>emb|AL031776.7|HS312L17 Human DNA sequence from clone RP1-312L17 on chromosome 6q22.2-23.1
Contains the 5' end of the FLJ14440 gene for
thrombospondin and a CpG island, complete sequence
Length = 108208
Score = 44.1 bits (22), Expect = 0.55
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Plus
Query: 567 tctctggtttagttaggaaatgatatattgggtt 600
|||||| |||||||||||| ||||||||||||||
Sbjct: 22268 tctctgatttagttaggaa-tgatatattgggtt 22300
>emb|AL049646.19|HSDJ568F9 Human DNA sequence from clone RP4-568F9 on chromosome 20 Contains the
ZNF133 gene for zinc finger protein 133, three novel genes,
the 3' end of the C20orf12 gene for chromosome 20 open
reading frame 12 and two CpG islands, complete sequence
Length = 155432
Score = 40.1 bits (20), Expect = 8.6
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 227 tttttcaacctcagtgttca 246
||||||||||||||||||||
Sbjct: 105413 tttttcaacctcagtgttca 105394
>dbj|AP001052.1| Homo sapiens genomic DNA, chromosome 21, clone:KB22A5, MX1-D21S171
region, complete sequence
Length = 145540
Score = 40.1 bits (20), Expect = 8.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 211 agatgggaatggtcgctttttcaa 234
|||||||||||||| |||||||||
Sbjct: 47989 agatgggaatggtccctttttcaa 48012
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,565,872
Number of Sequences: 3902068
Number of extensions: 5565872
Number of successful extensions: 106039
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 105822
Number of HSP's gapped (non-prelim): 214
length of query: 629
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 606
effective length of database: 17,143,297,704
effective search space: 10388838408624
effective search space used: 10388838408624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)