ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags32l08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479406.1| Oryza sativa (japonica cultivar-group), mRNA 270 2e-69
2dbj|AK103870.1| Oryza sativa (japonica cultivar-group) cDNA clon... 270 2e-69
3dbj|AK064580.1| Oryza sativa (japonica cultivar-group) cDNA clon... 270 2e-69
4dbj|AK058967.1| Oryza sativa (japonica cultivar-group) cDNA clon... 270 2e-69
5gb|BT018903.1| Zea mays clone EL01T0208C03.d mRNA sequence 167 3e-38
6ref|NM_121944.2| Arabidopsis thaliana unknown protein AT5G19390 ... 133 4e-28
7ref|NM_001036828.1| Arabidopsis thaliana unknown protein AT5G193... 133 4e-28
8ref|NM_001036827.1| Arabidopsis thaliana unknown protein AT5G193... 133 4e-28
9ref|NM_180711.2| Arabidopsis thaliana unknown protein AT5G19390 ... 133 4e-28
10gb|AY091776.1| Arabidopsis thaliana AT5g19390/F7K24_140 mRNA, co... 133 4e-28
11gb|BT002224.1| Arabidopsis thaliana At5g19390/F7K24_140 mRNA, co... 133 4e-28
12dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 111 1e-21
13dbj|AP005184.5| Oryza sativa (japonica cultivar-group) genomic D... 111 1e-21
14dbj|AP003833.3| Oryza sativa (japonica cultivar-group) genomic D... 111 1e-21
15gb|AF296837.1|F7K24 Arabidopsis thaliana BAC F7K24 86 8e-14
16gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome... 84 3e-13
17gb|AC151407.1| Oryza sativa (japonica cultivar-group) chromosome... 84 3e-13
18emb|CT033769.2| Medicago truncatula chromosome 5 clone mte1-54l1... 76 7e-11
19gb|AC171735.1| Lycopersicon esculentum chromosome 11 clone C11HB... 48 0.017
20ref|XM_854508.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
21ref|XM_854467.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
22ref|XM_854442.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
23ref|XM_854404.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
24ref|XM_854295.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
25ref|XM_854258.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
26ref|XM_854226.1| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
27ref|XM_534659.2| PREDICTED: Canis familiaris similar to Restin (... 44 0.26
28gb|AC091278.6| Mus musculus chromosome 1, clone RP23-294D6, comp... 42 1.0
29gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complet... 42 1.0
30gb|AC131673.4| Mus musculus BAC clone RP23-321P21 from 1, comple... 42 1.0
31gb|AY515512.1| SARS coronavirus HC/SZ/61/03, complete genome 40 4.1
32gb|AY609081.1| Synthetic construct SARS coronavirus 3C-like prot... 40 4.1
33gb|AC168852.2| Mus musculus BAC clone RP24-191L21 from chromosom... 40 4.1
34gb|AC116800.11| Mus musculus chromosome 8, clone RP24-335D17, co... 40 4.1
35gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome... 40 4.1
36gb|AY714217.1| SARS Coronavirus CDC#200301157, complete genome 40 4.1
37gb|AY559097.1| SARS coronavirus Sin3408L, complete genome 40 4.1
38gb|AY559096.1| SARS coronavirus Sin850, complete genome 40 4.1
39gb|AY559095.1| SARS coronavirus Sin847, complete genome 40 4.1
40gb|AY559094.1| SARS coronavirus Sin846, complete genome 40 4.1
41gb|AY559093.1| SARS coronavirus Sin845, complete genome 40 4.1
42gb|AY559092.1| SARS coronavirus SinP5, complete genome 40 4.1
43gb|AY559091.1| SARS coronavirus SinP4, complete genome 40 4.1
44gb|AY559090.1| SARS coronavirus SinP3, complete genome 40 4.1
45gb|AY559089.1| SARS coronavirus SinP2, complete genome 40 4.1
46gb|AY559088.1| SARS coronavirus SinP1, complete genome 40 4.1
47gb|AY559087.1| SARS coronavirus Sin3725V, complete genome 40 4.1
48gb|AY559086.1| SARS coronavirus Sin849, complete genome 40 4.1
49gb|AY559085.1| SARS coronavirus Sin848, complete genome 40 4.1
50gb|AY559084.1| SARS coronavirus Sin3765V, complete genome 40 4.1
51gb|AY559083.1| SARS coronavirus Sin3408, complete genome 40 4.1
52gb|AY559082.1| SARS coronavirus Sin852, complete genome 40 4.1
53gb|AY559081.1| SARS coronavirus Sin842, complete genome 40 4.1
54gb|AY278741.1| SARS coronavirus Urbani, complete genome 40 4.1
55gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.1
56ref|XM_583422.2| PREDICTED: Bos taurus similar to cytoplasmic li... 40 4.1
57gb|AY595412.1| SARS coronavirus LLJ-2004, complete genome 40 4.1
58gb|DQ182595.1| SARS coronavirus ZJ0301 from China, complete genome 40 4.1
59gb|AY274119.3| SARS coronavirus TOR2, complete genome 40 4.1
60gb|AY323977.2| SARS coronavirus HSR 1, complete genome 40 4.1
61gb|AY534763.1|AY534762S2 SARS coronavirus Sin_WNV, partial seque... 40 4.1
62gb|AY534758.1|AY534758S1 SARS coronavirus Sin0409, partial seque... 40 4.1
63gb|AY291315.1| SARS coronavirus Frankfurt 1, complete genome 40 4.1
64gb|AY291451.1| SARS coronavirus TW1, complete genome 40 4.1
65gb|AY502932.1| SARS coronavirus TW9, complete genome 40 4.1
66gb|AY502931.1| SARS coronavirus TW8, complete genome 40 4.1
67gb|AY502930.1| SARS coronavirus TW7, complete genome 40 4.1
68gb|AY502929.1| SARS coronavirus TW6, complete genome 40 4.1
69gb|AY502928.1| SARS coronavirus TW5, complete genome 40 4.1
70gb|AY502927.1| SARS coronavirus TW4, complete genome 40 4.1
71gb|AY502926.1| SARS coronavirus TW3, complete genome 40 4.1
72gb|AY502925.1| SARS coronavirus TW2, complete genome 40 4.1
73gb|AY502924.1| SARS coronavirus TW11, complete genome 40 4.1
74gb|AY502923.1| SARS coronavirus TW10, complete genome 40 4.1
75gb|AY286320.4| SARS coronavirus ZJ01, partial genome 40 4.1
76gb|AY443088.1|AY443086S03 SARS coronavirus CUHK-L2 orf1ab polypr... 40 4.1
77gb|AY390556.1| SARS coronavirus GZ02, complete genome 40 4.1
78gb|AY395004.1| SARS coronavirus HZS2-Bb, partial genome 40 4.1
79gb|AY395003.1| SARS coronavirus ZS-C, complete genome 40 4.1
80gb|AY395002.1| SARS coronavirus LC5, complete genome 40 4.1
81gb|AY395001.1| SARS coronavirus LC4, complete genome 40 4.1
82gb|AY395000.1| SARS coronavirus LC3, complete genome 40 4.1
83gb|AY394999.1| SARS coronavirus LC2, complete genome 40 4.1
84gb|AY394998.1| SARS coronavirus LC1, complete genome 40 4.1
85gb|AY394997.1| SARS coronavirus ZS-A, complete genome 40 4.1
86gb|AY394996.1| SARS coronavirus ZS-B, complete genome 40 4.1
87gb|AY394995.1| SARS coronavirus HSZ-Cc, complete genome 40 4.1
88gb|AY394994.1| SARS coronavirus HSZ-Bc, complete genome 40 4.1
89gb|AY394993.1| SARS coronavirus HGZ8L2, complete genome 40 4.1
90gb|AY394992.1| SARS coronavirus HZS2-C, complete genome 40 4.1
91gb|AY394991.1| SARS coronavirus HZS2-Fc, complete genome 40 4.1
92gb|AY394990.1| SARS coronavirus HZS2-E, complete genome 40 4.1
93gb|AY394989.1| SARS coronavirus HZS2-D, complete genome 40 4.1
94gb|AY394987.1| SARS coronavirus HZS2-Fb, complete genome 40 4.1
95gb|AY394986.1| SARS coronavirus HSZ-Cb, complete genome 40 4.1
96gb|AY394985.1| SARS coronavirus HSZ-Bb, complete genome 40 4.1
97gb|AY394984.1| SARS coronavirus HSZ-A, partial genome 40 4.1
