ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bags32f21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC160247.2| Pan troglodytes BAC clone CH251-540N18 from chrom... 44 0.56
2gb|AC000118.1| Homo sapiens BAC clone CTB-72E11 from 7, complete... 44 0.56
3gb|AC129884.4| Ornithorhynchus anatinus clone OA_Bb-5C22, comple... 44 0.56
4gb|AC122751.8| Mus musculus chromosome 8, clone RP24-320L13, com... 42 2.2
5gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosom... 42 2.2
6emb|AL138721.16| Human DNA sequence from clone RP11-174N3 on chr... 42 2.2
7gb|AC158353.3| Mus musculus chromosome 8, clone RP24-363C18, com... 42 2.2
8gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswel... 42 2.2
9gb|AC091128.2| Drosophila melanogaster 3L BAC RP98-17O7 (Roswell... 42 2.2
10gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 ... 42 2.2
11emb|BX119983.4| Zebrafish DNA sequence from clone CH211-198G9 in... 42 2.2
12gb|AY847952.1| Hyblaea puera clone Coimbatore cytochrome b gene,... 40 8.7
13gb|AY847950.1| Hyblaea puera clone Nilambur cytochrome b gene, p... 40 8.7
14gb|AC115767.14| Mus musculus chromosome 6, clone RP23-83K15, com... 40 8.7
15gb|AY334179.1| Copelatus sp. MB224 cytochrome b (CytB) gene, par... 40 8.7
16gb|AY334178.1| Copelatus sp. MB222 cytochrome b (CytB) gene, par... 40 8.7
17gb|AY334173.1| Copelatus sp. MB188 cytochrome b (CytB) gene, par... 40 8.7
18gb|AY334170.1| Copelatus sp. MB143 cytochrome b (CytB) gene, par... 40 8.7
19gb|AC145120.1| Solanum demissum chromosome 5 BAC PGEC446O19 geno... 40 8.7
20gb|AC000120.1| Homo sapiens BAC clone CTB-161K23 from 7, complet... 40 8.7
21gb|AY738386.1| Podismopsis poppiusi cytochrome b (Cytb) gene, pa... 40 8.7
22gb|AC122324.4| Mus musculus BAC clone RP23-333I5 from chromosome... 40 8.7
23gb|AC122866.4| Mus musculus BAC clone RP23-145J18 from 8, comple... 40 8.7
24gb|AF191158.1| Oecophylla smaragdina cytochrome b gene, partial ... 40 8.7
25gb|AY191793.1| Myrmecia pyriformis cytochrome b gene, partial cd... 40 8.7
26emb|Z83848.1|HS57A13 Human DNA sequence from clone RP1-57A13 on ... 40 8.7
27emb|AL645820.1| Human DNA sequence from clone RP1-138O17 on chro... 40 8.7
28gb|DQ472026.1| Nautilus macromphalus mitochondrion, complete genome 40 8.7
29emb|AL365398.22| Human DNA sequence from clone RP11-430L14 on ch... 40 8.7
30emb|AL359836.16| Human DNA sequence from clone RP11-389E6 on chr... 40 8.7
31emb|AL353640.7| Human DNA sequence from clone RP11-458E15 on chr... 40 8.7
32emb|AL139377.8| Human DNA sequence from clone RP11-251J8 on chro... 40 8.7
33emb|AL080249.26|HSJ564F22 Human DNA sequence from clone RP4-564F... 40 8.7
34emb|AL035067.2|HS170F5 Human DNA sequence from clone RP6-170F5 o... 40 8.7
35emb|AJ515093.1|PSP515093 Prothyma sp. APV-2001 mitochondrial par... 40 8.7
36gb|AF021088.1| Achenomorphus corticinus cytochrome b (cytb) gene... 40 8.7
37gb|AF021071.1| Oxyporus stygicus cytochrome b (cytb) gene, mitoc... 40 8.7
38gb|AF277763.1| Macrocneme chrysitis cytochrome b gene, partial c... 40 8.7
39gb|AY263802.1| Archaeochlus drakensbergensis cytochrome b gene, ... 40 8.7
40gb|DQ407479.1| Lucilia cuprina clone SCUBP06036 cytochrome b (cy... 40 8.7
41gb|DQ407478.1| Lucilia cuprina clone SCUBP06035 cytochrome b (cy... 40 8.7
42gb|DQ407476.1| Lucilia cuprina clone SCUBP06033 cytochrome b (cy... 40 8.7
