| Clone Name | bags33a17 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK103282.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033124M10, full insert sequence Length = 1650 Score = 276 bits (139), Expect = 8e-71 Identities = 244/278 (87%), Gaps = 1/278 (0%) Strand = Plus / Plus Query: 2 ctgtnatcagtgccgccagnaaaactctgggtcatcgtacaagatgctgtaattgccaga 61 |||| |||||||||| ||| |||||||| || |||| ||| || |||||||| ||||||| Sbjct: 721 ctgtcatcagtgccggcag-aaaactcttggccatcataccagctgctgtaaatgccaga 779 Query: 62 ttgtccaagggcagttctgcggagattgtttgtacatgaggtatggtgagaatgtgctgg 121 ||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| | Sbjct: 780 ttgtccaggggcagttctgtggggattgtttgtacatgaggtatggtgagaatgtgctcg 839 Query: 122 aagctaagagcaatcctaattggatatgtccggtttgtcgtggcatttgcaactgcagta 181 ||||||||| |||||| ||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 840 aagctaagaagaatcctgattggatatgtccagtttgtcgtggcatttgcaattgcagta 899 Query: 182 tctgcagaaccaagagaggatggttccctactggcaatgcataccggaaggttgtcagac 241 |||||||||| |||| ||||||||| || ||||| ||| || ||||||||||||| | Sbjct: 900 tctgcagaactaagaaaggatggtttccaactggtgctgcgtataggaaggttgtcagcc 959 Query: 242 ttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| || ||||| ||||| ||||| |||||| Sbjct: 960 ttgggtacaagtctgtggctcactatctcatcgcaaca 997
>dbj|AK064398.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-G10, full insert sequence Length = 1653 Score = 268 bits (135), Expect = 2e-68 Identities = 243/278 (87%), Gaps = 1/278 (0%) Strand = Plus / Plus Query: 2 ctgtnatcagtgccgccagnaaaactctgggtcatcgtacaagatgctgtaattgccaga 61 |||| |||||||||| ||| |||||||| || |||| ||| || |||||||| ||||||| Sbjct: 715 ctgtcatcagtgccggcag-aaaactcttggccatcataccagctgctgtaaatgccaga 773 Query: 62 ttgtccaagggcagttctgcggagattgtttgtacatgaggtatggtgagaatgtgctgg 121 ||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| | Sbjct: 774 ttgtccaggggcagttctgtggggattgtttgtacatgaggtatggtgagaatgtgctcg 833 Query: 122 aagctaagagcaatcctaattggatatgtccggtttgtcgtggcatttgcaactgcagta 181 ||||||||| |||||| ||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 834 aagctaagaagaatcctgattggatatgtccagtttgtcgtggcatttgcaattgcagta 893 Query: 182 tctgcagaaccaagagaggatggttccctactggcaatgcataccggaaggttgtcagac 241 |||||||||| |||| ||||||||| || ||||| ||| || ||||||||||||| | Sbjct: 894 tctgcagaactaagaaaggatggtttccaactggtgctgcgtataggaaggttgtcagcc 953 Query: 242 ttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| || ||||| |||| ||||| |||||| Sbjct: 954 ttgggtacaagtctgtggcttactatctcatcgcaaca 991
>gb|AC133291.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone P0542B04, complete sequence Length = 182823 Score = 151 bits (76), Expect = 3e-33 Identities = 106/116 (91%) Strand = Plus / Minus Query: 100 aggtatggtgagaatgtgctggaagctaagagcaatcctaattggatatgtccggtttgt 159 |||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||||| Sbjct: 170057 aggtatggtgagaatgtgctcgaagctaagaagaatcctgattggatatgtccagtttgt 169998 Query: 160 cgtggcatttgcaactgcagtatctgcagaaccaagagaggatggttccctactgg 215 |||||||||||||| ||||||||||||||||| |||| ||||||||| || ||||| Sbjct: 169997 cgtggcatttgcaattgcagtatctgcagaactaagaaaggatggtttccaactgg 169942 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 22 aaaactctgggtcatcgtacaagatgctgtaattgccagattgtccaagggcagttctgc 81 |||||||| || |||| ||| || |||||||| |||||||||||||| ||||||||||| Sbjct: 170761 aaaactcttggccatcataccagctgctgtaaatgccagattgtccaggggcagttctgt 170702 Query: 82 ggagattgtttgtacatgaggt 103 || ||||||||||||||||||| Sbjct: 170701 ggggattgtttgtacatgaggt 170680 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 230 aggttgtcagacttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| ||||||||||| || ||||| ||||| ||||| |||||| Sbjct: 169716 aggttgtcagccttgggtacaagtctgtggctcactatctcatcgcaaca 169667