98gb|AY394983.1| SARS coronavirus HSZ2-A, complete genome 40 4.1
99gb|AY394982.1| SARS coronavirus HGZ8L1-B, partial genome 40 4.1
100gb|AY394981.1| SARS coronavirus HGZ8L1-A, partial genome 40 4.1
101gb|AY394980.1| SARS coronavirus GZ-D, partial genome 40 4.1
102gb|AY394979.1| SARS coronavirus GZ-C, complete genome 40 4.1
103gb|AY394978.1| SARS coronavirus GZ-B, complete genome 40 4.1
104gb|AY394977.1| SARS coronavirus GZ-A, partial genome 40 4.1
105gb|AY508724.1| SARS coronavirus NS-1, complete genome 40 4.1
106gb|AY463059.1| SARS coronavirus ShanghaiQXC1, complete genome 40 4.1
107gb|AY463060.1| SARS coronavirus ShanghaiQXC2, complete genome 40 4.1
108gb|AC147133.2| Pan troglodytes BAC clone CH251-372A19 from Y, co... 40 4.1
109gb|AY310120.1| SARS coronavirus FRA, complete genome 40 4.1
110gb|AY345988.1| SARS coronavirus CUHK-AG03, complete genome 40 4.1
111gb|AY345987.1| SARS coronavirus CUHK-AG02, complete genome 40 4.1
112gb|AY345986.1| SARS coronavirus CUHK-AG01, complete genome 40 4.1
113gb|AY461660.1| SARS coronavirus SoD, complete genome 40 4.1
114gb|AY282752.2| SARS coronavirus CUHK-Su10, complete genome 40 4.1
115gb|AY357076.1| SARS coronavirus PUMC03, complete genome 40 4.1
116gb|AY357075.1| SARS coronavirus PUMC02, complete genome 40 4.1
117gb|AY350750.1| SARS coronavirus PUMC01, complete genome 40 4.1
118gb|AC122841.4| Mus musculus BAC clone RP23-194E5 from 3, complet... 40 4.1
119gb|AY304495.1| SARS coronavirus GZ50, complete genome 40 4.1
120gb|AY304488.1| SARS coronavirus SZ16, complete genome 40 4.1
121gb|AY304486.1| SARS coronavirus SZ3, complete genome 40 4.1
122gb|AY427439.1| SARS coronavirus AS, complete genome 40 4.1
123gb|AY283798.2| SARS coronavirus Sin2774, complete genome 40 4.1
124gb|AY278491.2| SARS coronavirus HKU-39849, complete genome 40 4.1
125gb|AY278489.2| SARS coronavirus GD01, complete genome 40 4.1
126gb|AC182586.3| Pan troglodytes BAC clone CH251-499F21 from chrom... 40 4.1
127emb|AL592287.4| Human DNA sequence from clone RP11-107P1 on chro... 40 4.1
128emb|AL441886.18| Human DNA sequence from clone RP11-287G8 on chr... 40 4.1
129emb|AL390844.12| Human DNA sequence from clone RP11-255N24 on ch... 40 4.1
130gb|AY362699.1| SARS coronavirus TWC3, complete genome 40 4.1
131gb|AY362698.1| SARS coronavirus TWC2, complete genome 40 4.1
132gb|AY283794.1| SARS coronavirus Sin2500, complete genome 40 4.1
133gb|AY283795.1| SARS coronavirus Sin2677, complete genome 40 4.1
134gb|AY283796.1| SARS coronavirus Sin2679, complete genome 40 4.1
135gb|AY283797.1| SARS coronavirus Sin2748, complete genome 40 4.1
136gb|AY278554.2| SARS coronavirus CUHK-W1, complete genome 40 4.1
137gb|AY322206.1|AY322205S2 SARS coronavirus Shanhgai LY orf1a poly... 40 4.1
138emb|AL138787.11| Human DNA sequence from clone RP4-665N4 on chro... 40 4.1
139gb|AY321118.1| SARS coronavirus TWC, complete genome 40 4.1
140gb|AY279354.2| SARS coronavirus BJ04, complete genome 40 4.1
141gb|AY278490.3| SARS coronavirus BJ03, complete genome 40 4.1
142gb|AY278487.3| SARS coronavirus BJ02, complete genome 40 4.1
143gb|AY297028.1| SARS coronavirus ZJ01, complete genome 40 4.1
144gb|AY686863.1| SARS coronavirus A022, complete genome 40 4.1
145gb|AY686864.1| SARS coronavirus B039, complete genome 40 4.1
146dbj|BS000642.2| Pan troglodytes chromosome Y clone: PTB-307G08, ... 40 4.1
147gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 4.1
148gb|AY278488.2| SARS coronavirus BJ01, complete genome 40 4.1
149dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
150gb|AY394850.2| SARS coronavirus WHU, complete genome 40 4.1
151gb|AC068129.6| Homo sapiens BAC clone RP11-619F9 from 2, complet... 40 4.1
152gb|AY074786.1| Oryza sativa dehydroascorbate reductase (DHAR) mR... 40 4.1
153gb|AY338175.1| SARS coronavirus Taiwan TC2, complete genome 40 4.1
154gb|AY338174.1| SARS coronavirus Taiwan TC1, complete genome 40 4.1
155gb|AY348314.1| SARS coronavirus Taiwan TC3, complete genome 40 4.1
156gb|AC007284.4|AC007284 Homo sapiens BAC clone RP11-558K21 from Y... 40 4.1
157gb|AC135168.8| Homo sapiens, clone CTD-2025E19, complete sequence 40 4.1
158gb|DQ071615.1| Bat SARS coronavirus Rp3, complete genome 40 4.1
159gb|AC146450.5| Pan troglodytes BAC clone clone CH251-552K12 from... 40 4.1
160gb|AC006371.2|AC006371 Homo sapiens BAC clone RP11-304C24 from Y... 40 4.1
161dbj|AK070895.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.1
162gb|AY654624.1| SARS coronavirus TJF, complete genome 40 4.1
163dbj|AK061836.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.1
164gb|AY772062.1| SARS coronavirus WH20, complete genome 40 4.1
165gb|AY545919.1| SARS coronavirus isolate CFB/SZ/94/03, complete g... 40 4.1
166gb|AY545918.1| SARS coronavirus isolate HC/GZ/32/03, complete ge... 40 4.1
167gb|AY545917.1| SARS coronavirus isolate HC/GZ/81/03, complete ge... 40 4.1
168gb|AY545916.1| SARS coronavirus isolate HC/SZ/266/03, complete g... 40 4.1
169gb|AY545915.1| SARS coronavirus isolate HC/SZ/DM1/03, complete g... 40 4.1
170gb|AY545914.1| SARS coronavirus isolate HC/SZ/79/03, complete ge... 40 4.1
171gb|AY568539.1| SARS coronavirus GZ0401, complete genome 40 4.1
172gb|AY313906.1| SARS coronavirus GD69, complete genome 40 4.1
173gb|AY613950.1| SARS coronavirus PC4-227, complete genome 40 4.1
174gb|AY613949.1| SARS coronavirus PC4-136, complete genome 40 4.1
175gb|AY613948.1| SARS coronavirus PC4-13, complete genome 40 4.1
176gb|AY613947.1| SARS coronavirus GZ0402, complete genome 40 4.1
177emb|AL805963.23| Mouse DNA sequence from clone RP23-98K7 on chro... 40 4.1
178emb|AL844521.15| Zebrafish DNA sequence from clone DKEY-155O15 i... 40 4.1
179gb|AC140238.3| Mus musculus BAC clone RP24-279O7 from 3, complet... 40 4.1
180dbj|AP006561.1| SARS coronavirus TWY genomic RNA, complete genome 40 4.1
181dbj|AP006560.1| SARS coronavirus TWS genomic RNA, complete genome 40 4.1
182dbj|AP006559.1| SARS coronavirus TWK genomic RNA, complete genome 40 4.1
183dbj|AP006558.1| SARS coronavirus TWJ genomic RNA, complete genome 40 4.1
184dbj|AP006557.1| SARS coronavirus TWH genomic RNA, complete genome 40 4.1
185gb|AY572038.1| SARS coronavirus civet020, complete genome 40 4.1
186gb|AY572035.1| SARS coronavirus civet010, complete genome 40 4.1
187gb|AY572034.1| SARS coronavirus civet007, complete genome 40 4.1
188gb|AY485278.1| SARS coronavirus Sino3-11, complete genome 40 4.1
189gb|AY485277.1| SARS coronavirus Sino1-11, complete genome 40 4.1
190dbj|AB257344.1| SARS coronavirus Frankfurt 1 genomic RNA, nearly... 40 4.1
191gb|AC092891.5| Homo sapiens 12 BAC RP11-495C19 (Roswell Park Can... 40 4.1
192dbj|AB037970.1| Oryza sativa (japonica cultivar-group) DHAR1 mRN... 40 4.1
193emb|AL833807.5| Mouse DNA sequence from clone RP23-305G2 on chro... 40 4.1