43gb|DQ407475.1| Lucilia cuprina clone SCUBP06032 cytochrome b (cy... 40 8.7
44gb|DQ400446.1| Chrysomya megacephala clone SCUBP06010 cytochrome... 40 8.7
45gb|DQ400487.1| Lucilia sericata clone SCUBP06016 cytochrome b (c... 40 8.7
46gb|DQ400485.1| Lucilia sericata clone SCUBP06014 cytochrome b (c... 40 8.7
47gb|DQ400484.1| Lucilia sericata clone SCUBP06013 cytochrome b (c... 40 8.7
48gb|AY968672.1| Campanulotes bidentatus compar mitochondrion, com... 40 8.7
49gb|AF161201.1| Phlebotomus cf. perfiliewi cytochrome b (Cytb) ge... 40 8.7
50gb|AF161200.1| Phlebotomus perfiliewi isolate T92 cytochrome b (... 40 8.7
51gb|AF161199.1| Phlebotomus perfiliewi isolate T91 cytochrome b (... 40 8.7
52gb|AF161198.1| Phlebotomus perfiliewi isolate T41 cytochrome b (... 40 8.7
53gb|AF161197.1| Phlebotomus perfiliewi isolate T40 cytochrome b (... 40 8.7
54gb|AC091894.2| Homo sapiens chromosome 5 clone RP11-138J23, comp... 40 8.7
55gb|AC013725.7| Homo sapiens BAC clone RP11-323F5 from 4, complet... 40 8.7
56gb|AF001905.1|AF001905 Homo sapiens cosmids E079, B0920 and A8 f... 40 8.7
57gb|AF192186.1|AF192186 Archaeochlus drakensbergensis cytochrome ... 40 8.7
58gb|AC073964.3|AC073964 Homo sapiens chromosome 15 clone RP11-394... 40 8.7
59gb|AY625429.1| Bruchidius auratopubens cytochrome b (cytb) gene,... 40 8.7
60gb|AC092162.3| Homo sapiens BAC clone RP11-632P5 from 2, complet... 40 8.7
61gb|AY242996.1| Antheraea pernyi mitochondrion, complete genome 40 8.7
62gb|AC022407.6|AC022407 Homo sapiens chromosome 15 clone RP11-105... 40 8.7
63gb|AC092093.34| Mus musculus strain C57BL/6J chromosome 10 clone... 40 8.7
64gb|DQ006909.1| Chaetellipsis maculosa Q043_2 cytochrome b (cytb)... 40 8.7
65gb|DQ006908.1| Chaetellipsis maculosa Q043_1 cytochrome b (cytb)... 40 8.7
66gb|AY168608.1| Antheraea pernyi cytochrome b gene, partial cds; ... 40 8.7
67dbj|AB125685.1| Erythroplusia rutilifrons mitochondrial cytb gen... 40 8.7
68dbj|AB125679.1| Abrostola triplasia mitochondrial cytb gene for ... 40 8.7
69gb|AF439151.1| Cicindela pulchrapraecisa cytochrome b gene, part... 40 8.7
70gb|AF439148.1| Cicindela viridisticta cytochrome b gene, partial... 40 8.7
71gb|AC005887.3|AC005887 citb_173_i_12, complete sequence 40 8.7
72gb|AC165437.5| Mus musculus chromosome 15, clone RP23-285N11, co... 40 8.7
73gb|DQ073916.1| Adoxophyes honmai mitochondrion, complete genome 40 8.7
74gb|AY744225.1| Dolichopus urbanus voucher Pollet 0001 (P) cytoch... 40 8.7
75gb|DQ133153.1| Strebla mirabilis cytochrome b gene, partial cds;... 40 8.7
76gb|DQ133151.1| Strebla guajiro cytochrome b gene, partial cds; m... 40 8.7
77gb|AC129076.6| Mus musculus BAC clone RP24-494O16 from 6, comple... 40 8.7
78gb|AC091764.35| Mus musculus strain C57BL/6J chromosome 10 clone... 40 8.7
79emb|Z72519.1|HSJ13817A Human DNA sequence from cosmid J138O17, b... 40 8.7
80dbj|AB056084.1| Oecophylla smaragdina mitochondrial cytb gene fo... 40 8.7
81dbj|AB056082.1| Oecophylla smaragdina mitochondrial cytb gene fo... 40 8.7
82dbj|AB056081.1| Oecophylla smaragdina mitochondrial cytb gene fo... 40 8.7
83dbj|AB056080.1| Oecophylla smaragdina mitochondrial cytb gene fo... 40 8.7
84dbj|AB056076.1| Oecophylla smaragdina mitochondrial cytb gene fo... 40 8.7 
>gb|AC160247.2| Pan troglodytes BAC clone CH251-540N18 from chromosome 7, complete
              sequence
          Length = 168031