>gb|AC109644.2| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone P0459F09, complete sequence Length = 143533 Score = 151 bits (76), Expect = 3e-33 Identities = 106/116 (91%) Strand = Plus / Plus Query: 100 aggtatggtgagaatgtgctggaagctaagagcaatcctaattggatatgtccggtttgt 159 |||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||||| Sbjct: 110657 aggtatggtgagaatgtgctcgaagctaagaagaatcctgattggatatgtccagtttgt 110716 Query: 160 cgtggcatttgcaactgcagtatctgcagaaccaagagaggatggttccctactgg 215 |||||||||||||| ||||||||||||||||| |||| ||||||||| || ||||| Sbjct: 110717 cgtggcatttgcaattgcagtatctgcagaactaagaaaggatggtttccaactgg 110772 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Plus Query: 22 aaaactctgggtcatcgtacaagatgctgtaattgccagattgtccaagggcagttctgc 81 |||||||| || |||| ||| || |||||||| |||||||||||||| ||||||||||| Sbjct: 109953 aaaactcttggccatcataccagctgctgtaaatgccagattgtccaggggcagttctgt 110012 Query: 82 ggagattgtttgtacatgaggt 103 || ||||||||||||||||||| Sbjct: 110013 ggggattgtttgtacatgaggt 110034 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 230 aggttgtcagacttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| ||||||||||| || ||||| ||||| ||||| |||||| Sbjct: 110998 aggttgtcagccttgggtacaagtctgtggctcactatctcatcgcaaca 111047
>gb|AC144559.1| Oryza sativa (japonica cultivar-group) chromosome 11 PAC clone P0459F09, complete sequence Length = 143533 Score = 151 bits (76), Expect = 3e-33 Identities = 106/116 (91%) Strand = Plus / Plus Query: 100 aggtatggtgagaatgtgctggaagctaagagcaatcctaattggatatgtccggtttgt 159 |||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||||| Sbjct: 110657 aggtatggtgagaatgtgctcgaagctaagaagaatcctgattggatatgtccagtttgt 110716 Query: 160 cgtggcatttgcaactgcagtatctgcagaaccaagagaggatggttccctactgg 215 |||||||||||||| ||||||||||||||||| |||| ||||||||| || ||||| Sbjct: 110717 cgtggcatttgcaattgcagtatctgcagaactaagaaaggatggtttccaactgg 110772 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Plus Query: 22 aaaactctgggtcatcgtacaagatgctgtaattgccagattgtccaagggcagttctgc 81 |||||||| || |||| ||| || |||||||| |||||||||||||| ||||||||||| Sbjct: 109953 aaaactcttggccatcataccagctgctgtaaatgccagattgtccaggggcagttctgt 110012 Query: 82 ggagattgtttgtacatgaggt 103 || ||||||||||||||||||| Sbjct: 110013 ggggattgtttgtacatgaggt 110034 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 230 aggttgtcagacttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| ||||||||||| || ||||| ||||| ||||| |||||| Sbjct: 110998 aggttgtcagccttgggtacaagtctgtggctcactatctcatcgcaaca 111047
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 151 bits (76), Expect = 3e-33 Identities = 106/116 (91%) Strand = Plus / Minus Query: 100 aggtatggtgagaatgtgctggaagctaagagcaatcctaattggatatgtccggtttgt 159 |||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||||| Sbjct: 20325547 aggtatggtgagaatgtgctcgaagctaagaagaatcctgattggatatgtccagtttgt 20325488 Query: 160 cgtggcatttgcaactgcagtatctgcagaaccaagagaggatggttccctactgg 215 |||||||||||||| ||||||||||||||||| |||| ||||||||| || ||||| Sbjct: 20325487 cgtggcatttgcaattgcagtatctgcagaactaagaaaggatggtttccaactgg 20325432 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 22 aaaactctgggtcatcgtacaagatgctgtaattgccagattgtccaagggcagttctgc 81 |||||||| || |||| ||| || |||||||| |||||||||||||| ||||||||||| Sbjct: 20326251 aaaactcttggccatcataccagctgctgtaaatgccagattgtccaggggcagttctgt 20326192 Query: 82 ggagattgtttgtacatgaggt 103 || ||||||||||||||||||| Sbjct: 20326191 ggggattgtttgtacatgaggt 20326170 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 230 aggttgtcagacttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| ||||||||||| || ||||| ||||| ||||| |||||| Sbjct: 20325206 aggttgtcagccttgggtacaagtctgtggctcactatctcatcgcaaca 20325157