>ref|XM_479406.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3125

 Score =  270 bits (136), Expect = 2e-69
 Identities = 257/295 (87%), Gaps = 2/295 (0%)
 Strand = Plus / Plus

                                                                        
Query: 17   tttggggacggaana-tgcaagaaagagccagcagtctgagtttgttgatt-atcgggtg 74
            ||||||||||||| | || |||||| || || ||||| || || | ||||| ||||||||
Sbjct: 1939 tttggggacggaacaatggaagaaaaagtcaacagtcagaattggctgattcatcgggtg 1998

                                                                        
Query: 75   aagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattg 134
            |||||||||||||||||||||| || |||||| |||||||||| || || ||||| || |
Sbjct: 1999 aagaagagcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcg 2058

                                                                        
Query: 135  caaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcac 194
            | |||||| || |||| |||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 2059 cgaaagaggctagaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcac 2118

                                                                        
Query: 195  tgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcagg 254
            | ||||||||||||||||  ||||| || ||||| |||||||||||||||||||| || |
Sbjct: 2119 tacatgagcgccgtttggctctggagcaggatgtttcaaggttgcaagagcagctacaag 2178

                                                                   
Query: 255  ctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcaca 309
            ||||| | ||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 2179 ctgaaagagatcttagagctgcattggaggttggattaagcatgtcttctgcaca 2233



to top

>dbj|AK103870.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033149H24, full
            insert sequence
          Length = 3125

 Score =  270 bits (136), Expect = 2e-69
 Identities = 257/295 (87%), Gaps = 2/295 (0%)
 Strand = Plus / Plus

                                                                        
Query: 17   tttggggacggaana-tgcaagaaagagccagcagtctgagtttgttgatt-atcgggtg 74
            ||||||||||||| | || |||||| || || ||||| || || | ||||| ||||||||
Sbjct: 1939 tttggggacggaacaatggaagaaaaagtcaacagtcagaattggctgattcatcgggtg 1998

                                                                        
Query: 75   aagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattg 134
            |||||||||||||||||||||| || |||||| |||||||||| || || ||||| || |
Sbjct: 1999 aagaagagcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcg 2058

                                                                        
Query: 135  caaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcac 194
            | |||||| || |||| |||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 2059 cgaaagaggctagaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcac 2118

                                                                        
Query: 195  tgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcagg 254
            | ||||||||||||||||  ||||| || ||||| |||||||||||||||||||| || |
Sbjct: 2119 tacatgagcgccgtttggctctggagcaggatgtttcaaggttgcaagagcagctacaag 2178

                                                                   
Query: 255  ctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcaca 309
            ||||| | ||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 2179 ctgaaagagatcttagagctgcattggaggttggattaagcatgtcttctgcaca 2233



to top

>dbj|AK064580.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-112-F01, full
            insert sequence
          Length = 1592

 Score =  270 bits (136), Expect = 2e-69
 Identities = 257/295 (87%), Gaps = 2/295 (0%)
 Strand = Plus / Plus

                                                                        
Query: 17   tttggggacggaana-tgcaagaaagagccagcagtctgagtttgttgatt-atcgggtg 74
            ||||||||||||| | || |||||| || || ||||| || || | ||||| ||||||||
Sbjct: 851  tttggggacggaacaatggaagaaaaagtcaacagtcagaattggctgattcatcgggtg 910

                                                                        
Query: 75   aagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattg 134
            |||||||||||||||||||||| || |||||| |||||||||| || || ||||| || |
Sbjct: 911  aagaagagcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcg 970

                                                                        
Query: 135  caaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcac 194
            | |||||| || |||| |||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 971  cgaaagaggctagaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcac 1030

                                                                        
Query: 195  tgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcagg 254
            | ||||||||||||||||  ||||| || ||||| |||||||||||||||||||| || |
Sbjct: 1031 tacatgagcgccgtttggctctggagcaggatgtttcaaggttgcaagagcagctacaag 1090

                                                                   
Query: 255  ctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcaca 309
            ||||| | ||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 1091 ctgaaagagatcttagagctgcattggaggttggattaagcatgtcttctgcaca 1145



to top

>dbj|AK058967.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-C09, full
           insert sequence
          Length = 1736

 Score =  270 bits (136), Expect = 2e-69
 Identities = 257/295 (87%), Gaps = 2/295 (0%)
 Strand = Plus / Plus

                                                                       
Query: 17  tttggggacggaana-tgcaagaaagagccagcagtctgagtttgttgatt-atcgggtg 74
           ||||||||||||| | || |||||| || || ||||| || || | ||||| ||||||||
Sbjct: 529 tttggggacggaacaatggaagaaaaagtcaacagtcagaattggctgattcatcgggtg 588

                                                                       
Query: 75  aagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattg 134
           |||||||||||||||||||||| || |||||| |||||||||| || || ||||| || |
Sbjct: 589 aagaagagcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcg 648

                                                                       
Query: 135 caaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcac 194
           | |||||| || |||| |||||||||||||| || ||||||||||||||||| |||||||
Sbjct: 649 cgaaagaggctagaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcac 708

                                                                       
Query: 195 tgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcagg 254
           | ||||||||||||||||  ||||| || ||||| |||||||||||||||||||| || |
Sbjct: 709 tacatgagcgccgtttggctctggagcaggatgtttcaaggttgcaagagcagctacaag 768

                                                                  
Query: 255 ctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcaca 309
           ||||| | ||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 769 ctgaaagagatcttagagctgcattggaggttggattaagcatgtcttctgcaca 823



to top

>gb|BT018903.1| Zea mays clone EL01T0208C03.d mRNA sequence
          Length = 2186

 Score =  167 bits (84), Expect = 3e-38
 Identities = 195/232 (84%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||||||||||||||| ||||| || ||||| || |||||||||||||||| ||| |||
Sbjct: 905  gaagaagagcttgctattcaaagactagagattgcgaagaatgatctgcaaaacagaatt 964

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||||||| || |||| ||||||||  ||||||| ||||||||||||||||| ||||| 
Sbjct: 965  gcaaaagaggctagagggaatgcaattctacaggcgagtttggaaagaagaaaacaagcg 1024

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            || ||||| ||| | ||||   ||||||| ||||| || ||||||||||| || || || 
Sbjct: 1025 ctacatgaacgcagattggctttggaacaggatgtctccaggttgcaagaacaactacaa 1084

                                                                
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctg 305
            |||||  |||||||  |||||||||| || ||||| || |||||||||||||
Sbjct: 1085 gctgagagggatctgcgagctgcattggaggttggcttgagcatgtcttctg 1136



to top

>ref|NM_121944.2| Arabidopsis thaliana unknown protein AT5G19390 transcript variant
            AT5G19390.2 mRNA, complete cds
          Length = 3235

 Score =  133 bits (67), Expect = 4e-28
 Identities = 196/239 (82%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||| ||||||||||| || ||||| |||| | |||| ||||| |||| |    | |||
Sbjct: 2069 gaagacgagcttgctatacagaggctcgagaccacaaaaaatgaactgcgacaacgaatt 2128

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||| ||| |  ||||||||||||| ||||||||||| ||||| ||||| || ||||||
Sbjct: 2129 gcaaaggaggccagaggtaatgcaatattacaggctagcttggagagaaggaaacaagca 2188

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            |||||||| || ||||||  ||| ||||||||||| ||||| || |||||||||||||| 
Sbjct: 2189 ctgcatgaacgtcgtttgtcgcttgaacaagatgtgtcaagattacaagagcagctgcaa 2248

                                                                       
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcacaatt 312
            |||||| | |||||  |||| ||| | || ||||| || ||||||||||||| ||||||
Sbjct: 2249 gctgaaagagatctccgagcagcactggaggttggtttgagcatgtcttctggacaatt 2307



to top

>ref|NM_001036828.1| Arabidopsis thaliana unknown protein AT5G19390 transcript variant
            AT5G19390.4 mRNA, complete cds
          Length = 2690

 Score =  133 bits (67), Expect = 4e-28
 Identities = 196/239 (82%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||| ||||||||||| || ||||| |||| | |||| ||||| |||| |    | |||
Sbjct: 2074 gaagacgagcttgctatacagaggctcgagaccacaaaaaatgaactgcgacaacgaatt 2133