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 10     ggaaccctggtacattgctcat 31
              ||||||||||||||||||||||
Sbjct: 137971 ggaaccctggtacattgctcat 137992
to top
>gb|AC000118.1| Homo sapiens BAC clone CTB-72E11 from 7, complete sequence
          Length = 96625

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 10    ggaaccctggtacattgctcat 31
             ||||||||||||||||||||||
Sbjct: 50768 ggaaccctggtacattgctcat 50747
to top
>gb|AC129884.4| Ornithorhynchus anatinus clone OA_Bb-5C22, complete sequence
          Length = 120929

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 613   attttaaaaatgatctgggaag 634
             ||||||||||||||||||||||
Sbjct: 97241 attttaaaaatgatctgggaag 97220
to top
>gb|AC122751.8| Mus musculus chromosome 8, clone RP24-320L13, complete sequence
          Length = 162548

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 610   cagattttaaaaatgatctgggaag 634
             |||||||||||||| ||||||||||
Sbjct: 53990 cagattttaaaaattatctgggaag 53966
to top
>gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosome 12, complete
             sequence
          Length = 196396

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 291   ggaaatttgttattatgtagt 311
             |||||||||||||||||||||
Sbjct: 98304 ggaaatttgttattatgtagt 98324
to top
>emb|AL138721.16| Human DNA sequence from clone RP11-174N3 on chromosome 6 Contains the
             3' end of gene KIAA0229 for a novel Ank, SAM (Sterile
             alpha motif) and Phosphotyrosine interaction (PTB/PID)
             domain containing protein, the TCP11 gene for t-complex 11
             (mouse) and two CpG islands, complete sequence
          Length = 155539

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     ttggaaccctggtacattgct 28
             |||||||||||||||||||||
Sbjct: 76311 ttggaaccctggtacattgct 76331
to top
>gb|AC158353.3| Mus musculus chromosome 8, clone RP24-363C18, complete sequence
          Length = 161841

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 610    cagattttaaaaatgatctgggaag 634
              |||||||||||||| ||||||||||
Sbjct: 154298 cagattttaaaaattatctgggaag 154322
to top
>gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 187438

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 373    tgccaaactagatttttagttattt 397
              |||||||||||||||||| ||||||
Sbjct: 113139 tgccaaactagatttttatttattt 113163
to top
>gb|AC091128.2| Drosophila melanogaster 3L BAC RP98-17O7 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170465

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 373   tgccaaactagatttttagttattt 397
             |||||||||||||||||| ||||||
Sbjct: 32808 tgccaaactagatttttatttattt 32832
to top
>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete
              sequence
          Length = 318699

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 373    tgccaaactagatttttagttattt 397
              |||||||||||||||||| ||||||
Sbjct: 237687 tgccaaactagatttttatttattt 237711
to top
>emb|BX119983.4| Zebrafish DNA sequence from clone CH211-198G9 in linkage group 1,
             complete sequence
          Length = 172227

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 250   gccaagtaattttagatttacttga 274
             ||||||||||||||| |||||||||
Sbjct: 87392 gccaagtaattttagttttacttga 87416
to top
>gb|AY847952.1| Hyblaea puera clone Coimbatore cytochrome b gene, partial sequence;
           mitochondrial
          Length = 373

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 267 tcctgataattttattcctg 286
to top
>gb|AY847950.1| Hyblaea puera clone Nilambur cytochrome b gene, partial sequence;
           mitochondrial
          Length = 753