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 151 bits (76), Expect = 3e-33 Identities = 106/116 (91%) Strand = Plus / Minus Query: 100 aggtatggtgagaatgtgctggaagctaagagcaatcctaattggatatgtccggtttgt 159 |||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||||| Sbjct: 20635784 aggtatggtgagaatgtgctcgaagctaagaagaatcctgattggatatgtccagtttgt 20635725 Query: 160 cgtggcatttgcaactgcagtatctgcagaaccaagagaggatggttccctactgg 215 |||||||||||||| ||||||||||||||||| |||| ||||||||| || ||||| Sbjct: 20635724 cgtggcatttgcaattgcagtatctgcagaactaagaaaggatggtttccaactgg 20635669 Score = 91.7 bits (46), Expect = 2e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 22 aaaactctgggtcatcgtacaagatgctgtaattgccagattgtccaagggcagttctgc 81 |||||||| || |||| ||| || |||||||| |||||||||||||| ||||||||||| Sbjct: 20636488 aaaactcttggccatcataccagctgctgtaaatgccagattgtccaggggcagttctgt 20636429 Query: 82 ggagattgtttgtacatgaggt 103 || ||||||||||||||||||| Sbjct: 20636428 ggggattgtttgtacatgaggt 20636407 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 230 aggttgtcagacttgggtacaaatcagtggcacactacctcattgcaaca 279 |||||||||| ||||||||||| || ||||| ||||| ||||| |||||| Sbjct: 20635443 aggttgtcagccttgggtacaagtctgtggctcactatctcatcgcaaca 20635394
>gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence Length = 931 Score = 111 bits (56), Expect = 3e-21 Identities = 131/156 (83%) Strand = Plus / Minus Query: 133 aatcctaattggatatgtccggtttgtcgtggcatttgcaactgcagtatctgcagaacc 192 |||||||| ||||||||||| ||||| |||||||| || || |||||| | |||||||| Sbjct: 916 aatcctaactggatatgtccagtttgccgtggcatctgtaattgcagtctatgcagaact 857 Query: 193 aagagaggatggttccctactggcaatgcataccggaaggttgtcagacttgggtacaaa 252 |||| |||||||||||||||||| ||| || |||||| || |||||||||||||| Sbjct: 856 aagaaaggatggttccctactgggtctgcgtataggaaggcgatcggacttgggtacaaa 797 Query: 253 tcagtggcacactacctcattgcaacaaatcgagca 288 || |||||||||| || ||||||||| |||||||| Sbjct: 796 tctgtggcacactttctaattgcaacacatcgagca 761
>gb|AC124301.6| Homo sapiens chromosome 11, clone RP11-358H18, complete sequence Length = 145713 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 431 agaaggaaggaaacatgaagaa 452 |||||||||||||||||||||| Sbjct: 80259 agaaggaaggaaacatgaagaa 80280
>gb|AC124056.8| Homo sapiens chromosome 11, clone RP5-1082L12, complete sequence Length = 115971 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 431 agaaggaaggaaacatgaagaa 452 |||||||||||||||||||||| Sbjct: 10058 agaaggaaggaaacatgaagaa 10037
>gb|AC004736.1|AC004736 Human Chromosome 11p14.3 PAC clone pDJ1082L12 containing KNCN1 and MyoD, complete sequence Length = 115958 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 431 agaaggaaggaaacatgaagaa 452 |||||||||||||||||||||| Sbjct: 105905 agaaggaaggaaacatgaagaa 105926
>gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence Length = 1952 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 532 actgctgatgtggtctgcaag 552 ||||||||||||||||||||| Sbjct: 1021 actgctgatgtggtctgcaag 1041
>gb|AC124987.9| Mus musculus chromosome 3, clone RP24-364E17, complete sequence Length = 165330 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 432 gaaggaaggaaacatgaagaa 452 ||||||||||||||||||||| Sbjct: 154779 gaaggaaggaaacatgaagaa 154799
>gb|AC109152.13| Mus musculus chromosome 18, clone RP23-166J4, complete sequence Length = 206894 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 448 aagaaggccaaggatgaagtc 468 ||||||||||||||||||||| Sbjct: 124574 aagaaggccaaggatgaagtc 124594
>emb|AL139044.15| Human DNA sequence from clone RP11-6B20 on chromosome 6 Contains the ITPR3 gene for inositol 1,4,5-triphosphate receptor type 3, a novel gene and the IHPK3 gene for inositol hexaphosphate kinase 3, complete sequence Length = 134250 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 431 agaaggaaggaaacatgaagaaggc 455 |||||||| |||||||||||||||| Sbjct: 87828 agaaggaaagaaacatgaagaaggc 87852