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||| ||| |  ||||||||||||| ||||||||||| ||||| ||||| || ||||||
Sbjct: 2134 gcaaaggaggccagaggtaatgcaatattacaggctagcttggagagaaggaaacaagca 2193

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            |||||||| || ||||||  ||| ||||||||||| ||||| || |||||||||||||| 
Sbjct: 2194 ctgcatgaacgtcgtttgtcgcttgaacaagatgtgtcaagattacaagagcagctgcaa 2253

                                                                       
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcacaatt 312
            |||||| | |||||  |||| ||| | || ||||| || ||||||||||||| ||||||
Sbjct: 2254 gctgaaagagatctccgagcagcactggaggttggtttgagcatgtcttctggacaatt 2312



to top

>ref|NM_001036827.1| Arabidopsis thaliana unknown protein AT5G19390 transcript variant
            AT5G19390.3 mRNA, complete cds
          Length = 3249

 Score =  133 bits (67), Expect = 4e-28
 Identities = 196/239 (82%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||| ||||||||||| || ||||| |||| | |||| ||||| |||| |    | |||
Sbjct: 2074 gaagacgagcttgctatacagaggctcgagaccacaaaaaatgaactgcgacaacgaatt 2133

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||| ||| |  ||||||||||||| ||||||||||| ||||| ||||| || ||||||
Sbjct: 2134 gcaaaggaggccagaggtaatgcaatattacaggctagcttggagagaaggaaacaagca 2193

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            |||||||| || ||||||  ||| ||||||||||| ||||| || |||||||||||||| 
Sbjct: 2194 ctgcatgaacgtcgtttgtcgcttgaacaagatgtgtcaagattacaagagcagctgcaa 2253

                                                                       
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcacaatt 312
            |||||| | |||||  |||| ||| | || ||||| || ||||||||||||| ||||||
Sbjct: 2254 gctgaaagagatctccgagcagcactggaggttggtttgagcatgtcttctggacaatt 2312



to top

>ref|NM_180711.2| Arabidopsis thaliana unknown protein AT5G19390 transcript variant
            AT5G19390.1 mRNA, complete cds
          Length = 3182

 Score =  133 bits (67), Expect = 4e-28
 Identities = 196/239 (82%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||| ||||||||||| || ||||| |||| | |||| ||||| |||| |    | |||
Sbjct: 2000 gaagacgagcttgctatacagaggctcgagaccacaaaaaatgaactgcgacaacgaatt 2059

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||| ||| |  ||||||||||||| ||||||||||| ||||| ||||| || ||||||
Sbjct: 2060 gcaaaggaggccagaggtaatgcaatattacaggctagcttggagagaaggaaacaagca 2119

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            |||||||| || ||||||  ||| ||||||||||| ||||| || |||||||||||||| 
Sbjct: 2120 ctgcatgaacgtcgtttgtcgcttgaacaagatgtgtcaagattacaagagcagctgcaa 2179

                                                                       
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcacaatt 312
            |||||| | |||||  |||| ||| | || ||||| || ||||||||||||| ||||||
Sbjct: 2180 gctgaaagagatctccgagcagcactggaggttggtttgagcatgtcttctggacaatt 2238



to top

>gb|AY091776.1| Arabidopsis thaliana AT5g19390/F7K24_140 mRNA, complete cds
          Length = 3235

 Score =  133 bits (67), Expect = 4e-28
 Identities = 196/239 (82%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||| ||||||||||| || ||||| |||| | |||| ||||| |||| |    | |||
Sbjct: 2069 gaagacgagcttgctatacagaggctcgagaccacaaaaaatgaactgcgacaacgaatt 2128

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||| ||| |  ||||||||||||| ||||||||||| ||||| ||||| || ||||||
Sbjct: 2129 gcaaaggaggccagaggtaatgcaatattacaggctagcttggagagaaggaaacaagca 2188

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            |||||||| || ||||||  ||| ||||||||||| ||||| || |||||||||||||| 
Sbjct: 2189 ctgcatgaacgtcgtttgtcgcttgaacaagatgtgtcaagattacaagagcagctgcaa 2248

                                                                       
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcacaatt 312
            |||||| | |||||  |||| ||| | || ||||| || ||||||||||||| ||||||
Sbjct: 2249 gctgaaagagatctccgagcagcactggaggttggtttgagcatgtcttctggacaatt 2307



to top

>gb|BT002224.1| Arabidopsis thaliana At5g19390/F7K24_140 mRNA, complete cds
          Length = 2613

 Score =  133 bits (67), Expect = 4e-28
 Identities = 196/239 (82%)
 Strand = Plus / Plus

                                                                        
Query: 74   gaagaagagcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggatt 133
            ||||| ||||||||||| || ||||| |||| | |||| ||||| |||| |    | |||
Sbjct: 1708 gaagacgagcttgctatacagaggctcgagaccacaaaaaatgaactgcgacaacgaatt 1767

                                                                        
Query: 134  gcaaaagagactggaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagca 193
            ||||| ||| |  ||||||||||||| ||||||||||| ||||| ||||| || ||||||
Sbjct: 1768 gcaaaggaggccagaggtaatgcaatattacaggctagcttggagagaaggaaacaagca 1827

                                                                        
Query: 194  ctgcatgagcgccgtttggtgctggaacaagatgtatcaaggttgcaagagcagctgcag 253
            |||||||| || ||||||  ||| ||||||||||| ||||| || |||||||||||||| 
Sbjct: 1828 ctgcatgaacgtcgtttgtcgcttgaacaagatgtgtcaagattacaagagcagctgcaa 1887

                                                                       
Query: 254  gctgaacgggatcttagagctgcattagaagttggattaagcatgtcttctgcacaatt 312
            |||||| | |||||  |||| ||| | || ||||| || ||||||||||||| ||||||
Sbjct: 1888 gctgaaagagatctccgagcagcactggaggttggtttgagcatgtcttctggacaatt 1946



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  111 bits (56), Expect = 1e-21
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                            
Query: 230      tcaaggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttgga 289
                |||||||||||||||||||| || |||||| | ||||||||||||||||| || ||||||
Sbjct: 27666929 tcaaggttgcaagagcagctacaagctgaaagagatcttagagctgcattggaggttgga 27666988

                                    
Query: 290      ttaagcatgtcttctgcaca 309
                ||||||||||||||||||||
Sbjct: 27666989 ttaagcatgtcttctgcaca 27667008



 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                            
Query: 147      gaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgcc 206
                |||| |||||||||||||| || ||||||||||||||||| |||||||| ||||||||||
Sbjct: 27666637 gaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcactacatgagcgcc 27666696

                                        
Query: 207      gtttggtgctggaacaagatgtat 230
                ||||||  ||||| || |||||||
Sbjct: 27666697 gtttggctctggagcaggatgtat 27666720



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                            
Query: 82       gcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattgcaaaaga 141
                ||||||||||||||| || |||||| |||||||||| || || ||||| || || |||||
Sbjct: 27666493 gcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcgcgaaaga 27666552

                 
Query: 142      g 142
                |
Sbjct: 27666553 g 27666553



to top

>dbj|AP005184.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0047B07
          Length = 157797

 Score =  111 bits (56), Expect = 1e-21
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                          
Query: 230    tcaaggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttgga 289
              |||||||||||||||||||| || |||||| | ||||||||||||||||| || ||||||
Sbjct: 123922 tcaaggttgcaagagcagctacaagctgaaagagatcttagagctgcattggaggttgga 123981

                                  
Query: 290    ttaagcatgtcttctgcaca 309
              ||||||||||||||||||||
Sbjct: 123982 ttaagcatgtcttctgcaca 124001



 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                          
Query: 147    gaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgcc 206
              |||| |||||||||||||| || ||||||||||||||||| |||||||| ||||||||||
Sbjct: 123630 gaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcactacatgagcgcc 123689

                                      
Query: 207    gtttggtgctggaacaagatgtat 230
              ||||||  ||||| || |||||||
Sbjct: 123690 gtttggctctggagcaggatgtat 123713



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                          
Query: 82     gcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattgcaaaaga 141
              ||||||||||||||| || |||||| |||||||||| || || ||||| || || |||||
Sbjct: 123486 gcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcgcgaaaga 123545

               
Query: 142    g 142
              |
Sbjct: 123546 g 123546



to top

>dbj|AP003833.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1477_F01
          Length = 158792