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 647 tcctgataattttattcctg 666
to top
>gb|AC115767.14| Mus musculus chromosome 6, clone RP23-83K15, complete sequence
          Length = 257790

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 363   tggtgttctttgccaaactagatt 386
             ||||||||||||||||||| ||||
Sbjct: 48563 tggtgttctttgccaaactggatt 48586
to top
>gb|AY334179.1| Copelatus sp. MB224 cytochrome b (CytB) gene, partial cds;
           mitochondrial
          Length = 343

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 301 tcctgataattttattcctg 320
to top
>gb|AY334178.1| Copelatus sp. MB222 cytochrome b (CytB) gene, partial cds;
           mitochondrial
          Length = 343

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 301 tcctgataattttattcctg 320
to top
>gb|AY334173.1| Copelatus sp. MB188 cytochrome b (CytB) gene, partial cds;
           mitochondrial
          Length = 343

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 301 tcctgataattttattcctg 320
to top
>gb|AY334170.1| Copelatus sp. MB143 cytochrome b (CytB) gene, partial cds;
           mitochondrial
          Length = 343

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 301 tcctgataattttattcctg 320
to top
>gb|AC145120.1| Solanum demissum chromosome 5 BAC PGEC446O19 genomic sequence, complete
             sequence
          Length = 122450

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 543   ctaattatattttcctaaat 562
             ||||||||||||||||||||
Sbjct: 90429 ctaattatattttcctaaat 90448
to top
>gb|AC000120.1| Homo sapiens BAC clone CTB-161K23 from 7, complete sequence
          Length = 142396

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      ttggaaccctggtacattgc 27
              ||||||||||||||||||||
Sbjct: 109529 ttggaaccctggtacattgc 109510
to top
>gb|AY738386.1| Podismopsis poppiusi cytochrome b (Cytb) gene, partial cds;
           mitochondrial
          Length = 640

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 292 tcctgataattttattcctg 311
to top
>gb|AC122324.4| Mus musculus BAC clone RP23-333I5 from chromosome 3, complete sequence
          Length = 243378

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    tagttattttctgtagcatg 408
              ||||||||||||||||||||
Sbjct: 181085 tagttattttctgtagcatg 181104
to top
>gb|AC122866.4| Mus musculus BAC clone RP23-145J18 from 8, complete sequence
          Length = 200136

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 389   tagttattttctgtagcatg 408
             ||||||||||||||||||||
Sbjct: 82348 tagttattttctgtagcatg 82329
to top
>gb|AF191158.1| Oecophylla smaragdina cytochrome b gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 405

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 315 tcctgataattttattcctg 334
to top
>gb|AY191793.1| Myrmecia pyriformis cytochrome b gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 693

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 603 tcctgataattttattcctg 622
to top
>emb|Z83848.1|HS57A13 Human DNA sequence from clone RP1-57A13 on chromosome Xq24 Contains the
             5' end of the GRIA3 gene for glutamate receptor,
             ionotrophic, AMPA 3, the gene for a novel protein and a
             CpG island, complete sequence
          Length = 169693

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   taattttagatttacttgaa 275
             ||||||||||||||||||||
Sbjct: 82690 taattttagatttacttgaa 82709
to top
>emb|AL645820.1| Human DNA sequence from clone RP1-138O17 on chromosome X, complete
            sequence
          Length = 125787

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 88   tttgaagtttctcaaggaagctgg 111
            |||||||||||| |||||||||||
Sbjct: 8653 tttgaagtttctgaaggaagctgg 8630
to top
>gb|DQ472026.1| Nautilus macromphalus mitochondrion, complete genome
          Length = 16258

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 512   tcctgataattttattcctg 531
             ||||||||||||||||||||
Sbjct: 11180 tcctgataattttattcctg 11161
to top
>emb|AL365398.22| Human DNA sequence from clone RP11-430L14 on chromosome 10 Contains the
             3' end of the BTAF1 gene for BTAF1 RNA polymerase II,
             B-TFIID transcription factor-associated, 170kDa (Mot1
             homolog, S. cerevisiae) and the 3' end of the gene for
             KIAA0940 protein, complete sequence
          Length = 95298