>emb|Z99707.1|ATAP21 Arabidopsis thaliana DNA chromosome 4, ESSA I AP2 contig fragment No. 1 Length = 206420 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 ttctgcggagattgtttgtacatgaggta 104 ||||| ||||||||||| ||||||||||| Sbjct: 82460 ttctgtggagattgtttatacatgaggta 82488
>gb|AC158763.6| Mus musculus chromosome 18, clone RP23-343L17, complete sequence Length = 204022 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 448 aagaaggccaaggatgaagtc 468 ||||||||||||||||||||| Sbjct: 197275 aagaaggccaaggatgaagtc 197255
>emb|AL161590.2|ATCHRIV86 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 86 Length = 198780 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 ttctgcggagattgtttgtacatgaggta 104 ||||| ||||||||||| ||||||||||| Sbjct: 172774 ttctgtggagattgtttatacatgaggta 172746
>gb|AC072044.9| Homo sapiens 3 BAC RP11-213O23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 178453 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 376 aagcaggatgctgatctgagcagca 400 |||||||| |||||||||||||||| Sbjct: 170493 aagcaggaagctgatctgagcagca 170517
>gb|AC005831.1| Homo sapiens 12p13.3 PAC RPCI5-1180D12 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 144515 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 418 ggtgaagttgagcagaaggaa 438 ||||||||||||||||||||| Sbjct: 102792 ggtgaagttgagcagaaggaa 102772
>dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome Length = 860631 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 409 aatgatgctggtgaagttgag 429 ||||||||||||||||||||| Sbjct: 470177 aatgatgctggtgaagttgag 470197
>gb|AC141632.4| Mus musculus BAC clone RP24-100G24 from 3, complete sequence Length = 180488 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 432 gaaggaaggaaacatgaagaa 452 ||||||||||||||||||||| Sbjct: 171277 gaaggaaggaaacatgaagaa 171257
>ref|NM_119874.3| Arabidopsis thaliana ubiquitin-protein ligase/ zinc ion binding AT4G37110 mRNA, complete cds Length = 1546 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 76 ttctgcggagattgtttgtacatgaggtatgg 107 ||||| ||||||||||| |||||||| ||||| Sbjct: 696 ttctgtggagattgtttatacatgagatatgg 727
>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence Length = 210051 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 173976 aagccaaggcccccaggaag 173957
>gb|AC152889.1| Ornithorhynchus anatinus chromosome UNK clone OABb-513A1, complete sequence Length = 115833 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 415 gctggtgaagttgagcagaa 434 |||||||||||||||||||| Sbjct: 67306 gctggtgaagttgagcagaa 67325
>ref|NM_053485.2| Rattus norvegicus S100 calcium binding protein A6 (calcyclin) (S100a6), mRNA Length = 402 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 283 aagccaaggcccccaggaag 264
>gb|AF140232.1| Rattus norvegicus calcium binding protein (S100A6) mRNA, complete cds Length = 402 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 283 aagccaaggcccccaggaag 264
>gb|AY159316.1| Homo sapiens lung cancer oncogene 7 mRNA, complete cds Length = 1616 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 202 aagccaaggcccccaggaag 221
>gb|BC009017.1| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:18233 IMAGE:4157026), complete cds Length = 679 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 539 aagccaaggcccccaggaag 520
>gb|AC161060.6| Mus musculus BAC clone RP23-69N10 from chromosome 6, complete sequence Length = 222363 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 230 aggttgtcagacttgggtacaaat 253 |||||||||| ||||||||||||| Sbjct: 125508 aggttgtcaggcttgggtacaaat 125485
>gb|AC112972.9| Mus musculus chromosome 15, clone RP24-450J12, complete sequence Length = 148336 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 ctggaagctaagagcaatcc 137 |||||||||||||||||||| Sbjct: 67391 ctggaagctaagagcaatcc 67410
