 acgtcaacttccctatccagatctggagtggacacaagccctatacaggattggcaaggg 243
           ||||||||| || || ||| || | || ||| |||||||  |||  | ||| || | |||
Sbjct: 246 acgtcaactgccttacccaaatttagaatgggcacaagctttatttaagatcggaagggg 305

                                                                       
Query: 244 tgaaccaccagcaattccaagtgctatttcgaaggaagctcgagatttcattagccagtg 303
           ||||||||||||||| ||||      |||| ||||| ||||| |||||||| ||||||||
Sbjct: 306 tgaaccaccagcaatcccaaaatacctttcaaaggaggctcgtgatttcataagccagtg 365

                                                                       
Query: 304 tgtaaaaccgaacccagaagacagaccttctgcgtccaaacttctggaccatccctttgt 363
           | | | |||  | || || || ||||||||||| |||||| |  |||||||||| || ||
Sbjct: 366 tttgagaccatatccggatgatagaccttctgcatccaaattattggaccatcctttcgt 425

                   
Query: 364 gaatagat 371
           ||||||||
Sbjct: 426 gaatagat 433



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  147 bits (74), Expect = 5e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                           
Query: 105     aggtcgtcaatcccaagaagacatatggacctgcagctgatatatggagtctgggttgca 164
               |||| |||||||||||||  ||||||||||||| ||||||||||||||||||||| ||||
Sbjct: 8546567 aggttgtcaatcccaagacaacatatggacctgaagctgatatatggagtctgggctgca 8546508

                                                             
Query: 165     cggtcctagagatgttgacacgtcaacttccctatccagatctgga 210
               | ||||||||||||||||||||||||||||||||||| | ||||||
Sbjct: 8546507 cagtcctagagatgttgacacgtcaacttccctatcctggtctgga 8546462



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 152/188 (80%)
 Strand = Plus / Minus

                                                                           
Query: 214     gacacaagccctatacaggattggcaagggtgaaccaccagcaattccaagtgctatttc 273
               |||||||||  ||||||||||||| ||||| ||||||||||||||||||| |    ||||
Sbjct: 8546317 gacacaagctttatacaggattgggaagggggaaccaccagcaattccaaattgcctttc 8546258

                                                                           
Query: 274     gaaggaagctcgagatttcattagccagtgtgtaaaaccgaacccagaagacagaccttc 333
                | ||| ||||| ||||| || |||||||| |||||||| || ||  |||||||||| ||
Sbjct: 8546257 tagggatgctcgtgattttataagccagtgcgtaaaacccaatccgcaagacagaccctc 8546198

                                                                           
Query: 334     tgcgtccaaacttctggaccatccctttgtgaatagatctatgcgatctatacggtccat 393
               |||  | || || ||||| ||||| || || ||||| || ||||| || ||| |||| ||
Sbjct: 8546197 tgcagcaaagctgctggagcatcctttcgttaataggtcaatgcggtcgataaggtctat 8546138

                       
Query: 394     gaggacat 401
               ||||||||
Sbjct: 8546137 gaggacat 8546130



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                         
Query: 51      ccaaactcaatgtgctaaaatcatgcaaaggaactgtatattggatggcacctgaggt 108
               ||||| |||| ||||| ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 8546964 ccaaattcaacgtgcttaaatcgtgcaaaggaactgtttattggatggcacctgaggt 8546907



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                       
Query: 70       atcatgcaaaggaactgtatattggatggcacctgaggt 108
                |||||||||||||| ||| ||||||||||||||||||||
Sbjct: 27976508 atcatgcaaaggaagtgtttattggatggcacctgaggt 27976470



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 5       aatggatccgtgaagcttgcggactttggacttgctaag 43
               |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 8547120 aatggatccgtgaaacttgctgactttggtcttgctaag 8547082



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 281      gctcgagatttcattagccagtgtgta 307
                |||| ||||||||||||||||||||||
Sbjct: 27975242 gctcaagatttcattagccagtgtgta 27975216



to top

>gb|AC135206.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1041F02,
             complete sequence
          Length = 137327

 Score =  147 bits (74), Expect = 5e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                         
Query: 105   aggtcgtcaatcccaagaagacatatggacctgcagctgatatatggagtctgggttgca 164
             |||| |||||||||||||  ||||||||||||| ||||||||||||||||||||| ||||
Sbjct: 27539 aggttgtcaatcccaagacaacatatggacctgaagctgatatatggagtctgggctgca 27480

                                                           
Query: 165   cggtcctagagatgttgacacgtcaacttccctatccagatctgga 210
             | ||||||||||||||||||||||||||||||||||| | ||||||
Sbjct: 27479 cagtcctagagatgttgacacgtcaacttccctatcctggtctgga 27434



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 152/188 (80%)
 Strand = Plus / Minus