 Score =  111 bits (56), Expect = 1e-21
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                         
Query: 230   tcaaggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttgga 289
             |||||||||||||||||||| || |||||| | ||||||||||||||||| || ||||||
Sbjct: 46031 tcaaggttgcaagagcagctacaagctgaaagagatcttagagctgcattggaggttgga 46090

                                 
Query: 290   ttaagcatgtcttctgcaca 309
             ||||||||||||||||||||
Sbjct: 46091 ttaagcatgtcttctgcaca 46110



 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 75/84 (89%)
 Strand = Plus / Plus

                                                                         
Query: 147   gaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgcc 206
             |||| |||||||||||||| || ||||||||||||||||| |||||||| ||||||||||
Sbjct: 45739 gaggaaatgcaatcttacaagcaagtttggaaagaagaaaacaagcactacatgagcgcc 45798

                                     
Query: 207   gtttggtgctggaacaagatgtat 230
             ||||||  ||||| || |||||||
Sbjct: 45799 gtttggctctggagcaggatgtat 45822



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 82    gcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattgcaaaaga 141
             ||||||||||||||| || |||||| |||||||||| || || ||||| || || |||||
Sbjct: 45595 gcttgctatccaaagactggagatcacaaagaatgacctccagatcagaatcgcgaaaga 45654

              
Query: 142   g 142
             |
Sbjct: 45655 g 45655



to top

>gb|AF296837.1|F7K24 Arabidopsis thaliana BAC F7K24
          Length = 103024

 Score = 85.7 bits (43), Expect = 8e-14
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                         
Query: 147   gaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgcc 206
             ||||||||||||| ||||||||||| ||||| ||||| || |||||||||||||| || |
Sbjct: 63704 gaggtaatgcaatattacaggctagcttggagagaaggaaacaagcactgcatgaacgtc 63763

                                    
Query: 207   gtttggtgctggaacaagatgta 229
             |||||  ||| ||||||||||||
Sbjct: 63764 gtttgtcgcttgaacaagatgta 63786



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                         
Query: 230   tcaaggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttgga 289
             ||||| || |||||||||||||| |||||| | |||||  |||| ||| | || ||||| 
Sbjct: 63896 tcaagattacaagagcagctgcaagctgaaagagatctccgagcagcactggaggttggt 63955

                                    
Query: 290   ttaagcatgtcttctgcacaatt 312
             || ||||||||||||| ||||||
Sbjct: 63956 ttgagcatgtcttctggacaatt 63978



to top

>gb|AC151537.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0087D01, complete sequence
          Length = 83225

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                         
Query: 149   ggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgccgt 208
             |||||||||||  ||||||| |||||||||||||| || |||||||||||||| || |||
Sbjct: 31214 ggtaatgcaattctacaggcaagtttggaaagaaggaaacaagcactgcatgaacgtcgt 31155

                                   
Query: 209   ttggtgctggaacaagatgtat 230
             ||||  |||||||| |||||||
Sbjct: 31154 ttggccctggaacaggatgtat 31133



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                         
Query: 233   aggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttggatta 292
             |||||||||||||| || ||||| ||  | ||||||||||||||||| || |||||||| 
Sbjct: 30224 aggttgcaagagcaactacaggcagagagagatcttagagctgcattggaggttggattg 30165

                        
Query: 293   agcatgtcttc 303
             |||||||||||
Sbjct: 30164 agcatgtcttc 30154



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                         
Query: 82    gcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattgcaaaaga 141
             ||||||||| |||||||| || || ||||||||||||||||| | ||| ||||| |||||
Sbjct: 31349 gcttgctattcaaaggctcgaaatagcaaagaatgatctgcagaacagaattgccaaaga 31290

              
Query: 142   g 142
             |
Sbjct: 31289 g 31289



to top

>gb|AC151407.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0073M15,
              complete sequence
          Length = 143071

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                          
Query: 149    ggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgccgt 208
              |||||||||||  ||||||| |||||||||||||| || |||||||||||||| || |||
Sbjct: 110113 ggtaatgcaattctacaggcaagtttggaaagaaggaaacaagcactgcatgaacgtcgt 110054

                                    
Query: 209    ttggtgctggaacaagatgtat 230
              ||||  |||||||| |||||||
Sbjct: 110053 ttggccctggaacaggatgtat 110032



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                          
Query: 233    aggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttggatta 292
              |||||||||||||| || ||||| ||  | ||||||||||||||||| || |||||||| 
Sbjct: 109123 aggttgcaagagcaactacaggcagagagagatcttagagctgcattggaggttggattg 109064

                         
Query: 293    agcatgtcttc 303
              |||||||||||
Sbjct: 109063 agcatgtcttc 109053



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                          
Query: 82     gcttgctatccaaaggcttgagatcgcaaagaatgatctgcaaatcaggattgcaaaaga 141
              ||||||||| |||||||| || || ||||||||||||||||| | ||| ||||| |||||
Sbjct: 110248 gcttgctattcaaaggctcgaaatagcaaagaatgatctgcagaacagaattgccaaaga 110189

               
Query: 142    g 142
              |
Sbjct: 110188 g 110188



to top

>emb|CT033769.2| Medicago truncatula chromosome 5 clone mte1-54l11, COMPLETE SEQUENCE
          Length = 127487

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                        
Query: 230  tcaaggttgcaagagcagctgcaggctgaacgggatcttagagctgcattagaagttgga 289
            ||||| |||||||| ||| |||| |||||  ||||||||||||||||||| |||||||| 
Sbjct: 2945 tcaagattgcaagaacagttgcaagctgagagggatcttagagctgcattggaagttggt 3004

                          
Query: 290  ttaagcatgtcttc 303
            || |||||||||||
Sbjct: 3005 ttgagcatgtcttc 3018



to top

>gb|AC171735.1| Lycopersicon esculentum chromosome 11 clone C11HBa0119D16, complete
            sequence
          Length = 125830

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                        
Query: 147  gaggtaatgcaatcttacaggctagtttggaaagaagaaagcaagcactgcatgagcgcc 206
            |||| ||||||||  | ||||| || ||||| ||| | ||||||||  |||||||||| |
Sbjct: 3444 gaggaaatgcaattctgcaggcgagcttggagagacggaagcaagccttgcatgagcgtc 3503

                                    
Query: 207  gtttggtgctggaacaagatgtat 230
            ||||||  || |||||||||||||
Sbjct: 3504 gtttggctcttgaacaagatgtat 3527



to top

>ref|XM_854508.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 11 (LOC477461), mRNA
          Length = 5400

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1201 gagcagctgctggctgaacgggatct 1226



to top

>ref|XM_854467.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 10 (LOC477461), mRNA
          Length = 5181

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1093 gagcagctgctggctgaacgggatct 1118



to top

>ref|XM_854442.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 9 (LOC477461), mRNA
          Length = 5055

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1201 gagcagctgctggctgaacgggatct 1226



to top

>ref|XM_854404.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 8 (LOC477461), mRNA
          Length = 4953

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1093 gagcagctgctggctgaacgggatct 1118



to top

>ref|XM_854295.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 5 (LOC477461), mRNA
          Length = 5076

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1201 gagcagctgctggctgaacgggatct 1226



to top

>ref|XM_854258.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 4 (LOC477461), mRNA
          Length = 3776

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1201 gagcagctgctggctgaacgggatct 1226



to top

>ref|XM_854226.1| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 3 (LOC477461), mRNA
          Length = 5394

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1201 gagcagctgctggctgaacgggatct 1226



to top

>ref|XM_534659.2| PREDICTED: Canis familiaris similar to Restin (Cytoplasmic linker
            protein-170 alpha-2) (CLIP-170) (Reed-Sternberg
            intermediate filament associated protein), transcript
            variant 1 (LOC477461), mRNA
          Length = 4933

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 242  gagcagctgcaggctgaacgggatct 267
            |||||||||| |||||||||||||||
Sbjct: 1201 gagcagctgctggctgaacgggatct 1226



to top

>gb|AC091278.6| Mus musculus chromosome 1, clone RP23-294D6, complete sequence
          Length = 244656

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 134    gcaaaagagactggaggtaat 154
              |||||||||||||||||||||
Sbjct: 102801 gcaaaagagactggaggtaat 102781



to top

>gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complete sequence
          Length = 148930

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 108   caaagaatgatctgcaaatca 128
             |||||||||||||||||||||
Sbjct: 27000 caaagaatgatctgcaaatca 26980



to top

>gb|AC131673.4| Mus musculus BAC clone RP23-321P21 from 1, complete sequence
          Length = 262190