>ref|XM_461876.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G08217g) partial mRNA Length = 3423 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 136 cctaattggatatgtccggtttgt 159 ||||||||||||||||| |||||| Sbjct: 1084 cctaattggatatgtcctgtttgt 1107
>gb|BC001431.2| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:2187 IMAGE:3138609), complete cds Length = 506 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 363 aagccaaggcccccaggaag 344
>gb|BC010774.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:18644 IMAGE:4219642), complete cds Length = 470 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 326 aagccaaggcccccaggaag 307
>ref|NM_011313.1| Mus musculus S100 calcium binding protein A6 (calcyclin) (S100a6), mRNA Length = 551 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 403 aagccaaggcccccaggaag 384
>ref|XM_676809.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8632.2), mRNA Length = 2982 Score = 40.1 bits (20), Expect = 7.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 447 gaagaaggccaaggatgaagtcaaggcc 474 |||||| |||||||||||| |||||||| Sbjct: 969 gaagaaagccaaggatgaactcaaggcc 996
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome Length = 6397126 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 ctgagcagcaacacgatgaa 410 |||||||||||||||||||| Sbjct: 272948 ctgagcagcaacacgatgaa 272929
>gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, complete sequence Length = 238123 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 tctgagcagcaacacgatga 409 |||||||||||||||||||| Sbjct: 137048 tctgagcagcaacacgatga 137067
>gb|BC003832.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA (cDNA clone MGC:6260 IMAGE:3490662), complete cds Length = 499 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 364 aagccaaggcccccaggaag 345
>ref|XM_388683.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08507.1) partial mRNA Length = 360 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 ggtcatcgtacaagatgctgtaat 54 |||||||||| ||||||||||||| Sbjct: 154 ggtcatcgtagaagatgctgtaat 131
>gb|AF549497.1| Mus musculus MC3T3-E1 calcyclin mRNA, complete cds Length = 445 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 309 aagccaaggcccccaggaag 290
>gb|AC128662.4| Mus musculus BAC clone RP24-440E3 from chromosome 6, complete sequence Length = 134729 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 230 aggttgtcagacttgggtacaaat 253 |||||||||| ||||||||||||| Sbjct: 29256 aggttgtcaggcttgggtacaaat 29233
>emb|BX470102.12| Human DNA sequence from clone RP11-49N14 on chromosome 1 Contains the S100A6 gene for S100 calcium binding protein A6 (calcyclin), a novel gene, the S100A5 gene for S100 calcium binding protein A5, the S100A4 gene for S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog), the S100A3 gene for S100 calcium binding protein A3, the S100A2 gene for S100 calcium binding protein A2, the S100A16 gene for S100 calcium binding protein A16, the S100A14 gene for S100 calcium binding protein A14, and the 3' end of the S100A13 gene for S100 calcium binding protein A13, complete sequence Length = 100590 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 8823 aagccaaggcccccaggaag 8842
>ref|XM_503547.1| Yarrowia lipolytica CLIB122, YALI0E04576g predicted mRNA Length = 3078 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 407 tgaatgatgctggtgaagttgagc 430 |||||||||||||||| ||||||| Sbjct: 896 tgaatgatgctggtgaggttgagc 873
>ref|NM_014624.3| Homo sapiens S100 calcium binding protein A6 (calcyclin) (S100A6), mRNA Length = 683 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 558 aagccaaggcccccaggaag 539
>emb|X52278.1|MM5B10 Mouse 5B10 mRNA for calcyclin Length = 434 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 319 aagccaaggcccccaggaag 300
>emb|X66449.1|MMCALC M.musculus mRNA for calcyclin Length = 551 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 403 aagccaaggcccccaggaag 384