                                                                         
Query: 214   gacacaagccctatacaggattggcaagggtgaaccaccagcaattccaagtgctatttc 273
             |||||||||  ||||||||||||| ||||| ||||||||||||||||||| |    ||||
Sbjct: 27289 gacacaagctttatacaggattgggaagggggaaccaccagcaattccaaattgcctttc 27230

                                                                         
Query: 274   gaaggaagctcgagatttcattagccagtgtgtaaaaccgaacccagaagacagaccttc 333
              | ||| ||||| ||||| || |||||||| |||||||| || ||  |||||||||| ||
Sbjct: 27229 tagggatgctcgtgattttataagccagtgcgtaaaacccaatccgcaagacagaccctc 27170

                                                                         
Query: 334   tgcgtccaaacttctggaccatccctttgtgaatagatctatgcgatctatacggtccat 393
             |||  | || || ||||| ||||| || || ||||| || ||||| || ||| |||| ||
Sbjct: 27169 tgcagcaaagctgctggagcatcctttcgttaataggtcaatgcggtcgataaggtctat 27110

                     
Query: 394   gaggacat 401
             ||||||||
Sbjct: 27109 gaggacat 27102



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                       
Query: 51    ccaaactcaatgtgctaaaatcatgcaaaggaactgtatattggatggcacctgaggt 108
             ||||| |||| ||||| ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 27936 ccaaattcaacgtgcttaaatcgtgcaaaggaactgtttattggatggcacctgaggt 27879



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 5     aatggatccgtgaagcttgcggactttggacttgctaag 43
             |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 28092 aatggatccgtgaaacttgctgactttggtcttgctaag 28054



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  147 bits (74), Expect = 5e-32
 Identities = 98/106 (92%)
 Strand = Plus / Minus

                                                                           
Query: 105     aggtcgtcaatcccaagaagacatatggacctgcagctgatatatggagtctgggttgca 164
               |||| |||||||||||||  ||||||||||||| ||||||||||||||||||||| ||||
Sbjct: 8544402 aggttgtcaatcccaagacaacatatggacctgaagctgatatatggagtctgggctgca 8544343

                                                             
Query: 165     cggtcctagagatgttgacacgtcaacttccctatccagatctgga 210
               | ||||||||||||||||||||||||||||||||||| | ||||||
Sbjct: 8544342 cagtcctagagatgttgacacgtcaacttccctatcctggtctgga 8544297



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 152/188 (80%)
 Strand = Plus / Minus

                                                                           
Query: 214     gacacaagccctatacaggattggcaagggtgaaccaccagcaattccaagtgctatttc 273
               |||||||||  ||||||||||||| ||||| ||||||||||||||||||| |    ||||
Sbjct: 8544152 gacacaagctttatacaggattgggaagggggaaccaccagcaattccaaattgcctttc 8544093

                                                                           
Query: 274     gaaggaagctcgagatttcattagccagtgtgtaaaaccgaacccagaagacagaccttc 333
                | ||| ||||| ||||| || |||||||| |||||||| || ||  |||||||||| ||
Sbjct: 8544092 tagggatgctcgtgattttataagccagtgcgtaaaacccaatccgcaagacagaccctc 8544033

                                                                           
Query: 334     tgcgtccaaacttctggaccatccctttgtgaatagatctatgcgatctatacggtccat 393
               |||  | || || ||||| ||||| || || ||||| || ||||| || ||| |||| ||
Sbjct: 8544032 tgcagcaaagctgctggagcatcctttcgttaataggtcaatgcggtcgataaggtctat 8543973

                       
Query: 394     gaggacat 401
               ||||||||
Sbjct: 8543972 gaggacat 8543965



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                         
Query: 51      ccaaactcaatgtgctaaaatcatgcaaaggaactgtatattggatggcacctgaggt 108
               ||||| |||| ||||| ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 8544799 ccaaattcaacgtgcttaaatcgtgcaaaggaactgtttattggatggcacctgaggt 8544742



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                       
Query: 70       atcatgcaaaggaactgtatattggatggcacctgaggt 108
                |||||||||||||| ||| ||||||||||||||||||||
Sbjct: 28067832 atcatgcaaaggaagtgtttattggatggcacctgaggt 28067794



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                      
Query: 5       aatggatccgtgaagcttgcggactttggacttgctaag 43
               |||||||||||||| ||||| |||||||| |||||||||
Sbjct: 8544955 aatggatccgtgaaacttgctgactttggtcttgctaag 8544917



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 281      gctcgagatttcattagccagtgtgta 307
                |||| ||||||||||||||||||||||
Sbjct: 28066566 gctcaagatttcattagccagtgtgta 28066540



to top

>emb|AL606625.3|OSJN00039 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032I19,
              complete sequence
          Length = 145383