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     tggaaccctggtacattgct 28
             ||||||||||||||||||||
Sbjct: 30852 tggaaccctggtacattgct 30833
to top
>emb|AL359836.16| Human DNA sequence from clone RP11-389E6 on chromosome 10 Contains the
             5' end of gene LOC118987 and a CpG island, complete
             sequence
          Length = 49052

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 606   tgttcagattttaaaaatga 625
             ||||||||||||||||||||
Sbjct: 44235 tgttcagattttaaaaatga 44254
to top
>emb|AL353640.7| Human DNA sequence from clone RP11-458E15 on chromosome 20 Contains
             ESTs, STSs, GSSs and a CpG island, complete sequence
          Length = 62477

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 8     ttggaaccctggtacattgctcat 31
             |||||||||| |||||||||||||
Sbjct: 34407 ttggaacccttgtacattgctcat 34384
to top
>emb|AL139377.8| Human DNA sequence from clone RP11-251J8 on chromosome 13 Contains 2
             novel genes, the KIAA0610 gene and a CpG island, complete
             sequence
          Length = 153964

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 605   gtgttcagattttaaaaatg 624
             ||||||||||||||||||||
Sbjct: 63631 gtgttcagattttaaaaatg 63650
to top
>emb|AL080249.26|HSJ564F22 Human DNA sequence from clone RP4-564F22 on chromosome 20 Contains
           the LBP gene encoding the lipopolysaccharide-binding
           protein, a RNU71A gene for U71A small nucleolar RNA, a
           RNU71B gene for U71B small nucleolar RNA, a novel gene,
           a novel gene (FLJ33613) and 3 CpG islands, complete
           sequence
          Length = 95508

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 613 attttaaaaatgatctggga 632
           ||||||||||||||||||||
Sbjct: 627 attttaaaaatgatctggga 646
to top
>emb|AL035067.2|HS170F5 Human DNA sequence from clone RP6-170F5 on chromosome Xq22.3-24
             Contains an HMG1 (high-mobility group (nonhistone
             chromosomal) protein 1) pseudogene, complete sequence
          Length = 134218

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   ctttgccaaactagattttt 389
             ||||||||||||||||||||
Sbjct: 85878 ctttgccaaactagattttt 85897
to top
>emb|AJ515093.1|PSP515093 Prothyma sp. APV-2001 mitochondrial partial cytb gene for
           cytochrome b
          Length = 410

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 336 tcctgataattttattcctg 355
to top
>gb|AF021088.1| Achenomorphus corticinus cytochrome b (cytb) gene, mitochondrial
           gene encoding mitochondrial protein, partial cds
          Length = 465

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 354 tcctgataattttattcctg 373
to top
>gb|AF021071.1| Oxyporus stygicus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 465

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 354 tcctgataattttattcctg 373
to top
>gb|AF277763.1| Macrocneme chrysitis cytochrome b gene, partial cds; mitochondrial
          Length = 488

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 294 tcctgataattttattcctg 313
to top
>gb|AY263802.1| Archaeochlus drakensbergensis cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 740

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 332 tcctgataattttattcctg 351
to top
>gb|DQ407479.1| Lucilia cuprina clone SCUBP06036 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ407478.1| Lucilia cuprina clone SCUBP06035 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ407476.1| Lucilia cuprina clone SCUBP06033 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ407475.1| Lucilia cuprina clone SCUBP06032 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ400446.1| Chrysomya megacephala clone SCUBP06010 cytochrome b (cytb) gene,
           partial cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ400487.1| Lucilia sericata clone SCUBP06016 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ400485.1| Lucilia sericata clone SCUBP06014 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|DQ400484.1| Lucilia sericata clone SCUBP06013 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 485

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 366 tcctgataattttattcctg 385
to top
>gb|AY968672.1| Campanulotes bidentatus compar mitochondrion, complete genome
          Length = 14804

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 512  tcctgataattttattcctg 531
            ||||||||||||||||||||
Sbjct: 7651 tcctgataattttattcctg 7670
to top
>gb|AF161201.1| Phlebotomus cf. perfiliewi cytochrome b (Cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 714

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 339 tcctgataattttattcctg 358
to top
>gb|AF161200.1| Phlebotomus perfiliewi isolate T92 cytochrome b (Cytb) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 714

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 339 tcctgataattttattcctg 358
to top
>gb|AF161199.1| Phlebotomus perfiliewi isolate T91 cytochrome b (Cytb) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 714