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 134   gcaaaagagactggaggtaat 154
             |||||||||||||||||||||
Sbjct: 36874 gcaaaagagactggaggtaat 36894



to top

>gb|AY515512.1| SARS coronavirus HC/SZ/61/03, complete genome
          Length = 29731

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10116 ggattaagcatgtcttctgc 10097



to top

>gb|AY609081.1| Synthetic construct SARS coronavirus 3C-like protease gene, partial
           cds
          Length = 948

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 287 ggattaagcatgtcttctgc 306
           ||||||||||||||||||||
Sbjct: 170 ggattaagcatgtcttctgc 151



to top

>gb|AC168852.2| Mus musculus BAC clone RP24-191L21 from chromosome 6, complete sequence
          Length = 171677

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   ggtgctggaacaagatgtat 230
             ||||||||||||||||||||
Sbjct: 75973 ggtgctggaacaagatgtat 75992



to top

>gb|AC116800.11| Mus musculus chromosome 8, clone RP24-335D17, complete sequence
          Length = 168912

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 261    gggatcttagagctgcattagaag 284
              |||||||||||||||||| |||||
Sbjct: 134518 gggatcttagagctgcatgagaag 134541



to top

>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07,
             complete sequence
          Length = 164477

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 238   gcaagagcagctgcaggctg 257
             ||||||||||||||||||||
Sbjct: 50181 gcaagagcagctgcaggctg 50200



to top

>gb|AY714217.1| SARS Coronavirus CDC#200301157, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY559097.1| SARS coronavirus Sin3408L, complete genome
          Length = 29715

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY559096.1| SARS coronavirus Sin850, complete genome
          Length = 29720

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10131 ggattaagcatgtcttctgc 10112



to top

>gb|AY559095.1| SARS coronavirus Sin847, complete genome
          Length = 29719

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10129 ggattaagcatgtcttctgc 10110



to top

>gb|AY559094.1| SARS coronavirus Sin846, complete genome
          Length = 29577

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10125 ggattaagcatgtcttctgc 10106



to top

>gb|AY559093.1| SARS coronavirus Sin845, complete genome
          Length = 29712

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559092.1| SARS coronavirus SinP5, complete genome
          Length = 29713

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559091.1| SARS coronavirus SinP4, complete genome
          Length = 29710

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559090.1| SARS coronavirus SinP3, complete genome
          Length = 29725

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10125 ggattaagcatgtcttctgc 10106



to top

>gb|AY559089.1| SARS coronavirus SinP2, complete genome
          Length = 29717

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559088.1| SARS coronavirus SinP1, complete genome
          Length = 29714

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY559087.1| SARS coronavirus Sin3725V, complete genome
          Length = 29716

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559086.1| SARS coronavirus Sin849, complete genome
          Length = 29661

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559085.1| SARS coronavirus Sin848, complete genome
          Length = 29713

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559084.1| SARS coronavirus Sin3765V, complete genome
          Length = 29722

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY559083.1| SARS coronavirus Sin3408, complete genome
          Length = 29767

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10173 ggattaagcatgtcttctgc 10154



to top

>gb|AY559082.1| SARS coronavirus Sin852, complete genome
          Length = 29670

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10138 ggattaagcatgtcttctgc 10119



to top

>gb|AY559081.1| SARS coronavirus Sin842, complete genome
          Length = 29716

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10126 ggattaagcatgtcttctgc 10107



to top

>gb|AY278741.1| SARS coronavirus Urbani, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10,
              complete sequence
          Length = 140282

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    gcaagagcagctgcaggctg 257
              ||||||||||||||||||||
Sbjct: 118200 gcaagagcagctgcaggctg 118219



to top

>ref|XM_583422.2| PREDICTED: Bos taurus similar to cytoplasmic linker 2 isoform 1
            (LOC506908), mRNA
          Length = 5261

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 241  agagcagctgcaggctgaacggga 264
            ||||||||||| ||||||||||||
Sbjct: 1197 agagcagctgctggctgaacggga 1220



to top

>gb|AY595412.1| SARS coronavirus LLJ-2004, complete genome
          Length = 29716

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10117 ggattaagcatgtcttctgc 10098



to top

>gb|DQ182595.1| SARS coronavirus ZJ0301 from China, complete genome
          Length = 29706

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY274119.3| SARS coronavirus TOR2, complete genome
          Length = 29751

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY323977.2| SARS coronavirus HSR 1, complete genome
          Length = 29751

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY534763.1|AY534762S2 SARS coronavirus Sin_WNV, partial sequence.~~
          Length = 6768

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  ggattaagcatgtcttctgc 306
            ||||||||||||||||||||
Sbjct: 2844 ggattaagcatgtcttctgc 2825



to top

>gb|AY534758.1|AY534758S1 SARS coronavirus Sin0409, partial sequence.~~
          Length = 14011

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  ggattaagcatgtcttctgc 306
            ||||||||||||||||||||
Sbjct: 9594 ggattaagcatgtcttctgc 9575



to top

>gb|AY291315.1| SARS coronavirus Frankfurt 1, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY291451.1| SARS coronavirus TW1, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502932.1| SARS coronavirus TW9, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502931.1| SARS coronavirus TW8, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502930.1| SARS coronavirus TW7, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502929.1| SARS coronavirus TW6, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502928.1| SARS coronavirus TW5, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502927.1| SARS coronavirus TW4, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502926.1| SARS coronavirus TW3, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502925.1| SARS coronavirus TW2, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502924.1| SARS coronavirus TW11, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY502923.1| SARS coronavirus TW10, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY286320.4| SARS coronavirus ZJ01, partial genome
          Length = 26333

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY443088.1|AY443086S03 SARS coronavirus CUHK-L2 orf1ab polyprotein gene, partial cds
          Length = 3078

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  ggattaagcatgtcttctgc 306
            ||||||||||||||||||||
Sbjct: 2324 ggattaagcatgtcttctgc 2305



to top

>gb|AY390556.1| SARS coronavirus GZ02, complete genome
          Length = 29760

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY395004.1| SARS coronavirus HZS2-Bb, partial genome
          Length = 29620

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10092 ggattaagcatgtcttctgc 10073



to top

>gb|AY395003.1| SARS coronavirus ZS-C, complete genome
          Length = 29647

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10088 ggattaagcatgtcttctgc 10069



to top

>gb|AY395002.1| SARS coronavirus LC5, complete genome
          Length = 29350

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY395001.1| SARS coronavirus LC4, complete genome
          Length = 29350

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY395000.1| SARS coronavirus LC3, complete genome
          Length = 29350

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394999.1| SARS coronavirus LC2, complete genome
          Length = 29350

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394998.1| SARS coronavirus LC1, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394997.1| SARS coronavirus ZS-A, complete genome
          Length = 29683

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394996.1| SARS coronavirus ZS-B, complete genome
          Length = 29683

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394995.1| SARS coronavirus HSZ-Cc, complete genome
          Length = 29765

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394994.1| SARS coronavirus HSZ-Bc, complete genome
          Length = 29765

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394993.1| SARS coronavirus HGZ8L2, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394992.1| SARS coronavirus HZS2-C, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394991.1| SARS coronavirus HZS2-Fc, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394990.1| SARS coronavirus HZS2-E, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394989.1| SARS coronavirus HZS2-D, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY394987.1| SARS coronavirus HZS2-Fb, complete genome
          Length = 29709

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10097 ggattaagcatgtcttctgc 10078



to top

>gb|AY394986.1| SARS coronavirus HSZ-Cb, complete genome
          Length = 29729

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10088 ggattaagcatgtcttctgc 10069



to top

>gb|AY394985.1| SARS coronavirus HSZ-Bb, complete genome
          Length = 29530

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  ggattaagcatgtcttctgc 306
            ||||||||||||||||||||
Sbjct: 9889 ggattaagcatgtcttctgc 9870



to top

>gb|AY394984.1| SARS coronavirus HSZ-A, partial genome
          Length = 29733

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10092 ggattaagcatgtcttctgc 10073



to top

>gb|AY394983.1| SARS coronavirus HSZ2-A, complete genome
          Length = 29699

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10087 ggattaagcatgtcttctgc 10068



to top

>gb|AY394982.1| SARS coronavirus HGZ8L1-B, partial genome
          Length = 29646

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10087 ggattaagcatgtcttctgc 10068



to top

>gb|AY394981.1| SARS coronavirus HGZ8L1-A, partial genome
          Length = 29726