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                          
Query: 105    aggtcgtcaatcccaagaagacatatggacctgcagctgatatatggagtctgggttgca 164
              |||| ||||||||||||| |||||||||| | |||||||||||||||||||| |||||||
Sbjct: 120106 aggttgtcaatcccaagaggacatatggaacggcagctgatatatggagtctcggttgca 120047

                                          
Query: 165    cggtcctagagatgttgacacgtcaact 192
              | ||||| ||||||||||||||||||||
Sbjct: 120046 cagtcctggagatgttgacacgtcaact 120019



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 4      gaatggatccgtgaagcttgcggactttggacttgctaagcag 46
              ||||||||| ||||| ||||| |||||||| ||||||||||||
Sbjct: 120699 gaatggatctgtgaaacttgccgactttggtcttgctaagcag 120657



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 103/129 (79%)
 Strand = Plus / Minus

                                                                          
Query: 241    gggtgaaccaccagcaattccaagtgctatttcgaaggaagctcgagatttcattagcca 300
              |||||||||||||||||| ||||      |||| ||||| ||||| |||||||| |||||
Sbjct: 119804 gggtgaaccaccagcaatcccaaaatacctttcaaaggaggctcgtgatttcataagcca 119745

                                                                          
Query: 301    gtgtgtaaaaccgaacccagaagacagaccttctgcgtccaaacttctggaccatccctt 360
              |||| | | |||  | || || || ||||||||||| |||||| |  |||||||||| ||
Sbjct: 119744 gtgtttgagaccatatccggatgatagaccttctgcatccaaattattggaccatccttt 119685

                       
Query: 361    tgtgaatag 369
               ||||||||
Sbjct: 119684 cgtgaatag 119676



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 63     tgctaaaatcatgcaaaggaactgtatattggatggcacctgaggt 108
              |||| ||||||||  |||||| ||| |||||||||||||| |||||
Sbjct: 120533 tgcttaaatcatgtgaaggaagtgtttattggatggcacccgaggt 120488



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 105      aggtcgtcaatcccaagaagacatatggacctgcagctgatatatggagtctgggttgca 164
                |||| ||||||||||||| |||||||||| | |||||||||||||||||||| |||||||
Sbjct: 16035893 aggttgtcaatcccaagaggacatatggaacggcagctgatatatggagtctcggttgca 16035834

                                            
Query: 165      cggtcctagagatgttgacacgtcaact 192
                | ||||| ||||||||||||||||||||
Sbjct: 16035833 cagtcctggagatgttgacacgtcaact 16035806



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                           
Query: 4        gaatggatccgtgaagcttgcggactttggacttgctaagcag 46
                ||||||||| ||||| ||||| |||||||| ||||||||||||
Sbjct: 16036486 gaatggatctgtgaaacttgccgactttggtcttgctaagcag 16036444



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 103/129 (79%)
 Strand = Plus / Minus

                                                                            
Query: 241      gggtgaaccaccagcaattccaagtgctatttcgaaggaagctcgagatttcattagcca 300
                |||||||||||||||||| ||||      |||| ||||| ||||| |||||||| |||||
Sbjct: 16035591 gggtgaaccaccagcaatcccaaaatacctttcaaaggaggctcgtgatttcataagcca 16035532

                                                                            
Query: 301      gtgtgtaaaaccgaacccagaagacagaccttctgcgtccaaacttctggaccatccctt 360
                |||| | | |||  | || || || ||||||||||| |||||| |  |||||||||| ||
Sbjct: 16035531 gtgtttgagaccatatccggatgatagaccttctgcatccaaattattggaccatccttt 16035472

                         
Query: 361      tgtgaatag 369
                 ||||||||
Sbjct: 16035471 cgtgaatag 16035463



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                              
Query: 63       tgctaaaatcatgcaaaggaactgtatattggatggcacctgaggt 108
                |||| ||||||||  |||||| ||| |||||||||||||| |||||
Sbjct: 16036320 tgcttaaatcatgtgaaggaagtgtttattggatggcacccgaggt 16036275



to top

>ref|XM_469442.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2448

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                        
Query: 70   atcatgcaaaggaactgtatattggatggcacctgaggtcgtcaatcccaagaagacata 129
            |||||||||||||| ||| |||||||||||||||||||| || ||||| || || |||||
Sbjct: 1773 atcatgcaaaggaagtgtttattggatggcacctgaggttgttaatcctaaaaaaacata 1832

                                                
Query: 130  tggacctgcagctgatatatggagtctgggttgcac 165
            ||| ||    |||||||| |||||||| || |||||
Sbjct: 1833 tgggccccaggctgatatttggagtcttggctgcac 1868



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 281  gctcgagatttcattagccagtgtgta 307
            |||| ||||||||||||||||||||||
Sbjct: 1984 gctcaagatttcattagccagtgtgta 2010



to top

>dbj|AK100023.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013145O20, full
            insert sequence
          Length = 2449