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces hansenii Length = 2051428 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 136 cctaattggatatgtccggtttgt 159 ||||||||||||||||| |||||| Sbjct: 652369 cctaattggatatgtcctgtttgt 652346
>emb|AJ132717.1|RNO132717 Rattus norvegicus mRNA for calcyclin Length = 291 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 256 aagccaaggcccccaggaag 237
>gb|BT007814.1| Synthetic construct Homo sapiens S100 calcium binding protein A6 (calcyclin) mRNA, partial cds Length = 273 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>gb|BT006965.1| Homo sapiens S100 calcium binding protein A6 (calcyclin) mRNA, complete cds Length = 273 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>emb|BX546482.15| Zebrafish DNA sequence from clone DKEY-226B20 in linkage group 13, complete sequence Length = 206949 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 431 agaaggaaggaaacatgaag 450 |||||||||||||||||||| Sbjct: 31270 agaaggaaggaaacatgaag 31251
>gb|AC096742.3| Homo sapiens BAC clone RP11-328K4 from 4, complete sequence Length = 113991 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 237 cagacttgggtacaaatcag 256 |||||||||||||||||||| Sbjct: 104411 cagacttgggtacaaatcag 104392
>dbj|AK151587.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830031P06 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 429 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 312 aagccaaggcccccaggaag 293
>dbj|AK150408.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830006O04 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 312 aagccaaggcccccaggaag 293
>dbj|AK151144.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830026A04 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 312 aagccaaggcccccaggaag 293
>emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chromosome 4, complete sequence Length = 186208 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 aggaaggaaacatgaagaag 453 |||||||||||||||||||| Sbjct: 14568 aggaaggaaacatgaagaag 14549
>gb|AC104593.7| Homo sapiens chromosome 15, clone RP11-976K17, complete sequence Length = 46983 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 127 aagagcaatcctaattggat 146 |||||||||||||||||||| Sbjct: 38051 aagagcaatcctaattggat 38070
>dbj|AK008941.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched library, clone:2210415I10 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 312 aagccaaggcccccaggaag 293
>gb|AY034480.1| Homo sapiens S100 calcium-binding protein A6 gene, complete cds Length = 274 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>dbj|AK008241.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010015A02 product:S100 calcium binding protein A6 (calcyclin), full insert sequence Length = 430 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 312 aagccaaggcccccaggaag 293
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 301 agggattcaagctcagctga 320 |||||||||||||||||||| Sbjct: 7083343 agggattcaagctcagctga 7083362
>emb|BX827055.1|CNS0A43L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB90ZD04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1496 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 76 ttctgcggagattgtttgtacatgaggtatgg 107 ||||| ||||||||||| |||||||| ||||| Sbjct: 685 ttctgtggagattgtttatacatgagatatgg 716
>gb|AC090949.2| Homo sapiens chromosome 3 clone RP11-421B21 map 3p, complete sequence Length = 176751 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 agttgagcagaaggaaggaaacat 446 ||||||| |||||||||||||||| Sbjct: 160923 agttgagaagaaggaaggaaacat 160946
>gb|AC087590.2| Homo sapiens chromosome 3 clone RP11-321I9 map 3p, complete sequence Length = 188132 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 agttgagcagaaggaaggaaacat 446 ||||||| |||||||||||||||| Sbjct: 75984 agttgagaagaaggaaggaaacat 75961
