ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags32l16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL021396.8|HS971N18 Human DNA sequence from clone RP5-971N18... 44 0.53
2gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, c... 40 8.2
3gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 8.2
4gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 8.2
5gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 8.2
6gb|AC073140.5| Homo sapiens BAC clone RP11-731B4 from 7, complet... 40 8.2
7emb|Z81086.1|CEF53B6 Caenorhabditis elegans Cosmid F53B6, comple... 40 8.2
8gb|AC091507.2| Sus scrofa clone RP44-397B10, complete sequence 40 8.2
9gb|CP000001.1| Bacillus cereus E33L, complete genome 40 8.2
10emb|AL607023.3| Human DNA sequence from clone RP11-65E10 on chro... 40 8.2
11emb|AL353152.8| Human DNA sequence from clone RP11-359N11 on chr... 40 8.2
12gb|AC067793.9| Homo sapiens chromosome 15, clone RP11-552D14, co... 40 8.2
13gb|AC023464.11| Homo sapiens chromosome 8, clone RP11-436D19, co... 40 8.2
14emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 i... 40 8.2
15emb|AL928695.23| Zebrafish DNA sequence from clone CH211-217M19 ... 40 8.2
16dbj|AP000776.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 8.2
17gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 8.2
18emb|AL773601.11| Zebrafish DNA sequence from clone CH211-199O1, ... 40 8.2

>emb|AL021396.8|HS971N18 Human DNA sequence from clone RP5-971N18 on chromosome 20p12 Contains
             the PHKBP1 pseudogene (phosphorylase kinase, beta
             pseudogene 1), two novel genes and a CpG island, complete
             sequence
          Length = 125729

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 508   cccaagaggtcgaggcagtagt 529
             ||||||||||||||||||||||
Sbjct: 70633 cccaagaggtcgaggcagtagt 70654



to top

>gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, complete sequence
          Length = 204565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 302   aataagttgattcaatgtaa 321
             ||||||||||||||||||||
Sbjct: 30216 aataagttgattcaatgtaa 30235



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 541     tcaaggaataggtagtgttg 560
               ||||||||||||||||||||
Sbjct: 2223231 tcaaggaataggtagtgttg 2223250



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 541     tcaaggaataggtagtgttg 560
               ||||||||||||||||||||
Sbjct: 2202102 tcaaggaataggtagtgttg 2202121



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 541     tcaaggaataggtagtgttg 560
               ||||||||||||||||||||
Sbjct: 2202084 tcaaggaataggtagtgttg 2202103



to top

>gb|AC073140.5| Homo sapiens BAC clone RP11-731B4 from 7, complete sequence
          Length = 137990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 46   aaggatggcaggaaaggtaa 65
            ||||||||||||||||||||
Sbjct: 3888 aaggatggcaggaaaggtaa 3907



to top

>emb|Z81086.1|CEF53B6 Caenorhabditis elegans Cosmid F53B6, complete sequence
          Length = 32412

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 577   gttagttttttgtcccttgt 596
             ||||||||||||||||||||
Sbjct: 26803 gttagttttttgtcccttgt 26822



to top

>gb|AC091507.2| Sus scrofa clone RP44-397B10, complete sequence
          Length = 174031

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 150   atagcagttgcttttgctct 169
             ||||||||||||||||||||
Sbjct: 37921 atagcagttgcttttgctct 37902



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 541     tcaaggaataggtagtgttg 560
               ||||||||||||||||||||
Sbjct: 2250267 tcaaggaataggtagtgttg 2250286



to top

>emb|AL607023.3| Human DNA sequence from clone RP11-65E10 on chromosome 10 Contains part
              of the gene for alpha-catenin-like protein (MGC26194)
              (VR22), complete sequence
          Length = 132396

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 36     tggagaaataaaggatggca 55
              ||||||||||||||||||||
Sbjct: 114516 tggagaaataaaggatggca 114535



to top

>emb|AL353152.8| Human DNA sequence from clone RP11-359N11 on chromosome 6 Contains two
             novel genes (including FLJ32264) and a CpG island,
             complete sequence
          Length = 119416

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    gatggcaggaaaggtaaaag 68
             ||||||||||||||||||||
Sbjct: 50387 gatggcaggaaaggtaaaag 50406



to top

>gb|AC067793.9| Homo sapiens chromosome 15, clone RP11-552D14, complete sequence
          Length = 189722

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   agactccagtttcatgtttt 131
             ||||||||||||||||||||
Sbjct: 58740 agactccagtttcatgtttt 58759



to top

>gb|AC023464.11| Homo sapiens chromosome 8, clone RP11-436D19, complete sequence
          Length = 160370

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 582   ttttttgtcccttgttttca 601
             ||||||||||||||||||||
Sbjct: 75192 ttttttgtcccttgttttca 75211



to top

>emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10,
             complete sequence
          Length = 185190

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 470   ttagctatgaaagtctgcat 489
             ||||||||||||||||||||
Sbjct: 99380 ttagctatgaaagtctgcat 99361



to top

>emb|AL928695.23| Zebrafish DNA sequence from clone CH211-217M19 in linkage group 16,
             complete sequence
          Length = 215878

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    ggagaaataaaggatggcag 56
             ||||||||||||||||||||
Sbjct: 54869 ggagaaataaaggatggcag 54850



to top

>dbj|AP000776.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-748H22, complete
              sequence
          Length = 191270

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 579    tagttttttgtcccttgttttcat 602
              |||||||||||||||| |||||||
Sbjct: 116288 tagttttttgtcccttattttcat 116265



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 541     tcaaggaataggtagtgttg 560
               ||||||||||||||||||||
Sbjct: 2201978 tcaaggaataggtagtgttg 2201997



to top

>emb|AL773601.11| Zebrafish DNA sequence from clone CH211-199O1, complete sequence
          Length = 201299

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 526   tagttcagcctaaattcaag 545
             ||||||||||||||||||||
Sbjct: 34313 tagttcagcctaaattcaag 34294


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,212,593
Number of Sequences: 3902068
Number of extensions: 5212593
Number of successful extensions: 80319
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80170
Number of HSP's gapped (non-prelim): 149
length of query: 606
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 583
effective length of database: 17,143,297,704
effective search space: 9994542561432
effective search space used: 9994542561432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top