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                        
Query: 70   atcatgcaaaggaactgtatattggatggcacctgaggtcgtcaatcccaagaagacata 129
            |||||||||||||| ||| |||||||||||||||||||| || ||||| || || |||||
Sbjct: 1774 atcatgcaaaggaagtgtttattggatggcacctgaggttgttaatcctaaaaaaacata 1833

                                                
Query: 130  tggacctgcagctgatatatggagtctgggttgcac 165
            ||| ||    |||||||| |||||||| || |||||
Sbjct: 1834 tgggccccaggctgatatttggagtcttggctgcac 1869



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 281  gctcgagatttcattagccagtgtgta 307
            |||| ||||||||||||||||||||||
Sbjct: 1985 gctcaagatttcattagccagtgtgta 2011



to top

>gb|AY111816.1| Zea mays CL17799_1 mRNA sequence
          Length = 584

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccagcaattccaagtgctatttcgaaggaagctcgagatttcattagccagtgtgtaaaa 310
           |||||||||||||   || |||||| ||| ||||| ||||| || |||| ||||||||||
Sbjct: 516 ccagcaattccaaacactctttcgagggatgctcgcgattttataagccggtgtgtaaaa 457

                                             
Query: 311 ccgaacccagaagacagaccttctgcgtccaaac 344
           ||||| || ||||||||||| || || |||||||
Sbjct: 456 ccgaatccggaagacagaccgtcagcatccaaac 423



to top

>gb|AC133334.8| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genomic sequence, complete
             sequence
          Length = 133889

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                    
Query: 70    atcatgcaaaggaactgtatattggatggcacctgaggt 108
             |||||||||||||| ||| ||||||||||||||||||||
Sbjct: 48518 atcatgcaaaggaagtgtttattggatggcacctgaggt 48556



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 281   gctcgagatttcattagccagtgtgta 307
             |||| ||||||||||||||||||||||
Sbjct: 49784 gctcaagatttcattagccagtgtgta 49810



to top

>ref|XM_677013.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8836.2), mRNA
          Length = 2478

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 89   tattggatggcacctgaggtcgtcaa 114
            ||||||||||| ||||||||||||||
Sbjct: 2137 tattggatggcgcctgaggtcgtcaa 2162



to top

>gb|AY357949.1| Arabidopsis thaliana ecotype C24 YDA (At1g63700) gene, complete cds
          Length = 4031

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 88   atattggatggcacctgaggtc 109
            ||||||||||||||||||||||
Sbjct: 2587 atattggatggcacctgaggtc 2608



to top

>gb|AY357948.1| Arabidopsis thaliana ecotype Landsberg erecta YDA (At1g63700) gene,
            complete cds
          Length = 4568

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 88   atattggatggcacctgaggtc 109
            ||||||||||||||||||||||
Sbjct: 2704 atattggatggcacctgaggtc 2725



to top

>gb|AC011622.6|AC011622 Arabidopsis thaliana chromosome 1 BAC F24D7 genomic sequence, complete
             sequence
          Length = 87575

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 88    atattggatggcacctgaggtc 109
             ||||||||||||||||||||||
Sbjct: 42291 atattggatggcacctgaggtc 42312



to top

>dbj|AB167408.1| Lotus japonicus LjM3Kalpha mRNA for mitogen-activated kinase kinase
            kinase alpha, complete cds
          Length = 2331

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 71   tcatgcaaaggaactgtatattggatggcacctgaggt 108
            |||| |||||||| |  |||||||||||||||||||||
Sbjct: 1237 tcattcaaaggaagtccatattggatggcacctgaggt 1274



to top

>ref|NM_105047.1| Arabidopsis thaliana YDA (YODA); ATP binding / kinase/ protein
            kinase/ protein serine/threonine kinase/ protein-tyrosine
            kinase AT1G63700 (YDA) mRNA, complete cds
          Length = 2652

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1689 atattggatggcacctgaggt 1709



to top

>gb|AC102417.11| Mus musculus chromosome 3, clone RP24-499J8, complete sequence
          Length = 161101

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 551   catctcttgtattttgttagt 571
             |||||||||||||||||||||
Sbjct: 76106 catctcttgtattttgttagt 76086



to top

>ref|NM_002578.2| Homo sapiens p21 (CDKN1A)-activated kinase 3 (PAK3), mRNA
          Length = 2516

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1674 atattggatggcacctgaggt 1694



to top

>gb|AC151710.1| Pan troglodytes chromosome X clone PTB-084K12 map human ortholog q23,
              complete sequence
          Length = 174741

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 88     atattggatggcacctgaggt 108
              |||||||||||||||||||||
Sbjct: 135577 atattggatggcacctgaggt 135597



to top

>gb|AC121148.8| Mus musculus chromosome 3, clone RP24-369K4, complete sequence
          Length = 209365