>dbj|AP006520.1| Geobacillus kaustophilus HTA426 plasmid pHTA426 DNA, complete genome Length = 47890 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 90 tttgtacatgaggtatggtgagaa 113 ||||||||||| |||||||||||| Sbjct: 31162 tttgtacatgatgtatggtgagaa 31185
>dbj|AP005003.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0495C02 Length = 151467 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 301 agggattcaagctcagctga 320 |||||||||||||||||||| Sbjct: 86762 agggattcaagctcagctga 86781
>gb|AY891800.1| Synthetic construct Homo sapiens clone FLH110757.01L S100 calcium binding protein A6 (S100A6) mRNA, partial cds Length = 273 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>gb|AY891799.1| Synthetic construct Homo sapiens clone FLH110756.01L S100 calcium binding protein A6 (S100A6) mRNA, partial cds Length = 273 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>gb|AY889312.1| Synthetic construct Homo sapiens clone FLH110761.01X S100 calcium binding protein A6 (S100A6) mRNA, complete cds Length = 273 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>gb|AY889311.1| Synthetic construct Homo sapiens clone FLH110760.01X S100 calcium binding protein A6 (S100A6) mRNA, complete cds Length = 273 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 244 aagccaaggcccccaggaag 225
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 40.1 bits (20), Expect = 7.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 141 ttggatatgtccggtttgtcgtggcatt 168 |||||||| |||| |||||||||||||| Sbjct: 4998509 ttggatatttccgttttgtcgtggcatt 4998482
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 497 tcaaggatgaagccaaggcc 516 |||||||||||||||||||| Sbjct: 2460959 tcaaggatgaagccaaggcc 2460940
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 407 tgaatgatgctggtgaagttgagc 430 |||||||||||||||| ||||||| Sbjct: 523076 tgaatgatgctggtgaggttgagc 523099
>gb|U31867.1|RNU31867 Rattus norvegicus Tclone15 mRNA Length = 393 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 274 aagccaaggcccccaggaag 255
>emb|AL935136.4| Zebrafish DNA sequence from clone CH211-180B2, complete sequence Length = 146712 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 431 agaaggaaggaaacatgaag 450 |||||||||||||||||||| Sbjct: 49347 agaaggaaggaaacatgaag 49328
>gb|M18981.1|HUMCACYA Human prolactin receptor-associated protein (PRA) gene, complete cds Length = 470 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 346 aagccaaggcccccaggaag 327
>gb|J02763.1|HUMCACY Human calcyclin gene, complete cds Length = 3671 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 2639 aagccaaggcccccaggaag 2620
>gb|M37761.1|MUSCALC23 Mouse calcyclin mRNA, complete cds Length = 428 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 310 aagccaaggcccccaggaag 291
>gb|M14300.1|HUMGFI2A9 Human growth factor-inducible 2A9 gene, complete cds Length = 434 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 309 aagccaaggcccccaggaag 290
>gb|U04815.1|HSU04815 Human protein kinase PITSLRE alpha 1 mRNA, complete cds Length = 1805 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 506 aagccaaggcccccaggaag 525 |||||||||||||||||||| Sbjct: 106 aagccaaggcccccaggaag 125 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,615,873 Number of Sequences: 3902068 Number of extensions: 5615873 Number of successful extensions: 92468 Number of sequences better than 10.0: 81 Number of HSP's better than 10.0 without gapping: 81 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 92121 Number of HSP's gapped (non-prelim): 345 length of query: 574 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 551 effective length of database: 17,143,297,704 effective search space: 9445957034904 effective search space used: 9445957034904 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)