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 339 tcctgataattttattcctg 358
to top
>gb|AF161198.1| Phlebotomus perfiliewi isolate T41 cytochrome b (Cytb) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 714

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 339 tcctgataattttattcctg 358
to top
>gb|AF161197.1| Phlebotomus perfiliewi isolate T40 cytochrome b (Cytb) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 714

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 339 tcctgataattttattcctg 358
to top
>gb|AC091894.2| Homo sapiens chromosome 5 clone RP11-138J23, complete sequence
          Length = 175552

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 8      ttggaaccctggtacattgctcat 31
              ||||||||||| ||||||||||||
Sbjct: 123293 ttggaaccctgatacattgctcat 123316
to top
>gb|AC013725.7| Homo sapiens BAC clone RP11-323F5 from 4, complete sequence
          Length = 166048

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      tggaaccctggtacattgct 28
              ||||||||||||||||||||
Sbjct: 156245 tggaaccctggtacattgct 156264
to top
>gb|AF001905.1|AF001905 Homo sapiens cosmids E079, B0920 and A8 from Xq25 X-linked
              lymphoproliferative disease gene candidate region, complete
              sequence
          Length = 197620

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 88     tttgaagtttctcaaggaagctgg 111
              |||||||||||| |||||||||||
Sbjct: 117135 tttgaagtttctgaaggaagctgg 117158
to top
>gb|AF192186.1|AF192186 Archaeochlus drakensbergensis cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 685

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 307 tcctgataattttattcctg 326
to top
>gb|AC073964.3|AC073964 Homo sapiens chromosome 15 clone RP11-394B5 map 15q21.2, complete
             sequence
          Length = 189796

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     tggaaccctggtacattgct 28
             ||||||||||||||||||||
Sbjct: 12208 tggaaccctggtacattgct 12189
to top
>gb|AY625429.1| Bruchidius auratopubens cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 782

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 665 tcctgataattttattcctg 684
to top
>gb|AC092162.3| Homo sapiens BAC clone RP11-632P5 from 2, complete sequence
          Length = 155011

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   gtgccaagtaattttagatt 267
             ||||||||||||||||||||
Sbjct: 22722 gtgccaagtaattttagatt 22741
to top
>gb|AY242996.1| Antheraea pernyi mitochondrion, complete genome
          Length = 15575

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 512   tcctgataattttattcctg 531
             ||||||||||||||||||||
Sbjct: 11307 tcctgataattttattcctg 11326
to top
>gb|AC022407.6|AC022407 Homo sapiens chromosome 15 clone RP11-105D1 map 15q21.2, complete
              sequence
          Length = 143210

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      tggaaccctggtacattgct 28
              ||||||||||||||||||||
Sbjct: 139630 tggaaccctggtacattgct 139611
to top
>gb|AC092093.34| Mus musculus strain C57BL/6J chromosome 10 clone rp23-168o8, complete
              sequence
          Length = 200124

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 602    catgtgttcagattttaaaaatga 625
              |||||||||||||||| |||||||
Sbjct: 161141 catgtgttcagattttcaaaatga 161118
to top
>gb|DQ006909.1| Chaetellipsis maculosa Q043_2 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 676

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 623 tcctgataattttattcctg 642
to top
>gb|DQ006908.1| Chaetellipsis maculosa Q043_1 cytochrome b (cytb) gene, partial
           cds; mitochondrial
          Length = 694

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 641 tcctgataattttattcctg 660
to top
>gb|AY168608.1| Antheraea pernyi cytochrome b gene, partial cds; mitochondrial gene
           for mitochondrial product
          Length = 397

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 304 tcctgataattttattcctg 323
to top
>dbj|AB125685.1| Erythroplusia rutilifrons mitochondrial cytb gene for cytochrome b,
           partial cds
          Length = 680

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 303 tcctgataattttattcctg 322
to top
>dbj|AB125679.1| Abrostola triplasia mitochondrial cytb gene for cytochrome b,
           partial cds
          Length = 680

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 303 tcctgataattttattcctg 322
to top
>gb|AF439151.1| Cicindela pulchrapraecisa cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 411

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 337 tcctgataattttattcctg 356
to top
>gb|AF439148.1| Cicindela viridisticta cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 411