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 551   catctcttgtattttgttagt 571
             |||||||||||||||||||||
Sbjct: 30375 catctcttgtattttgttagt 30355



to top

>gb|AY357947.1| Arabidopsis thaliana ecotype Columbia YDA (At1g63700) mRNA, complete
            cds
          Length = 3287

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1770 atattggatggcacctgaggt 1790



to top

>emb|AL117326.5|HSDJ944N9 Human DNA sequence from clone RP5-944N9 on chromosome Xq22.3-23
             Contains part of the PAK3 gene for p21 (CDKN1A)-activated
             kinase 3 and a pseudogene similar to part of chromosome 14
             open reading frame 111 (C14orf111), complete sequence
          Length = 82394

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 88    atattggatggcacctgaggt 108
             |||||||||||||||||||||
Sbjct: 65214 atattggatggcacctgaggt 65234



to top

>emb|CR857841.1| Pongo pygmaeus mRNA; cDNA DKFZp459P0162 (from clone DKFZp459P0162)
          Length = 2396

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1522 atattggatggcacctgaggt 1542



to top

>dbj|AK128022.1| Homo sapiens cDNA FLJ46141 fis, clone TESTI2052985, highly  similar
            to Serine/threonine-protein kinase PAK 3 (EC 2.7.1.-)
          Length = 2407

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 2011 atattggatggcacctgaggt 2031



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 129      atggacctgcagctgatatatggagtctgggttgcac 165
                |||||||| |||| |||||||||||||| || |||||
Sbjct: 32479997 atggacctccagcagatatatggagtcttggctgcac 32480033



to top

>gb|AC154745.3| Mus musculus BAC clone RP24-395F6 from chromosome 13, complete sequence
          Length = 144172

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 551   catctcttgtattttgttagt 571
             |||||||||||||||||||||
Sbjct: 56474 catctcttgtattttgttagt 56494



to top

>ref|NM_001009039.1| Pan troglodytes p21 (CDKN1A)-activated kinase 3 (PAK3), mRNA
          Length = 1680

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1323 atattggatggcacctgaggt 1343



to top

>gb|AF155651.1|AF155651 Human P21 activated kinase-3 mRNA
          Length = 2505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1669 atattggatggcacctgaggt 1689



to top

>dbj|AP004080.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1079_F11
          Length = 122402

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 129   atggacctgcagctgatatatggagtctgggttgcac 165
             |||||||| |||| |||||||||||||| || |||||
Sbjct: 83390 atggacctccagcagatatatggagtcttggctgcac 83426



to top

>dbj|AB102661.1| Pongo pygmaeus PAK3 mRNA for p21-activated kinase 3, complete cds
          Length = 1680

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1323 atattggatggcacctgaggt 1343



to top

>dbj|AB102660.1| Pan troglodytes PAK3 mRNA for p21-activated kinase 3, complete cds
          Length = 1680

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1323 atattggatggcacctgaggt 1343



to top

>dbj|AB102659.1| Homo sapiens PAK3 mRNA for p21-activated kinase 3, complete cds
          Length = 1680

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1323 atattggatggcacctgaggt 1343



to top

>dbj|AB102310.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C10
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102309.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C9
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102308.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C8
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102307.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C7
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102306.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C6
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102305.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C5
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102304.1| Pan troglodytes troglodytes PAK3 gene for p21-activated kinase 3,
            partial cds, isolate: C4
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102303.1| Pan troglodytes verus PAK3 gene for p21-activated kinase 3, partial
            cds, isolate: C3
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102302.1| Pan troglodytes verus PAK3 gene for p21-activated kinase 3, partial
            cds, isolate: C2
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102301.1| Pan troglodytes verus PAK3 gene for p21-activated kinase 3, partial
            cds, isolate: C1
          Length = 1409

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1257 atattggatggcacctgaggt 1277



to top

>dbj|AB102300.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X21
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102299.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X20
          Length = 1406

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1254 atattggatggcacctgaggt 1274



to top

>dbj|AB102298.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X19
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102297.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X18
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102296.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X17
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102295.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X16
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102294.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X15
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102293.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X14
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102292.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X13
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102291.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X12
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102290.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X10
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102289.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X9
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102288.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X8
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102287.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X7
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102286.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X6
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102285.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X5
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102284.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X4
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102283.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X3
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102282.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X2
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AB102281.1| Homo sapiens PAK3 gene for p21-activated kinase 3, partial cds,
            isolate: X1
          Length = 1408

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1256 atattggatggcacctgaggt 1276



to top

>dbj|AK062956.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-D01, full
           insert sequence
          Length = 911

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 129 atggacctgcagctgatatatggagtctgggttgcac 165
           |||||||| |||| |||||||||||||| || |||||
Sbjct: 81  atggacctccagcagatatatggagtcttggctgcac 117



to top

>gb|AC161802.7| Mus musculus chromosome 5, clone RP23-477G6, complete sequence
          Length = 176484