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10088 ggattaagcatgtcttctgc 10069



to top

>gb|AY394980.1| SARS coronavirus GZ-D, partial genome
          Length = 29705

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10093 ggattaagcatgtcttctgc 10074



to top

>gb|AY394979.1| SARS coronavirus GZ-C, complete genome
          Length = 29645

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10087 ggattaagcatgtcttctgc 10068



to top

>gb|AY394978.1| SARS coronavirus GZ-B, complete genome
          Length = 29640

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10067 ggattaagcatgtcttctgc 10048



to top

>gb|AY394977.1| SARS coronavirus GZ-A, partial genome
          Length = 29433

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10088 ggattaagcatgtcttctgc 10069



to top

>gb|AY508724.1| SARS coronavirus NS-1, complete genome
          Length = 29732

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY463059.1| SARS coronavirus ShanghaiQXC1, complete genome
          Length = 29592

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10060 ggattaagcatgtcttctgc 10041



to top

>gb|AY463060.1| SARS coronavirus ShanghaiQXC2, complete genome
          Length = 29013

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  ggattaagcatgtcttctgc 306
            ||||||||||||||||||||
Sbjct: 9481 ggattaagcatgtcttctgc 9462



to top

>gb|AC147133.2| Pan troglodytes BAC clone CH251-372A19 from Y, complete sequence
          Length = 192074

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 244    gcagctgcaggctgaacggg 263
              ||||||||||||||||||||
Sbjct: 168518 gcagctgcaggctgaacggg 168499



to top

>gb|AY310120.1| SARS coronavirus FRA, complete genome
          Length = 29740

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY345988.1| SARS coronavirus CUHK-AG03, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY345987.1| SARS coronavirus CUHK-AG02, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY345986.1| SARS coronavirus CUHK-AG01, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY461660.1| SARS coronavirus SoD, complete genome
          Length = 29715

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY282752.2| SARS coronavirus CUHK-Su10, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY357076.1| SARS coronavirus PUMC03, complete genome
          Length = 29745

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10125 ggattaagcatgtcttctgc 10106



to top

>gb|AY357075.1| SARS coronavirus PUMC02, complete genome
          Length = 29738

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10125 ggattaagcatgtcttctgc 10106



to top

>gb|AY350750.1| SARS coronavirus PUMC01, complete genome
          Length = 29738

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10126 ggattaagcatgtcttctgc 10107



to top

>gb|AC122841.4| Mus musculus BAC clone RP23-194E5 from 3, complete sequence
          Length = 200088

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 170    agtttggaaagaagaaagcaagcactgcatga 201
              |||||||||||||||||| ||  |||||||||
Sbjct: 169542 agtttggaaagaagaaaggaaagactgcatga 169573



to top

>gb|AY304495.1| SARS coronavirus GZ50, complete genome
          Length = 29720

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY304488.1| SARS coronavirus SZ16, complete genome
          Length = 29731

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY304486.1| SARS coronavirus SZ3, complete genome
          Length = 29741

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY427439.1| SARS coronavirus AS, complete genome
          Length = 29711

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY283798.2| SARS coronavirus Sin2774, complete genome
          Length = 29711

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY278491.2| SARS coronavirus HKU-39849, complete genome
          Length = 29742

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY278489.2| SARS coronavirus GD01, complete genome
          Length = 29757

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AC182586.3| Pan troglodytes BAC clone CH251-499F21 from chromosome 9, complete
              sequence
          Length = 208237

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 107    gcaaagaatgatctgcaaatcagg 130
              |||||||||||| |||||||||||
Sbjct: 198245 gcaaagaatgatttgcaaatcagg 198268



to top

>emb|AL592287.4| Human DNA sequence from clone RP11-107P1 on chromosome 1, complete
              sequence
          Length = 189385

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    aggctagtttggaaagaaga 184
              ||||||||||||||||||||
Sbjct: 135738 aggctagtttggaaagaaga 135719



to top

>emb|AL441886.18| Human DNA sequence from clone RP11-287G8 on chromosome 10 Contains the
             5'end of gene KIAA1010, the 3'end of gene FLJ40792, the
             CPN1 gene for carboxypeptidase N, polypeptide 1, 50 kD and
             a CpG island, complete sequence
          Length = 135932

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 107   gcaaagaatgatctgcaaatcagg 130
             |||||||||||| |||||||||||
Sbjct: 69714 gcaaagaatgatttgcaaatcagg 69691



to top

>emb|AL390844.12| Human DNA sequence from clone RP11-255N24 on chromosome 9p13.3-21.3
              Contains a CMT1A duplicated region transcript 15 (CDRT15)
              pseudogene, a pseudogene similar to part of solute carrier
              family 4 (anion exchanger), member 1, adaptor protein
              (SLC4A1AP), a novel pseudogene and a RNA binding motif
              protein, X chromosome (RBMX) (HNRPG) pseudogene, complete
              sequence
          Length = 163677

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 107    gcaaagaatgatctgcaaatcagg 130
              |||||||||||| |||||||||||
Sbjct: 156125 gcaaagaatgatttgcaaatcagg 156102



to top

>gb|AY362699.1| SARS coronavirus TWC3, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY362698.1| SARS coronavirus TWC2, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY283794.1| SARS coronavirus Sin2500, complete genome
          Length = 29711

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY283795.1| SARS coronavirus Sin2677, complete genome
          Length = 29705

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY283796.1| SARS coronavirus Sin2679, complete genome
          Length = 29711

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY283797.1| SARS coronavirus Sin2748, complete genome
          Length = 29706

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY278554.2| SARS coronavirus CUHK-W1, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10124 ggattaagcatgtcttctgc 10105



to top

>gb|AY322206.1|AY322205S2 SARS coronavirus Shanhgai LY orf1a polyprotein and orf1ab polyprotein
            genes, partial cds
          Length = 10546

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 287  ggattaagcatgtcttctgc 306
            ||||||||||||||||||||
Sbjct: 4913 ggattaagcatgtcttctgc 4894



to top

>emb|AL138787.11| Human DNA sequence from clone RP4-665N4 on chromosome 1p34.1-35.3
              Contains the 3' end of the EIF2C3 gene for eukaryotic
              translation initiation factor 2C, 3, a putative novel
              transcript, a implantation-associated protein
              (DKFZp564K142) processed pseudogene, the TEKT2 gene for
              tektin 2 (testicular), the COL8A2 gene for collagen, type
              VIII, alpha 2, complete sequence
          Length = 128133

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 107    gcaaagaatgatctgcaaatcagg 130
              |||||||||||| |||||||||||
Sbjct: 110160 gcaaagaatgatttgcaaatcagg 110137



to top

>gb|AY321118.1| SARS coronavirus TWC, complete genome
          Length = 29725

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY279354.2| SARS coronavirus BJ04, complete genome
          Length = 29732

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10123 ggattaagcatgtcttctgc 10104



to top

>gb|AY278490.3| SARS coronavirus BJ03, complete genome
          Length = 29740

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10135 ggattaagcatgtcttctgc 10116



to top

>gb|AY278487.3| SARS coronavirus BJ02, complete genome
          Length = 29745

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY297028.1| SARS coronavirus ZJ01, complete genome
          Length = 29715

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10126 ggattaagcatgtcttctgc 10107



to top

>gb|AY686863.1| SARS coronavirus A022, complete genome
          Length = 29499

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10088 ggattaagcatgtcttctgc 10069



to top

>gb|AY686864.1| SARS coronavirus B039, complete genome
          Length = 29525

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10098 ggattaagcatgtcttctgc 10079



to top

>dbj|BS000642.2| Pan troglodytes chromosome Y clone: PTB-307G08, complete sequence
          Length = 162472

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   gcagctgcaggctgaacggg 263
             ||||||||||||||||||||
Sbjct: 37905 gcagctgcaggctgaacggg 37886



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 244      gcagctgcaggctgaacggg 263
                ||||||||||||||||||||
Sbjct: 18869501 gcagctgcaggctgaacggg 18869520



to top

>gb|AY278488.2| SARS coronavirus BJ01, complete genome
          Length = 29725

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10120 ggattaagcatgtcttctgc 10101



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    gcaagagcagctgcaggctg 257
              ||||||||||||||||||||
Sbjct: 845758 gcaagagcagctgcaggctg 845777



to top

>gb|AY394850.2| SARS coronavirus WHU, complete genome
          Length = 29728

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AC068129.6| Homo sapiens BAC clone RP11-619F9 from 2, complete sequence
          Length = 150646