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 337 tcctgataattttattcctg 356
to top
>gb|AC005887.3|AC005887 citb_173_i_12, complete sequence
          Length = 120578

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 606   tgttcagattttaaaaatga 625
             ||||||||||||||||||||
Sbjct: 39501 tgttcagattttaaaaatga 39482
to top
>gb|AC165437.5| Mus musculus chromosome 15, clone RP23-285N11, complete sequence
          Length = 228289

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    gctgcgccacaccttgctca 219
              ||||||||||||||||||||
Sbjct: 113471 gctgcgccacaccttgctca 113490
to top
>gb|DQ073916.1| Adoxophyes honmai mitochondrion, complete genome
          Length = 15680

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 512   tcctgataattttattcctg 531
             ||||||||||||||||||||
Sbjct: 11480 tcctgataattttattcctg 11499
to top
>gb|AY744225.1| Dolichopus urbanus voucher Pollet 0001 (P) cytochrome b (Cytb)
           gene, partial cds; mitochondrial
          Length = 605

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 324 tcctgataattttattcctg 343
to top
>gb|DQ133153.1| Strebla mirabilis cytochrome b gene, partial cds; mitochondrial
          Length = 373

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 338 tcctgataattttattcctg 357
to top
>gb|DQ133151.1| Strebla guajiro cytochrome b gene, partial cds; mitochondrial
          Length = 373

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 338 tcctgataattttattcctg 357
to top
>gb|AC129076.6| Mus musculus BAC clone RP24-494O16 from 6, complete sequence
          Length = 166003

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 363    tggtgttctttgccaaactagatt 386
              ||||||||||||||||||| ||||
Sbjct: 125547 tggtgttctttgccaaactggatt 125524
to top
>gb|AC091764.35| Mus musculus strain C57BL/6J chromosome 10 clone rp23-202b12, complete
             sequence
          Length = 230848

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 602   catgtgttcagattttaaaaatga 625
             |||||||||||||||| |||||||
Sbjct: 69791 catgtgttcagattttcaaaatga 69768
to top
>emb|Z72519.1|HSJ13817A Human DNA sequence from cosmid J138O17, between markers DXS6791 and
              DXS8038 on chromosome X contains EST CA repeat and an
              endogenous retroviral like element
          Length = 125787

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 88     tttgaagtttctcaaggaagctgg 111
              |||||||||||| |||||||||||
Sbjct: 117135 tttgaagtttctgaaggaagctgg 117158
to top
>dbj|AB056084.1| Oecophylla smaragdina mitochondrial cytb gene for cytochrome b,
           partial cds, specimen_voucher:Darwin (Hokkaido Univ.)
          Length = 647

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 315 tcctgataattttattcctg 334
to top
>dbj|AB056082.1| Oecophylla smaragdina mitochondrial cytb gene for cytochrome b,
           partial cds, specimen_voucher:Port Molesby (Hokkaido
           Univ.)
          Length = 647

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 315 tcctgataattttattcctg 334
to top
>dbj|AB056081.1| Oecophylla smaragdina mitochondrial cytb gene for cytochrome b,
           partial cds, specimen_voucher:Biak (Hokkaido Univ.)
          Length = 647

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 315 tcctgataattttattcctg 334
to top
>dbj|AB056080.1| Oecophylla smaragdina mitochondrial cytb gene for cytochrome b,
           partial cds, specimen_voucher:Cairns (Hokkaido Univ.)
          Length = 647

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 315 tcctgataattttattcctg 334
to top
>dbj|AB056076.1| Oecophylla smaragdina mitochondrial cytb gene for cytochrome b,
           partial cds, specimen_voucher:Rifle Creek (Hokkaido
           Univ.)
          Length = 647

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 512 tcctgataattttattcctg 531
           ||||||||||||||||||||
Sbjct: 315 tcctgataattttattcctg 334


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,121,017
Number of Sequences: 3902068
Number of extensions: 7121017
Number of successful extensions: 138174
Number of sequences better than 10.0: 84
Number of HSP's better than 10.0 without gapping: 84
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 138021
Number of HSP's gapped (non-prelim): 153
length of query: 639
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 616
effective length of database: 17,143,297,704
effective search space: 10560271385664
effective search space used: 10560271385664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top