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 63    tgctaaaatcatgcaaaggaa 83
             |||||||||||||||||||||
Sbjct: 58538 tgctaaaatcatgcaaaggaa 58558



to top

>gb|AF068864.1|AF068864 Homo sapiens p21-activated kinase 3 (PAK3) mRNA, complete cds
          Length = 1635

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 88   atattggatggcacctgaggt 108
            |||||||||||||||||||||
Sbjct: 1278 atattggatggcacctgaggt 1298



to top

>emb|CT025551.9| Mouse DNA sequence from clone RP23-414I10 on chromosome 13, complete
             sequence
          Length = 196737

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 551   catctcttgtattttgttagt 571
             |||||||||||||||||||||
Sbjct: 66323 catctcttgtattttgttagt 66343



to top

>ref|NM_019210.1| Rattus norvegicus p21 (CDKN1A)-activated kinase 3 (Pak3), mRNA
          Length = 2157

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1339 tattggatggcacctgaggt 1358



to top

>gb|AY347273.1| Caenorhabditis elegans AMP-activated protein kinase alpha subunit 1
           mRNA, complete cds
          Length = 1875

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 14  gtgaagcttgcggactttggactt 37
           |||||| |||||||||||||||||
Sbjct: 670 gtgaagattgcggactttggactt 693



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     tgaaccaccagcaattccaa 263
               ||||||||||||||||||||
Sbjct: 4176321 tgaaccaccagcaattccaa 4176340



to top

>ref|XM_866375.1| PREDICTED: Bos taurus similar to p21-activated kinase 3, transcript
            variant 2 (LOC534526), mRNA
          Length = 2067

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1207 tattggatggcacctgaggt 1226



to top

>ref|XM_878292.1| PREDICTED: Bos taurus similar to p21-activated kinase 3, transcript
            variant 3 (LOC534526), mRNA
          Length = 2070

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1210 tattggatggcacctgaggt 1229



to top

>ref|XM_614322.2| PREDICTED: Bos taurus similar to p21-activated kinase 3, transcript
            variant 1 (LOC534526), mRNA
          Length = 2061

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1201 tattggatggcacctgaggt 1220



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     tgaaccaccagcaattccaa 263
               ||||||||||||||||||||
Sbjct: 4187164 tgaaccaccagcaattccaa 4187183



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     tgaaccaccagcaattccaa 263
               ||||||||||||||||||||
Sbjct: 4187536 tgaaccaccagcaattccaa 4187555



to top

>gb|AF312696.1| Pneumocystis carinii mekk mRNA, complete cds
          Length = 2472

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 78   aaggaactgtatattggatggcacctga 105
            ||||| |||| |||||||||||||||||
Sbjct: 2147 aaggatctgtttattggatggcacctga 2174



to top

>gb|U58726.1| Caenorhabditis elegans cosmid T01C8, complete sequence
          Length = 31931

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 14    gtgaagcttgcggactttggactt 37
             |||||| |||||||||||||||||
Sbjct: 25192 gtgaagattgcggactttggactt 25215



to top

>gb|AC125395.3| Mus musculus BAC clone RP23-213J1 from chromosome 14, complete sequence
          Length = 208938

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 552   atctcttgtattttgttagt 571
             ||||||||||||||||||||
Sbjct: 98462 atctcttgtattttgttagt 98481



to top

>gb|AC114593.12| Mus musculus chromosome 14, clone RP23-44B17, complete sequence
          Length = 210843

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 552    atctcttgtattttgttagt 571
              ||||||||||||||||||||
Sbjct: 100367 atctcttgtattttgttagt 100386



to top

>gb|AC115904.13| Mus musculus chromosome 16, clone RP24-472P22, complete sequence
          Length = 167938

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 336   cgtccaaacttctggaccat 355
             ||||||||||||||||||||
Sbjct: 48740 cgtccaaacttctggaccat 48721



to top

>ref|XM_858510.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 12 (LOC492067), mRNA
          Length = 2535

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1678 tattggatggcacctgaggt 1697



to top

>ref|XM_846255.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 2 (LOC492067), mRNA
          Length = 2613

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1756 tattggatggcacctgaggt 1775



to top

>ref|XM_858464.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 11 (LOC492067), mRNA
          Length = 2529

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1672 tattggatggcacctgaggt 1691



to top

>ref|XM_858440.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 10 (LOC492067), mRNA
          Length = 2676

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1819 tattggatggcacctgaggt 1838



to top

>ref|XM_858419.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 9 (LOC492067), mRNA
          Length = 2637

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1780 tattggatggcacctgaggt 1799



to top

>ref|XM_858402.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 8 (LOC492067), mRNA
          Length = 2649