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 107   gcaaagaatgatctgcaaatcagg 130
             |||||||||||| |||||||||||
Sbjct: 14136 gcaaagaatgatttgcaaatcagg 14113



to top

>gb|AY074786.1| Oryza sativa dehydroascorbate reductase (DHAR) mRNA, complete cds
          Length = 1067

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 238  gcaagagcagctgcaggctg 257
            ||||||||||||||||||||
Sbjct: 1044 gcaagagcagctgcaggctg 1025



to top

>gb|AY338175.1| SARS coronavirus Taiwan TC2, complete genome
          Length = 29573

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10070 ggattaagcatgtcttctgc 10051



to top

>gb|AY338174.1| SARS coronavirus Taiwan TC1, complete genome
          Length = 29573

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10070 ggattaagcatgtcttctgc 10051



to top

>gb|AY348314.1| SARS coronavirus Taiwan TC3, complete genome
          Length = 29573

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10070 ggattaagcatgtcttctgc 10051



to top

>gb|AC007284.4|AC007284 Homo sapiens BAC clone RP11-558K21 from Y, complete sequence
          Length = 171449

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    aaagagactggaggtaatgc 156
              ||||||||||||||||||||
Sbjct: 151591 aaagagactggaggtaatgc 151572



to top

>gb|AC135168.8| Homo sapiens, clone CTD-2025E19, complete sequence
          Length = 125231

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 107   gcaaagaatgatctgcaaatcagg 130
             |||||||||||| |||||||||||
Sbjct: 46375 gcaaagaatgatttgcaaatcagg 46352



to top

>gb|DQ071615.1| Bat SARS coronavirus Rp3, complete genome
          Length = 29736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10133 ggattaagcatgtcttctgc 10114



to top

>gb|AC146450.5| Pan troglodytes BAC clone clone CH251-552K12 from y, complete sequence
          Length = 172072

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   gcagctgcaggctgaacggg 263
             ||||||||||||||||||||
Sbjct: 83999 gcagctgcaggctgaacggg 83980



to top

>gb|AC006371.2|AC006371 Homo sapiens BAC clone RP11-304C24 from Y, complete sequence
          Length = 202354

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   gcagctgcaggctgaacggg 263
             ||||||||||||||||||||
Sbjct: 57930 gcagctgcaggctgaacggg 57949



to top

>dbj|AK070895.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074C02, full
            insert sequence
          Length = 1198

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 238  gcaagagcagctgcaggctg 257
            ||||||||||||||||||||
Sbjct: 1045 gcaagagcagctgcaggctg 1026



to top

>gb|AY654624.1| SARS coronavirus TJF, complete genome
          Length = 29745

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10138 ggattaagcatgtcttctgc 10119



to top

>dbj|AK061836.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-D08, full
            insert sequence
          Length = 1053

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 238  gcaagagcagctgcaggctg 257
            ||||||||||||||||||||
Sbjct: 1049 gcaagagcagctgcaggctg 1030



to top

>gb|AY772062.1| SARS coronavirus WH20, complete genome
          Length = 29461

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10149 ggattaagcatgtcttctgc 10130



to top

>gb|AY545919.1| SARS coronavirus isolate CFB/SZ/94/03, complete genome
          Length = 29739

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10118 ggattaagcatgtcttctgc 10099



to top

>gb|AY545918.1| SARS coronavirus isolate HC/GZ/32/03, complete genome
          Length = 29737

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10105 ggattaagcatgtcttctgc 10086



to top

>gb|AY545917.1| SARS coronavirus isolate HC/GZ/81/03, complete genome
          Length = 29739

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10103 ggattaagcatgtcttctgc 10084



to top

>gb|AY545916.1| SARS coronavirus isolate HC/SZ/266/03, complete genome
          Length = 29721

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10105 ggattaagcatgtcttctgc 10086



to top

>gb|AY545915.1| SARS coronavirus isolate HC/SZ/DM1/03, complete genome
          Length = 29714

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10107 ggattaagcatgtcttctgc 10088



to top

>gb|AY545914.1| SARS coronavirus isolate HC/SZ/79/03, complete genome
          Length = 29723

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10116 ggattaagcatgtcttctgc 10097



to top

>gb|AY568539.1| SARS coronavirus GZ0401, complete genome
          Length = 29730

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10089 ggattaagcatgtcttctgc 10070



to top

>gb|AY313906.1| SARS coronavirus GD69, complete genome
          Length = 29754

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY613950.1| SARS coronavirus PC4-227, complete genome
          Length = 29728

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10089 ggattaagcatgtcttctgc 10070



to top

>gb|AY613949.1| SARS coronavirus PC4-136, complete genome
          Length = 29730

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10089 ggattaagcatgtcttctgc 10070



to top

>gb|AY613948.1| SARS coronavirus PC4-13, complete genome
          Length = 29730

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10089 ggattaagcatgtcttctgc 10070



to top

>gb|AY613947.1| SARS coronavirus GZ0402, complete genome
          Length = 29730

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10089 ggattaagcatgtcttctgc 10070



to top

>emb|AL805963.23| Mouse DNA sequence from clone RP23-98K7 on chromosome X, complete
              sequence
          Length = 233546

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    aagaagaaagcaagcactgc 197
              ||||||||||||||||||||
Sbjct: 170935 aagaagaaagcaagcactgc 170916



to top

>emb|AL844521.15| Zebrafish DNA sequence from clone DKEY-155O15 in linkage group 19,
             complete sequence
          Length = 213269

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   agaagaaagcaagcactgca 198
             ||||||||||||||||||||
Sbjct: 66778 agaagaaagcaagcactgca 66797



to top

>gb|AC140238.3| Mus musculus BAC clone RP24-279O7 from 3, complete sequence
          Length = 174633

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 170    agtttggaaagaagaaagcaagcactgcatga 201
              |||||||||||||||||| ||  |||||||||
Sbjct: 125879 agtttggaaagaagaaaggaaagactgcatga 125848



to top

>dbj|AP006561.1| SARS coronavirus TWY genomic RNA, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>dbj|AP006560.1| SARS coronavirus TWS genomic RNA, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>dbj|AP006559.1| SARS coronavirus TWK genomic RNA, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>dbj|AP006558.1| SARS coronavirus TWJ genomic RNA, complete genome
          Length = 29725

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>dbj|AP006557.1| SARS coronavirus TWH genomic RNA, complete genome
          Length = 29727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY572038.1| SARS coronavirus civet020, complete genome
          Length = 29683

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10068 ggattaagcatgtcttctgc 10049



to top

>gb|AY572035.1| SARS coronavirus civet010, complete genome
          Length = 29518

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10091 ggattaagcatgtcttctgc 10072



to top

>gb|AY572034.1| SARS coronavirus civet007, complete genome
          Length = 29540

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10113 ggattaagcatgtcttctgc 10094



to top

>gb|AY485278.1| SARS coronavirus Sino3-11, complete genome
          Length = 29740

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>gb|AY485277.1| SARS coronavirus Sino1-11, complete genome
          Length = 29741

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10139 ggattaagcatgtcttctgc 10120



to top

>dbj|AB257344.1| SARS coronavirus Frankfurt 1 genomic RNA, nearly complete genome,
             clone: persistent virus #21
          Length = 29632

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   ggattaagcatgtcttctgc 306
             ||||||||||||||||||||
Sbjct: 10098 ggattaagcatgtcttctgc 10079



to top

>gb|AC092891.5| Homo sapiens 12 BAC RP11-495C19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 109440

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 107   gcaaagaatgatctgcaaatcagg 130
             |||||||||||| |||||||||||
Sbjct: 70301 gcaaagaatgatttgcaaatcagg 70278



to top

>dbj|AB037970.1| Oryza sativa (japonica cultivar-group) DHAR1 mRNA for GSH-dependent
            dehydroascorbate reductase 1, complete cds
          Length = 1044

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 238  gcaagagcagctgcaggctg 257
            ||||||||||||||||||||
Sbjct: 1014 gcaagagcagctgcaggctg 995



to top

>emb|AL833807.5| Mouse DNA sequence from clone RP23-305G2 on chromosome 2, complete
             sequence
          Length = 65071

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   aagaaagcaagcactgcatg 200
             ||||||||||||||||||||
Sbjct: 55318 aagaaagcaagcactgcatg 55337


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,961,867
Number of Sequences: 3902068
Number of extensions: 2961867
Number of successful extensions: 62061
Number of sequences better than 10.0: 193
Number of HSP's better than 10.0 without gapping: 193
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61668
Number of HSP's gapped (non-prelim): 393
length of query: 313
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 291
effective length of database: 17,147,199,772
effective search space: 4989835133652
effective search space used: 4989835133652
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top