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1792 tattggatggcacctgaggt 1811



to top

>ref|XM_858383.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 7 (LOC492067), mRNA
          Length = 2670

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1813 tattggatggcacctgaggt 1832



to top

>ref|XM_858358.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 6 (LOC492067), mRNA
          Length = 2532

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1675 tattggatggcacctgaggt 1694



to top

>ref|XM_858334.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 5 (LOC492067), mRNA
          Length = 2895

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1957 tattggatggcacctgaggt 1976



to top

>ref|XM_549187.2| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 1 (LOC492067), mRNA
          Length = 2525

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1668 tattggatggcacctgaggt 1687



to top

>ref|XM_858293.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 4 (LOC492067), mRNA
          Length = 2266

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1711 tattggatggcacctgaggt 1730



to top

>ref|XM_858267.1| PREDICTED: Canis familiaris similar to Serine/threonine-protein
            kinase PAK 3 (p21-activated kinase 3) (PAK-3) (Beta-PAK)
            (Oligophrenin-3), transcript variant 3 (LOC492067), mRNA
          Length = 2568

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1711 tattggatggcacctgaggt 1730



to top

>gb|AC124807.11| Mus musculus chromosome 3, clone RP23-137I13, complete sequence
          Length = 213113

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 552    atctcttgtattttgttagt 571
              ||||||||||||||||||||
Sbjct: 212410 atctcttgtattttgttagt 212429



to top

>gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, complete sequence
          Length = 264410

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 342    aacttctggaccatcccttt 361
              ||||||||||||||||||||
Sbjct: 155875 aacttctggaccatcccttt 155894



to top

>emb|Z48717.1|CET10B9 Caenorhabditis elegans Cosmid T10B9, complete sequence
          Length = 34881

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 561   attttgttagttgattcttt 580
             ||||||||||||||||||||
Sbjct: 16473 attttgttagttgattcttt 16492



to top

>gb|AC112926.7| Mus musculus chromosome 3, clone RP23-215M7, complete sequence
          Length = 222106

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 553   tctcttgtattttgttagtt 572
             ||||||||||||||||||||
Sbjct: 92152 tctcttgtattttgttagtt 92171



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     tgaaccaccagcaattccaa 263
               ||||||||||||||||||||
Sbjct: 4230633 tgaaccaccagcaattccaa 4230652



to top

>gb|AC157596.5| Mus musculus BAC clone RP23-240B9 from chromosome 16, complete sequence
          Length = 204275

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 336    cgtccaaacttctggaccat 355
              ||||||||||||||||||||
Sbjct: 176092 cgtccaaacttctggaccat 176073



to top

>gb|AC112001.6| Rattus norvegicus 2 BAC CH230-54E3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 225052

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 552    atctcttgtattttgttagt 571
              ||||||||||||||||||||
Sbjct: 110062 atctcttgtattttgttagt 110081



to top

>emb|AL163975.1|ATT15B3 Arabidopsis thaliana DNA chromosome 3, BAC clone T15B3
          Length = 114656

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 522   tccttgtaaacagcattttc 541
             ||||||||||||||||||||
Sbjct: 14130 tccttgtaaacagcattttc 14149



to top

>emb|AL161533.2|ATCHRIV33 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 33
          Length = 190026

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 128   tatggacctgcagctgatatatggagtctgggttgcacggtcctagagatgttgac 183
             |||||| || |||||||||||||||| || || || || || ||||| ||||||||
Sbjct: 66094 tatggaactccagctgatatatggagccttgggtgtactgtgctagaaatgttgac 66149



to top

>emb|AL049638.1|ATF16J13 Arabidopsis thaliana DNA chromosome 4, BAC clone  F16J13 (ESSA project)
          Length = 107600

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 128   tatggacctgcagctgatatatggagtctgggttgcacggtcctagagatgttgac 183
             |||||| || |||||||||||||||| || || || || || ||||| ||||||||
Sbjct: 42264 tatggaactccagctgatatatggagccttgggtgtactgtgctagaaatgttgac 42319



to top

>emb|AL590616.23| Mouse DNA sequence from clone RP23-231P12 on chromosome 13 Contains the
             gene for prolactin-like protein L and the Prlpa gene for
             prolactin-like protein A, complete sequence
          Length = 202629

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 552   atctcttgtattttgttagttgattctt 579
             ||||||||||||||||| ||||||||||
Sbjct: 43245 atctcttgtattttgtt-gttgattctt 43219



to top

>emb|BX294132.11| Zebrafish DNA sequence from clone DKEY-16L23 in linkage group 2,
             complete sequence
          Length = 166384

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   cttccctatccagatctgga 210
             ||||||||||||||||||||
Sbjct: 49833 cttccctatccagatctgga 49852



to top

>gb|AC151277.3| Mus musculus BAC clone RP24-170B23 from chromosome 17, complete
             sequence
          Length = 146255

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 551   catctcttgtattttgttag 570
             ||||||||||||||||||||
Sbjct: 71416 catctcttgtattttgttag 71397



to top

>ref|NM_001029697.2| Caenorhabditis elegans AMP-Activated Kinase family member (aak-2)
           (aak-2) mRNA, complete cds
          Length = 1877

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 14  gtgaagcttgcggactttggactt 37
           |||||| |||||||||||||||||
Sbjct: 672 gtgaagattgcggactttggactt 695



to top

>ref|NM_078309.3| Caenorhabditis elegans AMP-Activated Kinase family member (aak-2)
           (aak-2) mRNA, complete cds
          Length = 1883

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 14  gtgaagcttgcggactttggactt 37
           |||||| |||||||||||||||||
Sbjct: 672 gtgaagattgcggactttggactt 695



to top

>ref|NM_078310.4| Caenorhabditis elegans AMP-Activated Kinase family member (aak-2)
           (aak-2) mRNA, complete cds
          Length = 2384

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 14  gtgaagcttgcggactttggactt 37
           |||||| |||||||||||||||||
Sbjct: 672 gtgaagattgcggactttggactt 695



to top

>ref|XM_396779.2| PREDICTED: Apis mellifera similar to mitogen-activated protein
           kinase kinase kinase kinase 3 (LOC413334), mRNA
          Length = 2886

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 89  tattggatggcacctgaggt 108
           ||||||||||||||||||||
Sbjct: 541 tattggatggcacctgaggt 560



to top

>gb|AC027123.7| Homo sapiens chromosome 3 clone RP11-392M7 map 3p, complete sequence
          Length = 191566

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 191    cttccctatccagatctgga 210
              ||||||||||||||||||||
Sbjct: 116265 cttccctatccagatctgga 116284



to top

>emb|BX088584.14| Mouse DNA sequence from clone RP23-390E22 on chromosome 4, complete
             sequence
          Length = 146527

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 552   atctcttgtattttgttagt 571
             ||||||||||||||||||||
Sbjct: 37399 atctcttgtattttgttagt 37380



to top

>gb|AC158475.2| Postia placenta clone JGIACWS-5G19, complete sequence
          Length = 25716

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   aagcttgcggactttggact 36
            ||||||||||||||||||||
Sbjct: 5336 aagcttgcggactttggact 5355



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     tgaaccaccagcaattccaa 263
               ||||||||||||||||||||
Sbjct: 4187037 tgaaccaccagcaattccaa 4187056



to top

>gb|U33314.1|RNU33314 Rattus norvegicus serine/threonine kinase beta-PAK mRNA, complete cds
          Length = 2157

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   tattggatggcacctgaggt 108
            ||||||||||||||||||||
Sbjct: 1339 tattggatggcacctgaggt 1358



to top

>gb|U67304.1|DMU67304 Drosophila melanogaster 70 kDa S6 kinase (S6k) mRNA, complete cds
          Length = 2481

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 13   cgtgaagcttgcggactttggact 36
            |||||||||| |||||||||||||
Sbjct: 1218 cgtgaagcttacggactttggact 1241



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     tgaaccaccagcaattccaa 263
               ||||||||||||||||||||
Sbjct: 4134074 tgaaccaccagcaattccaa 4134093



to top

>gb|AY621630.1| Penicillium marneffei PakA (pakA) gene, complete cds
          Length = 4856

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 92   tggatggcacctgaggtcgt 111
            ||||||||||||||||||||
Sbjct: 3721 tggatggcacctgaggtcgt 3740



to top

>gb|AC093471.8| Mus musculus chromosome 3, clone RP23-29M11, complete sequence
          Length = 193703

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 552    atctcttgtattttgttagt 571
              ||||||||||||||||||||
Sbjct: 192725 atctcttgtattttgttagt 192706



to top

>emb|AL731679.9| Mouse DNA sequence from clone RP23-33J13 on chromosome X, complete
              sequence
          Length = 228007

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 560    tattttgttagttgattctt 579
              ||||||||||||||||||||
Sbjct: 194723 tattttgttagttgattctt 194704



to top

>gb|AC157476.2| Mus musculus BAC clone RP24-174O15 from chromosome 9, complete sequence
          Length = 161849

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 565   tgttagttgattctttaccg 584
             ||||||||||||||||||||
Sbjct: 97036 tgttagttgattctttaccg 97017


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,274,480
Number of Sequences: 3902068
Number of extensions: 5274480
Number of successful extensions: 143285
Number of sequences better than 10.0: 120
Number of HSP's better than 10.0 without gapping: 121
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 142723
Number of HSP's gapped (non-prelim): 564
length of query: 653
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 630
effective length of database: 17,143,297,704
effective search space: 10800277553520
effective search space used: 10800277553520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top